Next Article in Journal
Helicobacter pylori Virulence Factor Cytotoxin-Associated Gene A (CagA)-Mediated Gastric Pathogenicity
Next Article in Special Issue
Current Understandings on Magnesium Deficiency and Future Outlooks for Sustainable Agriculture
Previous Article in Journal
Circulating miR-99a-5p Expression in Plasma: A Potential Biomarker for Early Diagnosis of Breast Cancer
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Vitamin E Is Superior to Vitamin C in Delaying Seedling Senescence and Improving Resistance in Arabidopsis Deficient in Macro-Elements

College of Resources, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2020, 21(19), 7429; https://doi.org/10.3390/ijms21197429
Submission received: 31 August 2020 / Revised: 25 September 2020 / Accepted: 6 October 2020 / Published: 8 October 2020

Abstract

:
Nitrogen (N), phosphorus (P), and potassium (K) are three essential macro-elements for plant growth and development. Used to improve yield in agricultural production, the excessive use of chemical fertilizers often leads to increased production costs and ecological environmental pollution. Vitamins C and E are antioxidants that play an important role in alleviating abiotic stress. However, there are few studies on alleviating oxidative stress caused by macro-element deficiency. Here, we used Arabidopsis vitamin E synthesis-deficient mutant vte4 and vitamin C synthesis-deficient mutant vtc1 on which exogenous vitamin E and vitamin C, respectively, were applied at the bolting stage. In the deficiency of macro-elements, the Arabidopsis chlorophyll content decreased, malondialdehyde (MDA) content and relative electric conductivity increased, and reactive oxygen species (ROS) accumulated. The mutants vtc1 and vte4 are more severely stressed than the wild-type plants. Adding exogenous vitamin E was found to better alleviate stress than adding vitamin C. Vitamin C barely affected and vitamin E significantly inhibited the synthesis of ethylene (ETH) and jasmonic acid (JA) genes, thereby reducing the accumulation of ETH and JA that alleviated the senescence caused by macro-element deficiency at the later stage of bolting in Arabidopsis. A deficiency of macro-elements also reduced the yield and germination rate of the seeds, which were more apparent in vtc1 and vte4, and adding exogenous vitamin C and vitamin E, respectively, could restore them. This study reported, for the first time, that vitamin E is better than vitamin C in delaying seedling senescence caused by macro-element deficiency in Arabidopsis.

1. Introduction

During plant growth, metabolic activities, protein synthesis, vegetative growth, reproductive growth, and increased yield depend on an adequate supply of nitrogen (N) [1]. Insufficient N not only limits the growth of plants but also affects their morphogenesis [2]. N deficiency can also cause a decrease in photosynthetic efficiency, which in turn leads to a decrease in chlorophyll content and ribulose-1,5-bisphosphate oxygenase (Rubisco) activity [3]. Phosphorus (P) participates in the growth, development, and reproduction of plants, and plays an important role in life activities such as energy metabolism, photosynthesis, and signal transmission [4]. In the long-term evolutionary process, plants have developed more sophisticated strategies to better adapt to P starvation, including changes in the structure of the root system (reducing the growth of primary roots and promoting more lateral roots and root hairs) [5]. The formation of phosphate transporters increases the expression of the P transporter gene that leads to an induction of the secretion of organic acids, RNases, acid phosphatases (APases), and the accumulation of starch and anthocyanins, thereby enhancing plants’ resistance to P deficiency [6]. Potassium (K), a major element necessary for plants to complete their life cycles, also participates in many physiological processes. As an osmotic regulating substance, K participates in the rapid expansion of cells and promotes growth [7,8] and plays an important role in the transport of solutes through the phloem [9]. The transport process of sucrose solute from shoot to root and sink tissue in fruits requires K [10]. Wang and Wu [11] found that K is involved in the transmission of stress signals. For example, K deficiency induces the production of reactive oxygen species (ROS), affects resistance to disease and insect pests, and affects auxin synthesis [12]. The optimization of potassium nutritional status is very important for reducing the stress of biotic and abiotic stress [7]. Oxidation caused by ROS, such as superoxide ion (O2), hydrogen peroxide (H2O2), hydroxyl radicals (•OH), and singlet oxygen (1O2) in biotic and abiotic stresses, is the most common, and those oxidative stresses can cause significant damage to cells [13]. When plants are deficient in macro-elements (N, P, K), they will activate the antioxidant system as an abiotic stress response and cause a series of redox processes [14].
Hormones are very important for the regulation of senescence. On the one hand, environmental factors affect leaf senescence mainly due to the plant’s responses by hormones ethylene (ETH) and jasmonic acid (JA) [15,16]. On the other hand, the synergistic effects of various hormones can promote or inhibit leaf senescence [17,18,19,20,21,22,23]. The hormone JA is key in mediating plants’ responses to environmental factors and endogenous signal substances, and participates in a series of physiological activities such as plant growth, development, maturation, and senescence [15]. The JA pathway plays an important regulatory role in the process of plant senescence and yellowing, and regulates the accumulation of starch in plant photosynthesis and the expression of senescence-related genes [17]. During senescence, the expression of JA synthesis-related genes is up-regulated [18]. The hormone ETH is gaseous in nature. For normal-growing leaves, treatment with a very low concentration of ETH can induce shedding, and treatment with ETH inhibitor can delay leaf senescence [16]. A variety of biotic and abiotic stresses stimulate the massive synthesis of ethylene through transcriptional activation of the ASC (1-aminocyclopropane-1-carboxylic acid synthase) gene [19,20]. Gene EIN2 (ethylene insensitive 2) is a core member of the ethylene-signaling pathway that plays a role in the coordinated control of leaf senescence by JA [21]. The ETH response factor EIN3 acts on the downstream of EIN2. EIN3 can bind to the upstream of the ERF1 (ethylene response factor 1) promoter to regulate its transcription [22,23].
The content of vitamin E in plants is generally considered to be related to maturity and senescence. Studies have found that the old leaves of Arabidopsis plants contain high levels of α- and γ-tocopherols [24]. In lilies, the content of vitamin E increases as the petals age [25]. During senescence, plants face severe oxidative stress, leading to the increase in fatty acid free radicals. Increasing the content of vitamin E during senescence may be a strategy for plants to reduce stress [24]. At the same time, as a fat-soluble non-enzymatic antioxidant, vitamin E can effectively eliminate the production of ROS (mainly including 1O2 and •OH) by cooperating with other antioxidants [26]. Under stress conditions, the biosynthesis of vitamin E increases and provides better antioxidant protection by limiting the production of ROS [27].
Vitamin C is the most abundant and widely available water-soluble cellular antioxidant in plants [28]. Vitamin C can directly scavenge ROS or act as a substrate of ascorbate peroxidase (APX) to scavenge H2O2, allowing plants to avoid oxidative damage [29]. Moreover, vitamin C plays an important role in plant growth, development, and stress responses [30,31]. It is a cofactor for many enzymes, controls cell division, and affects cell expansion. It is also a regulator of plant senescence [32].
Vitamin E will irreversibly produce quinones and epoxides in the process of removing ROS, and chromogen alkoxy (TO•) will be produced during the conversion of lipid peroxy radicals (LOO•) [33]. With the participation of vitamin C through the ascorbic acid-glutathione cycle, these can be returned to vitamin E [34]. In addition, when plants are subjected to oxidative stress, vitamin E can effectively eliminate the production of ROS (mainly including 1O2 and •OH) by cooperating with other antioxidants (such as ascorbic acid) [35,36]. It can be seen that both vitamin E and vitamin C, as antioxidants, can remove ROS in plants and help plants resist oxidative damage under adversity stress. They are similar in function. Subtractive hybridization experiments have shown that a lack of N, P, and K can induce an upregulation of the GGR (geranylgeranyl reductase) gene in rape, which encodes a key enzyme involved in vitamin E synthesis [37]. This indicates that the deficiency of macro-elements may activate the antioxidant system in plants, such as increasing the expression of vitamin E in plants to resist a series of oxidative damage caused by macro-element deficiency [37].
At present, there are few studies on the mechanism of senescence caused by a deficiency in macro-elements. Vitamin C and vitamin E, as two kinds of antioxidants, are effective at alleviating oxidative stress and delaying senescence. However, no systematic comparison has been made between them. Therefore, in this study, vtc1 and vte4 were grown under a deficiency of macro-elements, and exogenous vitamin C and vitamin E were added as treatments. The results showed that both vitamin E and vitamin C could defer senescence caused by the deficiency of macro-elements. Vitamin E is superior to vitamin C in delaying senescence and improving plant resistance.

2. Results

2.1. Vitamin E and Vitamin C Defer Senescence Caused by the Deficiency of Macro-Elements in Arabidopsis

In order to explore the effects of vitamin C and vitamin E on the growth of mature Arabidopsis under macro-element deficiency, we first cultivated the experimental materials until bolting (25 days). Columbia ecotype Arabidopsis was used as the wild-type (WT), and vtc1 and vte4 were vitamin C and vitamin E synthetic-deficient mutants, respectively. In addition, 5 mM of vitamin E (WT+VE) and vitamin C solution (WT+VC) was sprayed on the WT every three days after bolting, representing the treatment of adding exogenous vitamin E and vitamin C. A part of each was removed to continue normal growth for the control (CK), and the rest were divided into three parts for the treatment of macro-element deficiency: deficiency of nitrogen (DN), deficiency of phosphorus (DP), and deficiency of potassium (DK).
After 10 days of macro-element deficiency (the 35th day), the leaves and seeds of Arabidopsis turned yellow and the chlorophyll content decreased (Figure 1A and Figure 2A). Under the CK condition, the degree of yellowing was the lowest; under DN treatment, the yellowing was the most prominent, followed by DP and DK treatment. Mutant vte4 is the most affected by the deficiency of macro-elements where the chlorophyll content is the lowest. The yellowing is alleviated in the wild-type materials treated with an exogenous addition of vitamin E (WT+VE). The level of vitamin C apparently had less effect on leaf yellowing and senescence caused by the deficiency of macro-elements because the senescence process of vtc1 and materials treated with exogenous vitamin C is the same as that of the WT (Figure 1A and Figure 2A).
After 20 days of macro-element deficiency (the 45th day), the senescence was further aggravated (Figure 1B and Figure 2B). Similar to the 10 days of deficiency of macro-elements, the degree of leaf yellowing in each treatment was DN>DP>DK>CK. Different from the result obtained after 10 days, after a longer period of stress, the leaves and seeds of vtc1 turned yellow and the chlorophyll was degraded. Although the vitamin E and vitamin C synthetic-deficient mutants vte4 and vtc1, respectively, had more severe stress than WT; an exogenous addition of vitamin E can only alleviate the stress caused by the deficiency of macro-elements (Figure 1A and Figure 2A).

2.2. Vitamin E and Vitamin C Relieve Oxidative Stress Caused by Macro-Element Deficiency by Removing Reactive Oxygen Species (ROS)

After 20 days of macro-element deficiency, the content of malondialdehyde (MDA) in Arabidopsis under DN, DP, DK treatments was significantly higher than that under CK conditions. Under DP treatment, the MDA content was the highest, followed by DP and DK treatments. The vte4 was most affected by the deficiency of macro-elements where the MDA content was the highest. Adding exogenous vitamin E effectively alleviated the oxidative damage caused by the stress, which is evident by the decrease in MDA content and electric conductivity (Figure 3).
In the vtc1 mutant, the MDA content was similar to that of the WT when the degree of oxidative damage is low (DN condition), indicating that the reduction in vitamin C synthesis did not aggravate the stress of Arabidopsis under conditions of macro-elements deficiency, and when the stress was more severe (DP and DK condition), the MDA content was higher than the WT. Different from vitamin E, adding exogenous vitamin C did not alleviate the damage caused by deficiency (Figure 3).
To more intuitively reflect the oxidative damage caused by the deficiency of macro-elements, we selected Arabidopsis leaves after 20 days of macro-element deficiency treatment. The selected leaves were measured for the production levels of two major ROS species, H2O2 and O2Ȓ, under macro-elements deficiency stress, by histochemical staining using nitro-blue tetrazolium (NBT) and 3,3’-diamino-benzidine (DAB), respectively (Figure 4). The vte4 mutant had the highest accumulation of H2O2 and O2 with the most severe oxidative damage, and after the addition of exogenous vitamin E, the ROS level became lower than the WT (Figure 4).
Vitamin E and vitamin C, as antioxidants, can remove ROS in plants and relieve the damage caused by oxidative stress. In vtc1 mutant, the expression of VTC2 is induced. Adding exogenous vitamin C inhibited the expression of VTC1 under CK and DN conditions and induced the expression of VTC1 and VTC2 under DP and DK conditions (Figure 5A,B). In vte4, the expression of GGR was significantly inhibited and the expression was significantly lower than that of the WT. Under CK, DN, and DK conditions, adding exogenous vitamin E induced the expression of VTE4 and GGR. In contrast, under DP conditions, adding exogenous vitamin E inhibited the expression of VTE4 and GGR (Figure 5C,D).

2.3. Vitamin E Inhibits the Expression of Ethylene and Jasmonic Acid under Macro-Element Deficiency

We tested the ethylene content and its related gene expression levels in Arabidopsis thaliana after 20 days of macro-element deficiency. The results showed that the ethylene content, the expression level of ethylene synthesis-related genes ACS2, ACO1, and signaling pathway-related genes EIN3 and ERF1 under DN, DP, and DK treatments were higher than in CK conditions. The expression level was the highest under DP treatment, followed by DK and DN treatments. The vte4 had the highest ethylene content and related gene expression levels, and the ethylene content after an exogenous addition of vitamin E treatments was lower than the WT. The level of vitamin C appeared to have little effect on the expression level of ethylene, because the senescence process of vtc1 and materials treated with exogenous vitamin C was the same as that of the WT (Figure 6). After 20 days of macro-element deficiency treatment, the content of the other hormone JA and the expression level of its related genes COI1 and PDF1.2 were induced by stress (expression level DP>DK>DN>CK). The expression level of JA in vtc1 and the materials treated with exogenous vitamin C were consistent with that of the WT, while in vte4 it was significantly higher than that of the WT. An exogenous addition of vitamin E reduced the expression level of JA (Figure 7).

2.4. Vitamin E and Vitamin C Reverse the Yield Reduction of Arabidopsis under Macro-Element Deficiency

The Arabidopsis was cultivated for 21 days and treated with DN, DP, and DK treatment, and samples were taken after the seeds were mature. Arabidopsis under DP conditions had the lowest yield, followed by DK, and DN. The yield in vtc1 and vte4 was lower than that in the WT, while adding exogenous vitamin C and vitamin E significantly increased the yield, and vitamin E had a more potent effect on increasing production (Figure 8A). The results showed that the seed weight DK<DP<DN<CK (Figure 8B), the number of seed pods per plant DP<DK<DN<CK (Figure 8C), and the length of seed pods had no effect on the yield (Figure 8D). The Arabidopsis seeds under the different treatments were counted, and it was found that the germination rate of the seeds is related to their growth status before harvest. Seed germination rate was DK<DP<DN<CK, and the seed germination rate of vtc1 and vte4 was significantly lower than WT, and adding exogenous vitamin C and vitamin E did not change the germination rate of seeds significantly (Figure 8E).

3. Discussion

Studies have shown that the lack of N, P, and K elements in mulberry will activate the antioxidant system and cause a series of redox processes [38]. When plants are under DK stress, ROS in plant cells increase. The lack of vitamin E and vitamin C can lead to increased oxidative damage in Arabidopsis thaliana [39,40], and the damage is more serious under DK conditions [11,41,42]. The lack of vitamin E appears earlier than the lack of vitamin C (Figure 1). It may be due to the yellowing and senescence caused by vitamin C deficiency that it takes longer to manifest [43]. The alleviation of macro-element deficiency mainly relies on endogenous vitamin C—an external addition of vitamin C has no obvious effect [29,44]. Contrastingly, an exogenous addition of vitamin E showed an alleviating effect to the senescence. It may because that vitamin E is a strong antioxidant, which can reduce the degree of oxidative damages suffered by plasma and chloroplasts during the senescence [45,46].
In this study, vitamin E eliminated ROS and improved Arabidopsis resistance better than vitamin C. Studies with mammal cells have shown that the IC50 of vitamin E to eliminate H2O2 is 690 μM, while that of vitamin C is 860 μM, indicating that vitamin E has strong antioxidant properties than vitamin C [47,48], although the data in plant cells are still lacking.
As an important component of chlorophyll molecules, nitrogen has an important influence on chlorophyll synthesis and chloroplast development. It regulates photosynthesis by influencing chloroplast development, chlorophyll synthesis, and photo-cooperative enzyme activity [49]. In this study, under DN conditions, Arabidopsis chlorophyll synthesis was hindered; therefore, a loss of green was most apparent in the leaf and pod.
We found that the seed weight and germination rate were the lowest under DK conditions, although the oxidative stress suffered by plant was not the most severe. DK stress can indirectly affect photosynthesis by affecting the transport of photosynthetic products. Research by Zhong et al. [50] showed that DK stress reduced the yield of grafted watermelon, which was manifested by a decrease in the weight of each fruit, and the total soluble solids, sucrose, total soluble sugar, vitamin C, lycopene, and β-carotene in the fruit. DK mainly affects watermelon fruit quality through metabolic processes and pathways. Among them, the K channel gene Cla020934 and the lycopene synthesis gene Cla009122 are significantly down-regulated, indicating that DK affects watermelon fruit quality at the transcription level [50]. Tomato fruit quality is also affected by K because the early response to K deficiency is related to the decrease in photosynthesis rate and the transport of assimilate from the source leaves [51]. K participates in the transportation of photosynthetic products, and potassium deficiency causes the transportation of sucrose to be blocked and accumulate in the leaves. Studies have found that K deficiency affects the assimilation output of cotton leaves, leading to the accumulation of sugar at the source. The accumulation of sugar in the leaves over-compensates for the lack of K in the tissue in terms of permeability, while the sink organs are in a hungry state, and the photosynthetic rate of the leaves is also reduced [52]. ROS mainly come from photosynthetic electron transport [38], and thus severe oxidative damages under DK conditions could be explained. Because of the growth arrest induced by DK treatment, the quality of seeds decreased and the accumulated nutrients were insufficient, so the seed germination showed the most significant decrease.
The yield per plant and pod number per plant decreased under DN, DP, and DK treatments, and the DP had the lowest of the three (Figure 8A,C), indicating that DP treatment decreased the seeding rate the most significantly. DP leads to a phenotype of less branching or less tillering, and therefore may affect pod development [7,9]. Interestingly, the yield per plant and pod number per plant of the seedlings treated with exogenous vitamin E were higher than those of the seedlings without vitamin E treatment (Figure 8A,C). In other words, vitamin E may promote pod development or fertilization. However, the roles of P and vitamin E in Arabidopsis fertilization and pod development have not been well studied, and so require more investigations.
Nevertheless, all declines in yield and germination induced by macro-element deficiencies could be partly reversed by the exogenous vitamin E treatment. Vitamin E plays a key role in limiting non-enzymatic lipid oxidation during Arabidopsis seed storage, germination, and early seedling development [40].
In seedlings, ETH-signaling has been shown to reduce ROS accumulation to protect seedlings against salt stress and photo-oxidative damage by activating antioxidant enzyme system and enhancing antioxidant contents [16,53]. Besides this stress resistant signaling pathway, a study has shown that ETH regulates vitamin C synthesis by inhibiting the expression of ABSCISIC ACID INSENSITIVE 4 (ABI4), promoting the transcription of VTC2 in Arabidopsis and vitamin C biosynthesis, and inhibiting the accumulation of ROS in Arabidopsis seedlings [54]. However, in this study, the accumulation of ROS activated the expression of ETH signals in senescent leaves, indicating that there are differences between ethylene and ROS signals in seedlings and mature Arabidopsis plants.
An ethylene-signaling mutant ein3 delayed the water stress-related increase in vitamin E and resulted in a 30% reduction in the levels of antioxidants, compared with the wild-type [55]. While an over-produced ethylene mutant, eto1-1, showed a 5-fold increase in vitamin E contents during leaf aging [55]. Thus, the perception and signal transduction of ETH may be involved in the regulation of vitamin E biosynthesis. On the contrary, here we showed that exogenous vitamin E repressed ethylene synthetic gene and ethylene-signaling gene expression, which might be attributed into its strong antioxidant capacity (see Discussion below).
There is little research on the relationship between JA and vitamin C and vitamin E. Both JA and ETH are related to senescence [15,16]. In this study, the expressions of ETH and JA are basically synchronized, indicating that ETH and JA may have similar signaling pathways in response to macro-element deficiency. When plants suffer from oxidative stress caused by a deficiency of macro-elements (or during senescence), ROS may function as a second messenger to induce JA and ETH biosynthesis [15,16]. Vitamin C and vitamin E are activated as antioxidants to remove ROS in plants, to avoid the accumulation of ETH and JA, and to delay the senescence of Arabidopsis. As an intermediate signaling molecule, ROS link vitamin E and vitamin C with ETH and JA, which reacts to senescence to form a chain-signaling pathway. In this process, vitamin E is faster and more effective than vitamin C in the removal of ROS.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

Arabidopsis mutants were soaked with 2 mg/L gibberellin solution, vernalized for 2 days under dark conditions at 4 °C, and then sown in pots containing vermiculite. Then the seedlings were grown in a culture room (temperature 23 °C; humidity 70%; light intensity 100 μmol·m−2·s−1; photoperiod 16 h light/8 h dark). A 1/2 MS nutrient solution (10 mM NH4NO3, 9.4 mM KNO3 and 0.5 mM KH2PO4) was irrigated every 3 days. After seedlings bolting (the 25th day), the treatments of macro-element deficiency were started by replacing the 1/2 MS nutrient solution with nutrient deficiency solutions. For the N deficiency (DN) treatment, NH4NO3 was removed and 9.4 mM KNO3 was replaced by 9.4 mM KCl; for the of P-deficient (DP) treatment, 0.5 mM KH2PO4 was replaced by 0.5 mM KCl; for the K-deficient (DK) treatment, 9.4 mM KNO3 was replaced by 9.4 mM NaNO3 and 0.5 mM KH2PO4 was replaced by 0.5 mM NaH2PO4. At the same time of nutrient deficiency treatments, the wild-type Arabidopsis leaves were sprayed with 5 mmol/L vitamin E solution or 5 mmol/L vitamin C solution (every 3 days), representing the exogenous vitamin E treatment and the exogenous vitamin C treatment, respectively.

4.2. Determination of Chlorophyll Contents

On the 35th day and 45th day after germination (10 days and 20 days of nutrient deficiency treatments, respectively), the rosette leaves and seed pods were harvested for chlorophyll determination. For the leaves, 0.2 g materials were ground into 4 mL of acetone/ethanol (v/v, 1:1) mixture, and incubated for 24 h in the dark. For seed pods, 0.2 g materials were ground into powder by liquid nitrogen, 1 mL of acetone/ethanol (v/v, 1:1) mixture was added, vortexed and mixed for 30 s, then they were centrifuged at 4 °C, 8000 rpm for 10 min. The absorbance at wavelengths of 470, 646 and 663 nm of the supernatant was measured. The chlorophyll contents were calculated according to Porra et al. [56].

4.3. Determination of Ethylene Contents

On the 45th day after germination (20 days of nutrient deficiency treatments), the seedlings were harvested for ethylene determination. Ethylene estimation was performed according to Datta et al. [57]. Leaves were incubated in a 20-mL gas chromatographic box at 20 °C for 1 day. The box was flushed with ethylene-free air and sealed then. The ethylene level was detected with a gas chromatograph (GC-2010, Shimadzu Comp., Kyoto, Japan) equipped with a Pora-PLOT U column. The samples were injected into the column, which was pre-warmed at 30 °C. The ethylene content was quantified according to the standard sample.

4.4. Determination of Jasmonic Acid Contents

On the 45th day after germination (20 days of nutrient deficiency treatments), the seedlings were harvested for jasmonic acid determination. A total of 0.5 g leaves were ground into powder by liquid nitrogen and transferred into a 10 mL centrifuge tube, 2 mL of 80% methanol aqueous solution containing 0.5% formic acid was added, and the jasmonic acid was ultrasonically extracted at 4 °C for 30 min and then incubated overnight. After centrifuging at 12,000 rpm at 4 °C for 15 min, the supernatant was rotated and depressurized at 38 °C for evaporation and then frozen at −20 °C for 30 min. The thawing sample was centrifuged at 12,000 rpm at 4 °C for 10 min, the pigments and lipid insolubles were discarded, and then the supernatant was shaken vigorously for 30 s, and centrifuged at 4000 rpm for 5 min. The supernatant was concentrated and dried with a nitrogen blower, and reconstituted in 1.0 mL acetonitrile solution, ultrasonicated for 30 s, and filtered through a 0.22 μm microporous membrane. The liquid chromatography–TurboIon Spray tandem mass spectrometric (LC/MS/MS) analysis was performed on an Agilent 1100 LC equipped with an MDS/Sciex API 3000 triple-quadrupole mass spectrometer (MDS/Sciex, Thornhill, ON, Canada). The experimental parameters were set as Kristl et al. [58] described.

4.5. Quantitative Real-Time PCR

On the 45th day after germination (20 days of nutrient deficiency treatments), the seedlings were harvested for RNA extraction with the TRIzol™ Plus RNA Purification Kit (Invitrogen, Carlsbad, CA, USA). All RNA samples were treated with DNase I before RT-PCR. For each sample, 1 μg RNA was subjected to cDNA synthesis by using SYBR Premix Ex Taq (Takara Biotechnology Dalian Co., Ltd. Dalian, China). Then the quantitative PCR (qPCR) was performed with the EmeraldAmp MAX PCR Master Mix (Takara Biotechnology). The threshold cycle (Ct), defined as the PCR cycles when the product could be first detected, was measured to the determine relative expression levels of target genes [59]. Three biological replicates with three technical repetitions were performed for each sample. ACTIN7 gene was used as an internal control. Normalization of qPCR data was achieved by subtracting the Ct value of the internal reference gene from the Ct values of the target genes to get ΔCt [60]. The individual gene expression levels were presented as the fold-changes relatively to ACTIN7 expression levels (2ΔCt). The expression level of the WT in the control sample (CK) was normalized into “1.0”. All primers are listed in Table 1.

4.6. Oxidative Damage Measurements

Histochemical staining for hydrogen peroxide or superoxide in 45-day-old seedlings (20 days of nutrient deficiency treatments) was performed by incubation with 3,3’-diamino-benzidine (DAB) or nitro-blue tetrazolium (NBT), respectively, for 2–4 h according to the procedure as previously described [61,62]. Stained leaves were boiled in 80% ethanol for decoloration of chlorophylls and scanned.
The quantitative level of O2 was detected with the method as described previously [63] via monitoring the NH2OH to NO3 conversion. The quantitative level of H2O2 was detected with the method as described previously [64] through a chromogenic reaction with trichloroacetic acid (TCA). The level of oxidative damage to the cytomembrane (lipid peroxidation) was assessed by detecting the malondialdehyde (MDA) concentrations with the method as described previously [65]. Electrolyte leakage was measured by a conductivity meter (DDSJ-319L, INESA Scientific Instrument Co., Ltd., Shanghai, China).

4.7. Germination Rate Determination

After harvesting the Arabidopsis thaliana seeds under each treatment condition, the seeds were vernalized for 2 days under dark conditions at 4 °C. Then the seeds were disinfected with 75% ethanol and 0.1% mercury (HgCl2 solution) on an ultraclean workbench. The seeds were sowed evenly (1 cm apart) on 1/2 MS medium, and sealed with parafilm to ensure that the seeds grew under aseptic conditions. The sealed medium was transferred to a light culture room for cultivation (temperature 23 °C; humidity 70%; light intensity 100 μmol·m−2·s−1; photoperiod 16 h light/8 h dark), and the number of seeds germinated after 5 days was counted.

4.8. Statistical Analysis

A total of 3-5 independent replicates were conducted for each measurement. The statistical analysis was carried out with the software SPSS 19.0 (IBM Comp., Chicago, IL, USA). The Duncan’s multiple range test was performed to compare the means. p < 0.05 was used to estimate a statistically significant difference. Error bars in the figures represent the standard error of the mean (SEM).

Author Contributions

Conceptualization, S.Y. and Z.-W.Z.; methodology, Z.-W.Z., X.-Y.Y., X.-J.Z. and Y.-F.F.; formal analysis, X.-Y.Y., X.-J.Z., Y.-F.F., T.L. and X.-Y.T.; investigation, C.-Q.W., G.-D.C. and J.Z.; data curation, Z.-W.Z., X.-Y.Y. and S.Y.; writing—original draft preparation, X.-Y.Y. and S.Y.; writing—review and editing, all authors; supervision, C.-Q.W.; funding acquisition, S.Y. and Z.-W.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (31770322) to S.Y., the Project of Sichuan Province Youth Science and Technology Innovation Team (20CXTD0062) to S.Y. and the Applied Basic Research Program of Sichuan Province (20YYJC4388) to Z.-W.Z.

Acknowledgments

We would like to thank for providing linguistic assistance during the preparation of this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cechin, I.; Tdef, F. Effect of nitrogen supply on growth and photosynthesis of sunflower plants grown in the greenhouse. Plant Sci. 2004, 166, 1379–1385. [Google Scholar] [CrossRef]
  2. Fetene, M.; Möller, I.; Beck, E. The effect of nitrogen supply to Urtica dioica L. plants on the distribution of assimilate between shoot and roots. Plant Biol. 2015, 106, 228–234. [Google Scholar]
  3. Tóth, V.R.; Mészáros, I.; Veres, S.; Nagy, J. Effects of the available nitrogen on the photosynthetic activity and xanthophyll cycle pool of maize in field. J Plant Physiol. 2002, 159, 627–634. [Google Scholar] [CrossRef]
  4. Yu, B.; Xu, C.; Benning, C. Arabidopsis disrupted in SQD2 encoding sulfolipid synthase is impaired in phosphate-limited growth. Proc. Natl. Acad. Sci. USA 2002, 99, 5732–5737. [Google Scholar] [CrossRef] [Green Version]
  5. Yuan, H.; Liu, D. Signaling components involved in plant responses to phosphate starvation. J. Integr. Plant Biol. 2008, 50, 849–859. [Google Scholar] [CrossRef] [PubMed]
  6. Lei, M.; Zhu, C.; Liu, Y.; Karthikeyan, A.S.; Bressan, R.A.; Kashchandra, K.G.; Liu, D. Ethylene signalling is involved in regulation of phosphate starvation-induced gene expression and production of acid phosphatases and anthocyanin in Arabidopsis. New Phytol. 2011, 189, 1084–1095. [Google Scholar] [CrossRef]
  7. Amtmann, A.; Hammond, J.P.; Armengaud, P.; White, P.J. Nutrient sensing and signalling in plants: potassium and phosphorus. Adv. Bot. Res. 2005, 43, 209–257. [Google Scholar]
  8. Amtmann, A.; Troufflard, S.; Armengaud, P. The effect of potassium nutrition on pest and disease resistance in plants. Physiol. Plant. 2008, 133, 682–691. [Google Scholar] [CrossRef]
  9. Amtmann, A.; Armengaud, P. Effects of N, P, K and S on metabolism: new knowledge gained from multi-level analysis. Curr. Opin. Plant Biol. 2009, 12, 275–283. [Google Scholar] [CrossRef]
  10. Etienne, A.; Génard, M.; Lobit, P.; Mbeguié-A-Mbéguié, C.; Bugaud, C. What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. Curr. Opin. Plant Biol. 2013, 64, 1451–1469. [Google Scholar] [CrossRef] [Green Version]
  11. Wang, Y.; Wu, W.H. Plant sensing and signaling in response to K+-deficiency. Mol Plant. 2010, 3, 280–287. [Google Scholar] [CrossRef] [PubMed]
  12. Troufflard, S.; Mullen, W.; Larson, T.R.; Graham, I.A.; Crozier, A.; Amtmann, A.; Armengaud, P. Potassium deficiency induces the biosynthesis of oxylipins and glucosinolates in Arabidopsis thaliana. BMC Plant Biol. 2010, 10, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Baxter, A.; Mittler, R.; Suzuki, N. ROS as key players in plant stress signalling. J. Exp. Bot. 2014, 65, 1229–1240. [Google Scholar] [CrossRef] [PubMed]
  14. Tewari, R.K.; Kumar, P.; Sharma, P.N. Oxidative stress and antioxidant responses in young leaves of mulberry plants grown under nitrogen, phosphorus or potassium deficiency. J. Integr. Plant Biol. 2007, 49, 313–322. [Google Scholar] [CrossRef]
  15. He, Y.; Fukushige, H.; Hildebrand, D.F.; Gan, S. Evidence supporting a role of jasmonic acid in Arabidopsis leaf senescence. Plant Physiol. 2002, 128, 876–884. [Google Scholar] [CrossRef] [Green Version]
  16. Peng, J.; Li, Z.; Wen, X.; Li, W.; Shi, H.; Yang, L.; Zhu, H. Salt-induced stabilization of EIN3/EIL1 confers salinity tolerance by deterring ROS accumulation in Arabidopsis. PLoS Genet. 2014, 10, e1004664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Sarwat, M.; Naqvi, A.R.; Ahmad, P.; Ashrafd, M.; Akram, N.A. Phytohormones and microRNAs as sensors and regulators of leaf senescence: Assigning macro roles to small molecules. Biotechnol. Adv. 2013, 31, 1153–1171. [Google Scholar] [CrossRef]
  18. Yan, J.X.; Deng, Y.A.; Yu, J.; Zhang, Y.Q.; Chi, D.F. A study on JA-and BTH-induced resistance of Rosa rugosa ‘Plena’ to powdery mildew (Sphaerotheca pannosa). J. Forest Res. 2018, 29, 823–831. [Google Scholar] [CrossRef]
  19. Peng, H.P.; Lin, T.Y.; Wang, N.N.; Shih, M.C. Differential expression of genes encoding 1-aminocyclopropane-1-carboxylic synthase in Arabidopsis during hypoxia. Plant Mol. Biol. 2005, 58, 15–25. [Google Scholar] [CrossRef]
  20. Tsuchisaka, A.; Yu, G.; Jin, H.; Alonso, J.M.; Ecker, J.R.; Zhang, X.; Gao, S.; Theologis, A. A combinatorial interplay among the 1-aminocyclopropane-1-carboxylate isoforms regulates ethylene biosynthesis in Arabidopsis thaliana. Genetics 2009, 183, 979–1003. [Google Scholar] [CrossRef] [Green Version]
  21. Kim, J.H.; Chung, K.M.; Woo, H.R. Three positive regulators of leaf senescence in Arabidopsis, ORE1, ORE3 and ORE9, play roles in crosstalk among multiple hormone-mediated senescence pathways. Genes Genom. 2011, 33, 373–381. [Google Scholar] [CrossRef]
  22. Li, Z.H.; Peng, J.Y.; Wen, X.; Guo, H.W. ETHYLENE-INSENSITIVE3 is a senescence-associated gene that accelerates age-dependent leaf senescence by directly repressing miR164 transcription in Arabidopsis. Plant Cell 2013, 25, 3311–3328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Qiu, K.; Li, Z.P.; Yang, Z.; Chen, J.Y.; Wu, S.X.; Zhu, X.Y.; Gao, S.; Gao, J.; Ren, G.D.; Kuai, B.K.; et al. EIN3 and ORE1 accelerate degreening during ethylene-mediated leaf senescence by directly activating chlorophyll catabolic genes in Arabidopsis. PLoS Genet. 2015, 11, e1005399. [Google Scholar] [CrossRef] [PubMed]
  24. Holländer-Czytko, H.; Grabowski, J.; Sandorf, I.; Weckermann, K.; Weiler, E.W. Tocopherol content and activities of tyrosine aminotransferase and cystine lyase in Arabidopsis under stress conditions. J. Plant Physiol. 2005, 162, 767–770. [Google Scholar] [CrossRef]
  25. Arrom, L.; Munné-Bosch, S. Tocopherol composition in flower organs of Lilium and its variations during natural and artificial senescence. Plant Sci. 2010, 179, 289–295. [Google Scholar] [CrossRef]
  26. Lushchak, V.I.; Semchuk, N.M. Tocopherol biosynthesis: Chemistry, regulation and effects of environmental factors. Acta Physiol. Plant. 2012, 34, 1607–1628. [Google Scholar] [CrossRef]
  27. Semchuk, N.M.; Lushchak, V.; Falk, J.; Krupinskab, K.; Lushchaka, V.I. Inactivation of genes, encoding tocopherol biosynthetic pathway enzymes, results in oxidative stress in outdoor grown Arabidopsis thaliana. Plant Physiol. Biochem. 2009, 47, 384–390. [Google Scholar] [CrossRef]
  28. Khan, T.A.; Mazid, M.; Mohammad, F. Potential of ascorbic acid against oxidative burst in plants under biotic stress: A Review. J. Ind. Res. Tech. 2012, 2, 72–80. [Google Scholar]
  29. Boubakri, H.; Gargouri, M.; Mliki, A.; Brini, F.; Chong, Z.L.; Jbara, M. A vitamins for enhancing plant resistance. Planta 2016, 244, 529–546. [Google Scholar] [CrossRef]
  30. Upadhyaya, C.P.; Akula, N.; Young, K.E.; Chun, S.C.; Kim, D.H.; Park, S.W. Enhanced ascorbic acid accumulation in transgenic potato confers tolerance to various abiotic stresses. Biotechnol. Lett. 2010, 32, 321–330. [Google Scholar]
  31. Zhang, Z.; Wang, J.; Zhang, R.; Huang, R. The ethylene response factor AtERF98 enhances tolerance to salt through the transcriptional activation of ascorbic acid synthesis in Arabidopsis. Plant J. 2012, 71, 273–287. [Google Scholar] [CrossRef] [PubMed]
  32. Dell’Aglio, E.; Mhamdi, A. What are the roles for dehydroascorbate reductases and glutathione in sustaining ascorbate accumulation? Plant Physiol. 2020, 183, 11–12. [Google Scholar] [CrossRef] [PubMed]
  33. Munné-Bosch, S. The role of α-tocopherol in plant stress tolerance. J. Plant Physiol. 2005, 162, 743–748. [Google Scholar] [CrossRef] [PubMed]
  34. Foyer, C.H.; Noctor, G. Ascorbate and glutathione: The heart of the redox hub. Plant Physiol. 2011, 155, 2–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Li, Y.; Zhou, Y.; Wang, Z.; Sun, X.; Tang, K. Engineering tocopherol biosynthetic pathway in Arabidopsis leaves and its effect on antioxidant metabolism. Plant Sci. 2010, 178, 312–320. [Google Scholar] [CrossRef]
  36. Ruiz-Sola, M.Á.; Coman, D.; Beck, G.M.; Barja, M.V.; Colinas, M.; Graf, A.; Welsch, R.; Rütimann, P.; Bühlmann, P.; Bigler, L.; et al. Arabidopsis GERANYLGERANYL DIPHOSPHATE SYNTHASE 11 is a hub isozyme required for the production of most photosynthesis-related isoprenoids. New Phytol. 2015, 209, 252–264. [Google Scholar] [CrossRef] [PubMed]
  37. Shpilyov, A.V.; Zinchenko, V.V.; Shestakov, S.V.; Grimm, B.; Lokstein, H. Inactivation of the geranylgeranyl reductase (ChlP) gene in the cyanobacterium Synechocystis sp. PCC 6803. Biochim. Biophys. Acta Bioenerget. 2005, 1706, 195–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Waraich, E.A.; Ahmad, R.; Halim, A.; Aziz, T. Alleviation of temperature stress by nutrient management in crop plants. J. Plant Nutr. Soil Sci. 2012, 12, 221–244. [Google Scholar] [CrossRef] [Green Version]
  39. Sattler, S.E.; Cheng, Z.; DellaPenna, D. From Arabidopsis to agriculture: Engineering improved Vitamin E content in soybean. Trends Plant Sci. 2004, 9, 365–367. [Google Scholar] [CrossRef]
  40. Sattler, S.E.; Mène-Saffrané, L.; Farmer, E.E.; Krischke, M.; Mueller, M.J.; DellaPenna, D. Nonenzymatic lipid peroxidation reprograms gene expression and activates defense markers in Arabidopsis tocopherol-deficient mutants. Plant Cell 2006, 18, 3706–3720. [Google Scholar] [CrossRef] [Green Version]
  41. Cakmak, I. The role of potassium in alleviating detrimental effects of abiotic stresses in plants. J. Plant Nutr. Soil Sci. 2005, 168, 521–530. [Google Scholar] [CrossRef]
  42. Römheld, V.; Kirkby, E.A. Research on potassium in agriculture: Needs and prospects. Plant Soil. 2010, 335, 155–180. [Google Scholar] [CrossRef]
  43. Abbasi, A.R.; Saur, A.; Hennig, P.; Tschiersch, H.; Hajirezaei, M.; Hofius, D.; Sonnewald, U.; Voll, L.M. Tocopherol deficiency in transgenic tobacco (Nicotiana tabacum L.) plants leads to accelerated senescence. Plant Cell Environ. 2009, 32, 144–157. [Google Scholar] [CrossRef]
  44. Caretto, S.; Nisi, R.; Paradiso, A.; Gara, L.D. Tocopherol production in plant cell cultures. Mol. Nutr. Food Res. 2010, 54, 726–730. [Google Scholar] [CrossRef] [PubMed]
  45. Miret, J.A.; Munné-Bosch, S. Redox signaling and stress tolerance in plants: A focus on Vitamin E. Ann. N. Y. Acad. Sci. 2015, 1340, 29–38. [Google Scholar] [CrossRef] [PubMed]
  46. Jabeen, F.; Saleemi, S.; Razzaq, H.; Yaqub, A.; Shakoor, S.; Qureshi, R. Investigating the scavenging of reactive oxygen species by antioxidants via theoretical and experimental methods. J. Photochem. Photobiol. B. 2018, 180, 268–275. [Google Scholar] [CrossRef]
  47. Siu, A.W.; Reiter, R.J.; To, C.H. The efficacy of vitamin E and melatonin as antioxidants against lipid peroxidation in rat retinal homogenates. J. Pineal. Res. 1998, 24, 239–244. [Google Scholar] [CrossRef]
  48. Zhang, Z.W.; Xu, X.C.; Liu, T.; Yuan, S. Mitochondrion-permeable antioxidants to treat ROS-burst-mediated acute diseases. Oxid. Med. Cell. Longev. 2016, 2016, 6859523. [Google Scholar] [CrossRef] [Green Version]
  49. Nozomi, N.; Ryouichi, T.; Soichirou, S. Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus species. Plant Cell 2005, 17, 233–240. [Google Scholar]
  50. Zhong, Y.Q.; Chen, C.; Nawaz, M.A.; Jiao, Y.Y.; Zheng, Z.H.; Shi, X.F.; Xie, W.Y.; Yu, Y.G.; Guo, J.; Zhu, S.H.; et al. Using rootstock to increase watermelon fruit yield and quality at low-K supply: A comprehensive analysis from agronomic, physiological and transcriptional perspective. Sci. Hortic. 2018, 241, 144–151. [Google Scholar] [CrossRef]
  51. Obed, I.; Hernández-Pérez, L.A.; Aguilar, V.; Alia-Tejacal, I.; Andrew, D.C.; Donita, L.C. Tomato fruit yield, quality, and nutrient status in response to potassium: Calcium balance and electrical conductivity in the nutrient solution. J. Soil Sci. Plant Nutr. 2020, 20, 484–492. [Google Scholar]
  52. Edward, G.; Lionel, J.M.; Constantin, J.; Sylvain, P.; Michael, D. Changes in plant morphology and dry matter partitioning caused by potassium deficiency in Gossypium hirsutum (L.). Environ. Exp. Bot. 2010, 67, 451–459. [Google Scholar]
  53. Zhong, S.; Zhao, M.; Shi, T.; Shi, H.; An, F.; Zhao, Q.; Guo, H. EIN3/EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. Proc. Natl. Acad. Sci. USA 2009, 106, 21431–21436. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Yu, Y.W.; Wang, J.; Li, S.H.; Kakan, X.; Zhou, Y.; Miao, Y.; Wang, F.F.; Qin, H.; Huang, R.F. Ascorbic acid integrates the antagonistic modulation of ethylene and abscisic acid in the accumulation of reactive oxygen species. Plant Physiol. 2019, 179, 1861–1875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Cela, J.; Falk, J.; Munné-Bosch, S. Ethylene signaling may be involved in the regulation of tocopherol biosynthesis in Arabidopsis thaliana. FEBS Lett. 2009, 583, 992–996. [Google Scholar] [CrossRef] [Green Version]
  56. Porra, R.J.; Thompson, W.A.; Kriedmann, P.E. Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: Verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim. Biophys. Acta 1989, 975, 384–394. [Google Scholar] [CrossRef]
  57. Datta, R.; Kumar, D.; Sultana, A.; Hazra, S.; Bhattacharyya, D.; Chattopadhyay, S. Glutathione regulates 1-aminocyclopropane-1-carboxylate synthase transcription via WRKY33 and 1-aminocyclopropane-1-carboxylate oxidase by modulating messenger RNA stability to induce ethylene synthesis during stress. Plant Physiol. 2015, 169, 2963–2981. [Google Scholar]
  58. Kristl, J.; Veber, M.; Krajničič, B.; Orešnik, K.; Slekovec, M. Determination of jasmonic acid in Lemna minor (L.) by liquid chromatography with fluorescence detection. Anal Bioanal. Chem. 2005, 383, 886–893. [Google Scholar] [CrossRef]
  59. Yuan, S.; Zhang, Z.W.; Zheng, C.; Zhao, Z.Y.; Wang, Y.; Feng, L.Y.; Niu, G.; Wang, C.Q.; Wang, J.H.; Feng, H.; et al. Arabidopsis cryptochrome 1 functions in nitrogen regulation of flowering. Proc. Natl. Acad. Sci. USA 2016, 113, 7661–7666. [Google Scholar] [CrossRef] [Green Version]
  60. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  61. Suorsa, M.; Järvi, S.; Grieco, M.; Nurmi, M.; Pietrzykowska, M.; Rantala, M.; Kangasjärvi, S.; Paakkarinen, V.; Tikkanen, M.; Jansson, S.; et al. PROTON GRADIENT REGULATION5 is essential for proper acclimation of Arabidopsis photosystem I to naturally and artificially fluctuating light conditions. Plant Cell 2012, 24, 2934–2948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Zhao, Y.; Han, Q.; Ding, C.; Huang, Y.; Liao, J.; Chen, T.; Feng, S.; Zhou, L.; Zhang, Z.; Chen, Y.; et al. Effect of low temperature on chlorophyll biosynthesis and chloroplast biogenesis of rice seedlings during greening. Int. J. Mol. Sci. 2020, 21, 1390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: a simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef]
  64. Velikova, V.; Yordanov, I.; Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants. Protective role of exogenous polyamines. Plant Sci. 2002, 151, 59–66. [Google Scholar] [CrossRef]
  65. Havaux, M.; Eymery, F.; Porfirova, S.; Rey, P.; Dormann, P. Vitamin E protects against photoinhibition and photooxidative stress in Arabidopsis thaliana. Plant Cell 2005, 17, 3451–3469. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Leaf phenotypes and chlorophyll contents of Arabidopsis thaliana at the 35th day (A) and the 45th day (B) after germination. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. Bar = 1 cm. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 1. Leaf phenotypes and chlorophyll contents of Arabidopsis thaliana at the 35th day (A) and the 45th day (B) after germination. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. Bar = 1 cm. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g001
Figure 2. Seed pod phenotypes and chlorophyll contents of Arabidopsis thaliana at the 35th day (A) and the 45th day (B) after germination. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. Bar = 1 cm. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 2. Seed pod phenotypes and chlorophyll contents of Arabidopsis thaliana at the 35th day (A) and the 45th day (B) after germination. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. Bar = 1 cm. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g002
Figure 3. Malondialdehyde (MDA) content (A) and relative electric conductivity (B) of 45-day-old seedlings (20 days of nutrient deficiency treatments). CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 3. Malondialdehyde (MDA) content (A) and relative electric conductivity (B) of 45-day-old seedlings (20 days of nutrient deficiency treatments). CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g003
Figure 4. O2 (A) and H2O2 (B) accumulation levels in 45-day-old seedlings (20 days of nutrient deficiency treatments). Histochemical assays for superoxide anion radicals (O2) and H2O2 were performed by nitro-blue tetrazolium (NBT) and 3,3’-diamino-benzidine (DAB) staining, respectively. Quantitative data are presented below the staining images. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 4. O2 (A) and H2O2 (B) accumulation levels in 45-day-old seedlings (20 days of nutrient deficiency treatments). Histochemical assays for superoxide anion radicals (O2) and H2O2 were performed by nitro-blue tetrazolium (NBT) and 3,3’-diamino-benzidine (DAB) staining, respectively. Quantitative data are presented below the staining images. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. FW, fresh weight. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g004
Figure 5. Relative expression of vitamin C synthetic genes VTC1 (A) and VTC2 (B) and vitamin E synthetic genes VTE4 (C) and GGR (D) in 45-day-old seedlings (20 days of nutrient deficiency treatments). CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. VTC1, Vitamin C defective 1; VTC2, Vitamin C defective 2; VTE4, Vitamin E defective 4; GGR, Geranylgeranyl Reductase. The specific gene expression levels are represented as the percentages relatively to ACTIN7 expression levels. The expression level of WT in the control sample (CK) was normalized into “1.0”. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 5. Relative expression of vitamin C synthetic genes VTC1 (A) and VTC2 (B) and vitamin E synthetic genes VTE4 (C) and GGR (D) in 45-day-old seedlings (20 days of nutrient deficiency treatments). CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. VTC1, Vitamin C defective 1; VTC2, Vitamin C defective 2; VTE4, Vitamin E defective 4; GGR, Geranylgeranyl Reductase. The specific gene expression levels are represented as the percentages relatively to ACTIN7 expression levels. The expression level of WT in the control sample (CK) was normalized into “1.0”. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g005
Figure 6. Relative expression of ethylene synthetic genes ACS2 (A) and ACO1 (B) and ethylene-signaling genes EIN3 (C) and ERF1 (D) and ethylene contents (E) in 45-day-old seedlings. ACS2, 1-Aminocyclopropane-1 -Carboxylic acid Synthase 2; ACO1, 1-Aminocyclopropane-1-Carboxylate Oxidase 1; EIN3, Ethylene Insensitive 3; ERF1, Ethylene Response Factor 1. The expression level of WT in the control sample (CK) was normalized into “1.0”. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 6. Relative expression of ethylene synthetic genes ACS2 (A) and ACO1 (B) and ethylene-signaling genes EIN3 (C) and ERF1 (D) and ethylene contents (E) in 45-day-old seedlings. ACS2, 1-Aminocyclopropane-1 -Carboxylic acid Synthase 2; ACO1, 1-Aminocyclopropane-1-Carboxylate Oxidase 1; EIN3, Ethylene Insensitive 3; ERF1, Ethylene Response Factor 1. The expression level of WT in the control sample (CK) was normalized into “1.0”. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g006
Figure 7. Relative expression of jasmonic acid synthetic gene COI1 (A) and jasmonic acid-signaling gene PDF1.2 (B) and jasmonic acid contents (C) in 45-day-old seedlings (20 days of nutrient deficiency treatments). COL1, CONSTANS-Like 1; PDF1.2, Plant Defensin 1.2. The expression level of WT in the control sample (CK) was normalized into “1.0”. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 7. Relative expression of jasmonic acid synthetic gene COI1 (A) and jasmonic acid-signaling gene PDF1.2 (B) and jasmonic acid contents (C) in 45-day-old seedlings (20 days of nutrient deficiency treatments). COL1, CONSTANS-Like 1; PDF1.2, Plant Defensin 1.2. The expression level of WT in the control sample (CK) was normalized into “1.0”. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g007
Figure 8. Yield per plant (A), 1000 seed weight (B), pod number per plant (C), length of pod (D), and seed germination rate (E) of Arabidopsis plants after macro-element deficiency treatments. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Figure 8. Yield per plant (A), 1000 seed weight (B), pod number per plant (C), length of pod (D), and seed germination rate (E) of Arabidopsis plants after macro-element deficiency treatments. CK, DN, DP, DK represent normal, deficiency of nitrogen, deficiency of phosphorus, and deficiency of potassium treatments, respectively. vtc1 and vte4 are vitamin C and vitamin E synthetic deletion mutants, respectively. WT+VC and WT+VE represent treatments of 5 mM exogenous vitamin C and vitamin E, respectively, to the wild-type (WT) plants. The data represent average values ± SEM (n = 3). Different small letters show significant differences (p < 0.05).
Ijms 21 07429 g008
Table 1. The PCR primers sequences.
Table 1. The PCR primers sequences.
GeneLocusThe Forward Primer SequencesThe Reverse Primer Sequences
VTC1At2g39770GGCAACCCCGTGACTACATAACCCAATCAAACATCCTTCCCCAA
VTC2At4g26850GGTCGTCACTTGAAGAAGAGGCGGGAAGAACTGAACTTGGGCAT
VTE4At1g64970AGCAGCACCCTCTTCTCTCACACCCAAATCTCTTCCCACAAACC
GGRAt4g38460ATGGTGGAGCAGAGAAGGGAATAGGTGGTAGCGAAGATGAATGG
ACS2At1g01480GTGTCTCCTGGCTCTTCCTTCCGCCGTCAAAAACAACCCTAATG
ACO1At2g19590TCCTGAGCTTATGAGAGGGCTGAATGGTATTGTTCTTGGATGGC
EIN3At3g20770ACAACAATAACAGTAGCGGCAACAAGCGATAGAGACAGAGAGACCCAG
ERF1At3g23240GCAGTCCACGCAACAAACCTACTTGAACTCTCTCCGCCGAAA
PDF1.2At5g44420CTTGTTCTCTTTGCTGCTTTCGCATGATCCATGTTTGGCTCCTT
COL1At5g15850AATGGCTTCTCGATTGGGGATTGGAGGGTAAGGTGGTTGGTC
ACT7At5g09810ATCCCTCAGCACCTTCCAACACCCGATACTTAAATAATTGTCTCAT
VTC1, Vitamin C defective 1; VTC2, Vitamin C defective 2; VTE4, Vitamin E defective 4; GGR, Geranylgeranyl Reductase; ACS2, 1-Aminocyclopropane-1-Carboxylic acid Synthase 2; ACO1, 1-Aminocyclopropane-1-Carboxylate Oxidase 1; EIN3, Ethylene Insensitive 3; ERF1, Ethylene Response Factor 1; PDF1.2, Plant Defensin 1.2; COL1, CONSTANS-Like 1; ACT7, ACTIN 7.

Share and Cite

MDPI and ACS Style

Zhang, Z.-W.; Yang, X.-Y.; Zheng, X.-J.; Fu, Y.-F.; Lan, T.; Tang, X.-Y.; Wang, C.-Q.; Chen, G.-D.; Zeng, J.; Yuan, S. Vitamin E Is Superior to Vitamin C in Delaying Seedling Senescence and Improving Resistance in Arabidopsis Deficient in Macro-Elements. Int. J. Mol. Sci. 2020, 21, 7429. https://doi.org/10.3390/ijms21197429

AMA Style

Zhang Z-W, Yang X-Y, Zheng X-J, Fu Y-F, Lan T, Tang X-Y, Wang C-Q, Chen G-D, Zeng J, Yuan S. Vitamin E Is Superior to Vitamin C in Delaying Seedling Senescence and Improving Resistance in Arabidopsis Deficient in Macro-Elements. International Journal of Molecular Sciences. 2020; 21(19):7429. https://doi.org/10.3390/ijms21197429

Chicago/Turabian Style

Zhang, Zhong-Wei, Xin-Yue Yang, Xiao-Jian Zheng, Yu-Fan Fu, Ting Lan, Xiao-Yan Tang, Chang-Quan Wang, Guang-Deng Chen, Jian Zeng, and Shu Yuan. 2020. "Vitamin E Is Superior to Vitamin C in Delaying Seedling Senescence and Improving Resistance in Arabidopsis Deficient in Macro-Elements" International Journal of Molecular Sciences 21, no. 19: 7429. https://doi.org/10.3390/ijms21197429

APA Style

Zhang, Z.-W., Yang, X.-Y., Zheng, X.-J., Fu, Y.-F., Lan, T., Tang, X.-Y., Wang, C.-Q., Chen, G.-D., Zeng, J., & Yuan, S. (2020). Vitamin E Is Superior to Vitamin C in Delaying Seedling Senescence and Improving Resistance in Arabidopsis Deficient in Macro-Elements. International Journal of Molecular Sciences, 21(19), 7429. https://doi.org/10.3390/ijms21197429

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop