Lipid Emulsion Improves Functional Recovery in an Animal Model of Stroke
Abstract
:1. Introduction
2. Results
2.1. Dosage-Dependent Reduction in Infarction and Behavior by LE
2.2. Wnt/β-Catenin-Dependent Reduction in Infarction and Behavior by LE
2.3. LE Dosage-Dependent Alleviation of Ischemic Reperfusion Injury through the Wnt/β-Catenin Signaling Pathway and Reduction of Inflammatory Protein Markers
2.4. Wnt/β-Catenin-Dependent Alleviation of Ischemic Reperfusion Injury and Reversal of Protection-Related Proteins
2.5. LE Dosage-Dependent mRNA Expression Against Ischemic Reperfusion Injury
2.6. Wnt-Dependent mRNA Expression of LE Against Ischemic Reperfusion Injury
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Middle Cerebral Artery Occlusion and Reperfusion
4.3. Drug Treatment
4.4. Neurological Deficit Assessment
4.5. Infarction Volume Assessment
4.6. Western Blotting
4.7. qPCR
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
AAALAC | Association and Accreditation of Laboratory Animal Care |
ANOVA | analysis of variance |
APC | adenomatous polyposis coli |
AXIN | axis inhibition protein |
CCA | common carotid artery |
DMSO | dimethyl sulfoxide |
ECA | external carotid artery |
GSK3-β | glycogen synthase kinase-3β |
ICA | internal carotid artery |
IL | interleukin |
LE | lipid emulsion |
LRP | low-density lipoprotein receptor-related protein |
MCA | middle cerebral artery |
MCAO | middle cerebral artery occlusion |
mRNA | messenger ribonucleic acid |
PORCN | porcupine |
qPCR | quantitative polymerase chain reaction |
SEM | standard error of mean |
TNF-α | tumor necrosis factor-α |
Veh | vehicle |
Wnt | wingless integration |
XAV939 | 2-[4-(trifluoromethyl)phenyl]-7,8-dihydro-5H-thiino [4,3-d]pyrimidin-4-ol |
References
- Romero, J.R.; Morris, J.; Pikula, A. Stroke prevention: Modifying risk factors. Ther. Adv. Cardiovasc. Dis. 2008, 2, 287–303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feigin, V.L.; Forouzanfar, M.H.; Krishnamurthi, R.; Mensah, G.A.; Connor, M.; Bennett, D.A.; Moran, A.E.; Sacco, R.L.; Anderson, L.; Truelsen, T.; et al. Global and regional burden of stroke during 1990–2010: Findings from the global burden of disease study 2010. Lancet 2014, 383, 245–254. [Google Scholar] [CrossRef]
- Gottesman, R.F.; Hillis, A.E. Predictors and assessment of cognitive dysfunction resulting from ischaemic stroke. Lancet Neurol. 2010, 9, 895–905. [Google Scholar] [CrossRef] [Green Version]
- Sun, M.-S.; Jin, H.; Sun, X.; Huang, S.; Zhang, F.-L.; Guo, Z.-N.; Yang, Y. Free radical damage in ischemia-reperfusion injury: An obstacle in acute ischemic stroke after revascularization therapy. Oxid. Med. Cell Longev. 2018, 2018, 3804979. [Google Scholar] [CrossRef] [PubMed]
- Wardlaw, J.M.; Murray, V.; Berge, E.; del Zoppo, G.J. Thrombolysis for acute ischaemic stroke. Cochrane Database Syst. Rev. 2014, 2014, Cd000213. [Google Scholar] [CrossRef] [PubMed]
- Pan, J.; Konstas, A.A.; Bateman, B.; Ortolano, G.A.; Pile-Spellman, J. Reperfusion injury following cerebral ischemia: Pathophysiology, MR imaging and potential therapies. Neuroradiology 2007, 49, 93–102. [Google Scholar] [CrossRef] [Green Version]
- Sobowale, O.A.; Parry-Jones, A.R.; Smith, C.J.; Tyrrell, P.J.; Rothwell, N.J.; Allan, S.M. Interleukin-1 in stroke: From bench to bedside. Stroke 2016, 47, 2160–2167. [Google Scholar] [CrossRef]
- Aref, H.M.A.; Fahmy, N.A.; Khalil, S.H.; Ahmed, M.F.; ElSadek, A.; Abdulghani, M.O. Role of interleukin-6 in ischemic stroke outcome. Egypt J. Neurol. Psychiatr. Neurosurg. 2020, 56, 12. [Google Scholar] [CrossRef] [Green Version]
- Domac, F.M.; Misirli, H. The role of neutrophils and interleukin-8 in acute ischemic stroke. Neurosciences (Riyadh) 2008, 13, 136–141. [Google Scholar]
- Zangari, R.; Zanier, E.R.; Torgano, G.; Bersano, A.; Beretta, S.; Beghi, E.; Casolla, B.; Checcarelli, N.; Lanfranconi, S.; Maino, A.; et al. Early ficolin-1 is a sensitive prognostic marker for functional outcome in ischemic stroke. J. Neuroinflammation 2016, 13, 16. [Google Scholar] [CrossRef] [Green Version]
- Relton, J.K.; Rothwell, N.J. Interleukin-1 receptor antagonist inhibits ischaemic and excitotoxic neuronal damage in the rat. Brain Res. Bull. 1992, 29, 243–246. [Google Scholar] [CrossRef]
- Yamasaki, Y.; Matsuura, N.; Shozuhara, H.; Onodera, H.; Itoyama, Y.; Kogure, K. Interleukin-1 as a pathogenetic mediator of ischemic brain damage in rats. Stroke 1995, 26, 676–680. [Google Scholar] [CrossRef] [PubMed]
- Shruster, A.; Ben-Zur, T.; Melamed, E.; Offen, D. Wnt signaling enhances neurogenesis and improves neurological function after focal ischemic injury. PLoS ONE 2012, 7, e40843. [Google Scholar] [CrossRef] [PubMed]
- Jean LeBlanc, N.; Menet, R.; Picard, K.; Parent, G.; Tremblay, M.-È.; ElAli, A. Canonical Wnt pathway maintains blood-brain barrier integrity upon ischemic stroke and its activation ameliorates tissue plasminogen activator therapy. Mol. Neurobiol. 2019, 56, 6521–6538. [Google Scholar] [CrossRef]
- Endo, H.; Nito, C.; Kamada, H.; Yu, F.; Chan, P.H. Akt/GSK3beta survival signaling is involved in acute brain injury after subarachnoid hemorrhage in rats. Stroke 2006, 37, 2140–2146. [Google Scholar] [CrossRef] [Green Version]
- Kim, U.J.; Lee, B.H.; Lee, K.H. Neuroprotective effects of a protein tyrosine phosphatase inhibitor against hippocampal excitotoxic injury. Brain Res. 2019, 1719, 133–139. [Google Scholar] [CrossRef]
- Lee, K.H.; Won, R.; Kim, U.J.; Kim, G.M.; Chung, M.A.; Sohn, J.H.; Lee, B.H. Neuroprotective effects of FK506 against excitotoxicity in organotypic hippocampal slice culture. Neurosci. Lett. 2010, 474, 126–130. [Google Scholar] [CrossRef]
- Wang, W.; Li, M.; Wang, Y.; Wang, Z.; Zhang, W.; Guan, F.; Chen, Q.; Wang, J. GSK-3β as a target for protection against transient cerebral ischemia. Int. J. Med. Sci. 2017, 14, 333–339. [Google Scholar] [CrossRef] [Green Version]
- Cheng, J.; Shen, W.; Jin, L.; Pan, J.; Zhou, Y.; Pan, G.; Xie, Q.; Hu, Q.; Wu, S.; Zhang, H.; et al. Treadmill exercise promotes neurogenesis and myelin repair via upregulating Wnt/β-catenin signaling pathways in the juvenile brain following focal cerebral ischemia/reperfusion. Int. J. Mol. Med. 2020, 45, 1447–1463. [Google Scholar] [CrossRef] [Green Version]
- Chen, B.; Tao, J.; Lin, Y.; Lin, R.; Liu, W.; Chen, L. Electro-acupuncture exerts beneficial effects against cerebral ischemia and promotes the proliferation of neural progenitor cells in the cortical peri-infarct area through the Wnt/β-catenin signaling pathway. Int. J. Mol. Med. 2015, 36, 1215–1222. [Google Scholar] [CrossRef] [Green Version]
- Isaksson, B.; Hambraeus, L.; Vinnars, E.; Samuelson, G.; Larsson, J.; Asp, N.-G. In memory of Arvid Wretlind 1919–2002. J. Food Nutr. Res. 2002, 46, 117–118. [Google Scholar]
- Weinberg, G.L.; VadeBoncouer, T.; Ramaraju, G.A.; Garcia-Amaro, M.F.; Cwik, M.J. Pretreatment or resuscitation with a lipid infusion shifts the dose-response to bupivacaine-induced asystole in rats. Anesthesiology 1998, 88, 1071–1075. [Google Scholar] [CrossRef] [PubMed]
- Tierney, K.J.; Murano, T.; Natal, B. Lidocaine-induced cardiac arrest in the emergency department: Effectiveness of lipid therapy. Int. J. Emerg. Med. 2016, 50, 47–50. [Google Scholar] [CrossRef] [PubMed]
- Litz, R.J.; Popp, M.; Stehr, S.N.; Koch, T. Successful resuscitation of a patient with ropivacaine-induced asystole after axillary plexus block using lipid infusion. Anaesthesia 2006, 61, 800–801. [Google Scholar] [CrossRef] [PubMed]
- Rosenblatt, M.A.; Abel, M.; Fischer, G.W.; Itzkovich, C.J.; Eisenkraft, J.B. Successful use of a 20% lipid emulsion to resuscitate a patient after a presumed bupivacaine-related cardiac arrest. Anesthesiology 2006, 105, 217–218. [Google Scholar] [CrossRef]
- Zaugg, M.; Lou, P.H.; Lucchinetti, E.; Gandhi, M.; Clanachan, A.S. Postconditioning with Intralipid emulsion protects against reperfusion injury in post-infarct remodeled rat hearts by activation of ROS-Akt/Erk signaling. Transl. Res. 2017, 186, 36–51. [Google Scholar] [CrossRef]
- Rahman, S.; Li, J.; Bopassa, J.C.; Umar, S.; Iorga, A.; Partownavid, P.; Eghbali, M. Phosphorylation of GSK-3β mediates intralipid-induced cardioprotection against ischemia/reperfusion injury. Anesthesiology 2011, 115, 242–253. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Ruffenach, G.; Kararigas, G.; Cunningham, C.M.; Motayagheni, N.; Barakai, N.; Umar, S.; Regitz-Zagrosek, V.; Eghbali, M. Intralipid protects the heart in late pregnancy against ischemia/reperfusion injury via Caveolin2/STAT3/GSK-3β pathway. J. Mol. Cell Cardiol. 2017, 102, 108–116. [Google Scholar] [CrossRef] [Green Version]
- Anna, R.; Rolf, R.; Mark, C. Update of the organoprotective properties of xenon and argon: From bench to beside. Intensive Care Med. Exp. 2020, 8, 11. [Google Scholar] [CrossRef]
- Auzmendi, J.; Puchulu, M.B.; Rodríguez, J.C.G.; Balaszczuk, A.M.; Lazarowski, A.; Merelli, A. EPO and EPO-receptor system as potential actionable mechanism for the protection of brain and heart in refractory epilepsy and SUDEP. Curr. Pharm. Des. 2020, 26, 1356–1364. [Google Scholar] [CrossRef]
- Tanioka, M.; Park, W.K.; Shim, I.; Kim, K.; Choi, S.; Kim, U.J.; Lee, K.H.; Hong, S.K.; Lee, B.H. Neuroprotection from excitotoxic injury by local administration of lipid emulsion into the brain of rats. Int. J. Mol. Sci. 2020, 21, 2706. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, Y.; Luo, Q.; Wei, J.; Lin, R.; Lin, L.; Li, Y.; Chen, Z.; Lin, W.; Chen, Q. Mechanism of salvianolic acid B neuroprotection against ischemia/reperfusion induced cerebral injury. Brain Res. 2018, 1679, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Torres, V.I.; Godoy, J.A.; Inestrosa, N.C. Modulating Wnt signaling at the root: Porcupine and Wnt acylation. Pharmacol. Therapeut. 2019, 198, 34–45. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Ma, Q.; Li, Y.; Li, B.; Zhang, L. Inhibition of microRNA-210 suppresses pro-inflammatory response and reduces acute brain injury of ischemic stroke in mice. Exp. Neurol. 2018, 300, 41–50. [Google Scholar] [CrossRef]
- Tarkowski, E.; Rosengren, L.; Blomstrand, C.; Wikkelsö, C.; Jensen, C.; Ekholm, S.; Tarkowski, A. Intrathecal release of pro- and anti-inflammatory cytokines during stroke. Clin. Exp. Immunol. 1997, 110, 492–499. [Google Scholar] [CrossRef]
- Chong, Z.Z.; Shang, Y.C.; Hou, J.; Maiese, K. Wnt1 neuroprotection translates into improved neurological function during oxidant stress and cerebral ischemia through AKT1 and mitochondrial apoptotic pathways. Oxid. Med. Cell Longev. 2010, 3, 153–165. [Google Scholar] [CrossRef] [Green Version]
- Morris, D.C.; Zhang, Z.G.; Wang, Y.; Zhang, R.L.; Gregg, S.; Liu, X.S.; Chopp, M. Wnt expression in the adult rat subventricular zone after stroke. Neurosci. Lett. 2007, 418, 170–174. [Google Scholar] [CrossRef] [Green Version]
- Lou, P.-H.; Lucchinetti, E.; Zhang, L.; Affolter, A.; Schaub, M.C.; Gandhi, M.; Hersberger, M.; Warren, B.E.; Lemieux, H.; Sobhi, H.F.; et al. The mechanism of Intralipid®-mediated cardioprotection complex IV inhibition by the active metabolite, palmitoylcarnitine, generates reactive oxygen species and activates reperfusion injury salvage kinases. PLoS ONE 2014, 9, e87205. [Google Scholar] [CrossRef] [Green Version]
- Suryawanshi, A.; Tadagavadi, R.K.; Swafford, D.; Manicassamy, S. Modulation of inflammatory responses by Wnt/β-Catenin signaling in dendritic cells: A novel immunotherapy target for autoimmunity and cancer. Front. Immunol. 2016, 7, 460. [Google Scholar] [CrossRef] [Green Version]
- Yu, Z.; Cheng, C.; Liu, Y.; Liu, N.; Lo, E.H.; Wang, X. Neuroglobin promotes neurogenesis through Wnt signaling pathway. Cell Death Dis. 2018, 9, 945. [Google Scholar] [CrossRef]
- Jia, L.; Piña-Crespo, J.; Li, Y. Restoring Wnt/β-catenin signaling is a promising therapeutic strategy for Alzheimer’s disease. Mol. Brain 2019, 12, 104. [Google Scholar] [CrossRef] [PubMed]
- Scott, E.L.; Brann, D.W. Estrogen regulation of Dkk1 and Wnt/β-Catenin signaling in neurodegenerative disease. Brain Res. 2013, 1514, 63–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosi, M.C.; Luccarini, I.; Grossi, C.; Fiorentini, A.; Spillantini, M.G.; Prisco, A.; Scali, C.; Gianfriddo, M.; Caricasole, A.; Terstappen, G.C.; et al. Increased Dickkopf-1 expression in transgenic mouse models of neurodegenerative disease. J. Neurochem. 2010, 112, 1539–1551. [Google Scholar] [CrossRef] [PubMed]
- Purro, S.A.; Galli, S.; Salinas, P.C. Dysfunction of Wnt signaling and synaptic disassembly in neurodegenerative diseases. J. Mol. Cell Biol. 2014, 6, 75–80. [Google Scholar] [CrossRef] [Green Version]
- Ragab, N.; Viehweger, F.; Bauer, J.; Geyer, N.; Yang, M.; Seils, A.; Belharazem, D.; Brembeck, F.H.; Schildhaus, H.-U.; Marx, A.; et al. Canonical WNT/β-catenin signaling plays a subordinate role in rhabdomyosarcomas. Front. Pediatr. 2018, 6, 378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, Z.Z.; Zhang, J.Y.; Taylor, T.M.; Gu, X.; Zhao, Y.; Wei, L. Neuroprotective and regenerative roles of intranasal Wnt-3a administration after focal ischemic stroke in mice. J. Cereb. Blood Flow Metab. 2018, 38, 404–421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, R.; Christova, T.; Song, S.; Angers, S.; Yan, X.; Attisano, L. Inhibition of tankyrases induces Axin stabilization and blocks Wnt signalling in breast cancer cells. PLoS ONE 2012, 7, e48670. [Google Scholar] [CrossRef] [PubMed]
- Berressem, D.; Koch, K.; Franke, N.; Klein, J.; Eckert, G.P. Intravenous treatment with a long-chain omega-3 lipid emulsion provides neuroprotection in a murine model of ischemic stroke—A pilot study. PLoS ONE 2016, 11, e0167329. [Google Scholar] [CrossRef]
- Williams, J.J.; Mayurasakorn, K.; Vannucci, S.J.; Mastropietro, C.; Bazan, N.G.; Ten, V.S.; Deckelbaum, R.J. N-3 fatty acid rich triglyceride emulsions are neuroprotective after cerebral hypoxic-ischemic injury in neonatal mice. PLoS ONE 2013, 8, e56233. [Google Scholar] [CrossRef] [Green Version]
- Morris, G.P.; Wright, A.L.; Tan, R.P.; Gladbach, A.; Ittner, L.M.; Vissel, B. A comparative study of variables influencing ischemic injury in the Longa and Koizumi methods of intraluminal filament middle cerebral artery occlusion in mice. PLoS ONE 2016, 11, e0148503. [Google Scholar] [CrossRef] [Green Version]
- Lyu, C.; Zhang, Y.; Gu, M.; Huang, Y.; Liu, G.; Wang, C.; Li, M.; Chen, S.; Pan, S.; Gu, Y. IRAK-M deficiency exacerbates ischemic neurovascular injuries in experimental stroke mice. Front. Cell Neurosci. 2018, 12, 504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Wnt1 | GCAACCAAAGTCGCCAGAA | TATGTTCACGATGCCCCACCA |
Wnt2b | GCTACCCAGACATCATGCG | ACACTCTCGGATCCATTCCC |
Wnt3 | AATTTGGTGGTCCCTGGC | GATAGAGCCGCAGAGCAGAG |
Wnt4 | GTTTCCAGTGGTCAGGATGC | AGGACTGTGAGAAGGCTACGC |
Wnt5a | AAGGGAACGAATCCACGCC | ATACTGTCCTGCGACCTGCTTC |
Wnt7a | CCAAGGTCTTCGTGGATGC | TGTAAGTTCATGAGGGTTCGG |
Wnt7b | CGTGTTTCTCTGCTTTGGC | CACCACGGATGACAATGC |
Wnt9a | GTACAGCAGCAAGTTTGTCAAGG | CACGAGGTTGTTGTGGAAGTCC |
Wnt10a | CGGAACAAAGTCCCCTACG | AGGCGAAAGCACTCTCTCG |
Wnt16 | GCACTCTGTAACCAGGTCATGC | TGCAAGGTGGTGTCACAGG |
Mki67 | TTCAGTTCCGCCAATCCAAC | CCGTGCTGGTTCCTTTCCA |
Porcn | CCTACCTCTTCCCCTACTTCA | CTTTGCGTTTCTTGTTGCGA |
IL-1β | AATGCCTCGTGCTGTCTG | TCCATTGAGGTGGAGAGC |
IL-6 | ATGAAGTTTCTCTCCGCAAG | CAACAACATCAGTCCCAAG |
IL-8 | AGCCTTCCTGATTTCTGC | AGCACTCCTTGGCAAAAC |
TNFα | CAGCCGATTTGCCATTTC | TCTTGATGGCAGAGAGGAG |
β-Actin | GTCCACCCGCGAGTACAAC | TATCGTCATCCATGGCGAACTGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanioka, M.; Park, W.K.; Park, J.; Lee, J.E.; Lee, B.H. Lipid Emulsion Improves Functional Recovery in an Animal Model of Stroke. Int. J. Mol. Sci. 2020, 21, 7373. https://doi.org/10.3390/ijms21197373
Tanioka M, Park WK, Park J, Lee JE, Lee BH. Lipid Emulsion Improves Functional Recovery in an Animal Model of Stroke. International Journal of Molecular Sciences. 2020; 21(19):7373. https://doi.org/10.3390/ijms21197373
Chicago/Turabian StyleTanioka, Motomasa, Wyun Kon Park, Joohyun Park, Jong Eun Lee, and Bae Hwan Lee. 2020. "Lipid Emulsion Improves Functional Recovery in an Animal Model of Stroke" International Journal of Molecular Sciences 21, no. 19: 7373. https://doi.org/10.3390/ijms21197373