STING-Mediated Autophagy Is Protective against H2O2-Induced Cell Death
Abstract
1. Introduction
2. Results
2.1. The STING Pathway Is Activated Following H2O2 Treatment
2.2. H2O2 Induces Type-I IFN Signalling in a STING-Dependent Manner
2.3. STING Is Required for Cellular Survival Following H2O2 Insult
2.4. STING Is a Negative Regulator of H2O2-Induced ROS Production
2.5. STING Is Required to Maintain a Normal Autophagy Flux in Response to H2O2 Treatment
3. Discussion
3.1. STING Is Protective in H2O2 Induced Cell Death
3.2. The Type-I IFN and STING Pathways Are Activated after H2O2 Treatment
3.3. Dual Role for STING in Regulating Autophagy Activity
4. Materials and Methods
4.1. MTT Assay
4.2. DCF Assay
4.3. RNA Extractions and cDNA Synthesis
4.4. Quantitative Real Time Polymerase Chain Reaction (qPCR) Analysis
4.5. Western Blot Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AD | Alzheimer’s disease |
BAFA1 | bafilomycin A1 |
DAMP | Damage associated molecular pattern |
DCFH-DA | 2′, 7′-dichlorofluorescin diacetate |
DEPC | Diethyl pyrocarbonate |
DMSO | Dimethyl sulfoxide |
DMXXA | 5,6-dimethylxanthenone-4-acetic acid |
dsDNA | Double stranded DNA |
FBS | Fetal bovine serum |
H2O2 | Hydrogen peroxide |
IFN | Interferon |
IFNAR | Interferon receptor |
IRF | Interferon regulatory factor |
JAK | Janus activated kinase |
LAMP2 | lysosomal-associated membrane protein 2 |
LC3 | Microtubule-associated protein 1 light chain 3 |
MEF | Murine embryonic fibroblast |
mtDNA | Mitochondrial DNA |
PD | Parkinson’s disease |
PVDF | polyvinylidene fluoride |
qPCR | Quantitative real time polymerase chain reaction |
ROS | Reactive oxygen species |
STAT | Signal transducer activator of transcription |
STING | Stimulator of interferon genes |
TBI | Traumatic brain injury |
TBK1 | Tumour necrosis factor (TNF) receptor-associated factor NF-κB activator (TANK)-binding kinase 1 |
References
- Vitner, E.B.; Farfel-Becker, T.; Ferreira, N.S.; Leshkowitz, D.; Sharma, P.; Lang, K.S.; Futerman, A.H. Induction of the type I interferon response in neurological forms of Gaucher disease. J. Neuroinflamm. 2016, 13, 104. [Google Scholar] [CrossRef] [PubMed]
- Crow, Y.J.; Manel, N. Aicardi-Goutieres syndrome and the type I interferonopathies. Nat. Rev. Immunol. 2015, 15, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Nazmi, A.; Field, R.H.; Griffin, E.W.; Haugh, O.; Hennessy, E.; Cox, D.; Reis, R.; Tortorelli, L.; Murray, C.L.; Lopez-Rodriguez, A.B.; et al. Chronic neurodegeneration induces type I interferon synthesis via STING, shaping microglial phenotype and accelerating disease progression. Glia 2019, 67, 1254–1276. [Google Scholar] [CrossRef] [PubMed]
- Taylor, J.M.; Minter, M.R.; Newman, A.G.; Zhang, M.; Adlard, P.A.; Crack, P.J. Type-1 interferon signaling mediates neuro-inflammatory events in models of Alzheimer’s disease. Neurobiol. Aging 2014, 35, 1012–1023. [Google Scholar] [CrossRef]
- Roy, E.R.; Wang, B.; Wan, Y.W.; Chiu, G.; Cole, A.; Yin, Z.; Propson, N.E.; Xu, Y.; Jankowsky, J.L.; Liu, Z.; et al. Type I interferon response drives neuroinflammation and synapse loss in Alzheimer disease. J. Clin. Investig. 2020, 130, 1912–1930. [Google Scholar] [CrossRef] [PubMed]
- Main, B.S.; Zhang, M.; Brody, K.M.; Ayton, S.; Frugier, T.; Steer, D.; Finkelstein, D.; Crack, P.J.; Taylor, J.M. Type-1 interferons contribute to the neuroinflammatory response and disease progression of the MPTP mouse model of Parkinson’s disease. Glia 2016, 64, 1590–1604. [Google Scholar] [CrossRef]
- Abdullah, A.; Zhang, M.; Frugier, T.; Bedoui, S.; Taylor, J.M.; Crack, P.J. STING-mediated type-I interferons contribute to the neuroinflammatory process and detrimental effects following traumatic brain injury. J. Neuroinflamm. 2018, 15, 323. [Google Scholar] [CrossRef]
- Feng, X.; Reder, N.P.; Yanamandala, M.; Hill, A.; Franek, B.S.; Niewold, T.B.; Reder, A.T.; Javed, A. Type I interferon signature is high in lupus and neuromyelitis optica but low in multiple sclerosis. J. Neurol. Sci. 2012, 313, 48–53. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Jesus, A.A.; Marrero, B.; Yang, D.; Ramsey, S.E.; Montealegre Sanchez, G.A.; Tenbrock, K.; Wittkowski, H.; Jones, O.Y.; Kuehn, H.S.; et al. Activated STING in a Vascular and Pulmonary Syndrome. N. Engl. J. Med. 2014, 371, 507–518. [Google Scholar] [CrossRef]
- Petrasek, J.; Iracheta-Vellve, A.; Csak, T.; Satishchandran, A.; Kodys, K.; Kurt-Jones, E.A.; Fitzgerald, K.A.; Szabo, G. STING-IRF3 pathway links endoplasmic reticulum stress with hepatocyte apoptosis in early alcoholic liver disease. Proc. Natl. Acad. Sci. USA 2013, 110, 16544–16549. [Google Scholar] [CrossRef] [PubMed]
- Gehrke, N.; Mertens, C.; Zillinger, T.; Wenzel, J.; Bald, T.; Zahn, S.; Tüting, T.; Hartmann, G.; Barchet, W. Oxidative Damage of DNA Confers Resistance to Cytosolic Nuclease TREX1 Degradation and Potentiates STING-Dependent Immune Sensing. Immunity 2013, 39, 482–495. [Google Scholar] [CrossRef] [PubMed]
- Qin, H.; Huang, G.; Gao, F.; Huang, B.; Wang, D.; Hu, X.; Wang, Y.; Peng, L.; Luo, D.; Mo, B.; et al. Diminished stimulator of interferon genes production with cigarette smoke-exposure contributes to weakened anti-adenovirus vectors response and destruction of lung in chronic obstructive pulmonary disease model. Exp. Cell Res. 2019, 384, 111545. [Google Scholar] [CrossRef]
- Maekawa, H.; Inoue, T.; Ouchi, H.; Jao, T.M.; Inoue, R.; Nishi, H.; Fujii, R.; Ishidate, F.; Tanaka, T.; Tanaka, Y.; et al. Mitochondrial Damage Causes Inflammation via cGAS-STING Signaling in Acute Kidney Injury. Cell Rep. 2019, 29, 1261–1273. [Google Scholar] [CrossRef]
- Prantner, D.; Perkins, D.J.; Lai, W.; Williams, M.S.; Sharma, S.; Fitzgerald, K.A.; Vogel, S.N. 5,6-Dimethylxanthenone-4-acetic Acid (DMXAA) Activates Stimulator of Interferon Gene (STING)-dependent Innate Immune Pathways and Is Regulated by Mitochondrial Membrane Potential. J. Biol. Chem. 2012, 287, 39776–39788. [Google Scholar] [CrossRef] [PubMed]
- Taylor, C.A.; Bell, J.M.; Breiding, M.J.; Xu, L. Traumatic Brain Injury-Related Emergency Department Visits, Hospitalizations, and Deaths—United States, 2007 and 2013. MMWR Surveill. Summ. 2017, 66, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Bullock, M.R.; Chesnut, R.; Ghajar, J.; Gordon, D.; Hartl, R.; Newell, D.W.; Servadei, F.; Walters, B.C.; Wilberger, J.E. Surgical management of acute subdural hematomas. Neurosurgery 2006, 58 (Suppl. 3), S16–S24. [Google Scholar] [CrossRef]
- Bullock, M.R.; Povlishock, J.T. Guidelines for the management of severe traumatic brain injury. Editor’s Commentary. J. Neurotrauma 2007, 24. [Google Scholar] [CrossRef]
- Khormi, Y.H.; Gosadi, I.; Campbell, S.; Senthilselvan, A.; O’Kelly, C.; Zygun, D. Adherence to Brain Trauma Foundation Guidelines for Management of Traumatic Brain Injury Patients and its Effect on Outcomes: Systematic Review. J. Neurotrauma 2018, 35, 1407–1418. [Google Scholar] [CrossRef]
- Teasdale, G.; Jennett, B. Assessment of coma and impaired consciousness. A practical scale. Lancet 1974, 2, 81–84. [Google Scholar] [CrossRef]
- Matis, G.; Birbilis, T. The Glasgow Coma Scale—A brief review. Past, present, future. Acta Neurol. Belg. 2008, 108, 75–89. [Google Scholar]
- Rosenfeld, J.V.; Maas, A.I.; Bragge, P.; Morganti-Kossmann, M.C.; Manley, G.T.; Gruen, R.L. Early management of severe traumatic brain injury. Lancet 2012, 380, 1088–1098. [Google Scholar] [CrossRef]
- Soderstrom, C.A.; Carson, S.L. Update: Alcohol and other drug use among vehicular crash victims. Md. Med. J. 1988, 37, 541–545. [Google Scholar] [PubMed]
- Brickley, M.R.; Shepherd, J.P. The relationship between alcohol intoxication, injury severity and Glasgow Coma Score in assault patients. Injury 1995, 26, 311–314. [Google Scholar] [CrossRef]
- Pories, S.E.; Gamelli, R.L.; Vacek, P.; Goodwin, G.; Shinozaki, T.; Harris, F. Intoxication and injury. J. Trauma 1992, 32, 60–64. [Google Scholar] [CrossRef] [PubMed]
- Vidal, R.L.; Matus, S.; Bargsted, L.; Hetz, C. Targeting autophagy in neurodegenerative diseases. Trends Pharm. Sci. 2014, 35, 583–591. [Google Scholar] [CrossRef] [PubMed]
- Filomeni, G.; de Zio, D.; Cecconi, F. Oxidative stress and autophagy: The clash between damage and metabolic needs. Cell Death Differ. 2014, 22, 377. [Google Scholar] [CrossRef]
- Nixon, R.A. Autophagy in neurodegenerative disease: Friend, foe or turncoat? Trends Neurosci. 2006, 29, 528–535. [Google Scholar] [CrossRef]
- Nixon, R.A. The role of autophagy in neurodegenerative disease. Nat. Med. 2013, 19, 983–997. [Google Scholar] [CrossRef]
- Shintani, T.; Klionsky, D.J. Autophagy in health and disease: A double-edged sword. Science 2004, 306, 990–995. [Google Scholar] [CrossRef]
- Stuke, L.; Diaz-Arrastia, R.; Gentilello, L.M.; Shafi, S. Effect of Alcohol on Glasgow Coma Scale in Head-Injured Patients. Ann. Surg. 2007, 245, 651–655. [Google Scholar] [CrossRef]
- Timmons, S.D.; Bee, T.; Webb, S.; Diaz-Arrastia, R.R.; Hesdorffer, D. Using the abbreviated injury severity and Glasgow Coma Scale scores to predict 2-week mortality after traumatic brain injury. J. Trauma 2011, 71, 1172–1178. [Google Scholar] [CrossRef]
- Hukkelhoven, C.W.; Steyerberg, E.W.; Rampen, A.J.; Farace, E.; Habbema, J.D.; Marshall, L.F.; Murray, G.D.; Maas, A.I. Patient age and outcome following severe traumatic brain injury: An analysis of 5600 patients. J. Neurosurg. 2003, 99, 666–673. [Google Scholar] [CrossRef]
- De la Plata, C.D.M.; Hart, T.; Hammond, F.M.; Frol, A.B.; Hudak, A.; Harper, C.R.; O’Neil-Pirozzi, T.M.; Whyte, J.; Carlile, M.; Diaz-Arrastia, R. Impact of age on long-term recovery from traumatic brain injury. Arch. Phys. Med. Rehabil. 2008, 89, 896–903. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Wu, H.; Wang, C.; Li, Y.; Tian, H.; Siraj, S.; Sehgal, S.A.; Wang, X.; Wang, J.; Shang, Y.; et al. STING directly activates autophagy to tune the innate immune response. Cell Death Differ. 2019, 26, 1735–1749. [Google Scholar] [CrossRef] [PubMed]
- Prabakaran, T.; Bodda, C.; Krapp, C.; Zhang, B.C.; Christensen, M.H.; Sun, C.; Reinert, L.; Cai, Y.; Jensen, S.B.; Skouboe, M.K.; et al. Attenuation of cGAS-STING signaling is mediated by a p62/SQSTM1-dependent autophagy pathway activated by TBK1. EMBO J. 2018, 37, e97858. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Luo, P.; Rao, W.; Dai, S.; Zhang, L.; Ma, W.; Pu, J.; Yu, Y.; Wang, J.; Fei, Z. Homer1a Attenuates Hydrogen Peroxide-Induced Oxidative Damage in HT-22 Cells through AMPK-Dependent Autophagy. Front. Neurosci. 2018, 12, 51. [Google Scholar] [CrossRef] [PubMed]
- Ballinger, S.W.; Patterson, C.; Yan, C.N.; Doan, R.; Burow, D.L.; Young, C.G.; Yakes, F.M.; van Houten, B.; Ballinger, C.A.; Freeman, B.A.; et al. Hydrogen peroxide- and peroxynitrite-induced mitochondrial DNA damage and dysfunction in vascular endothelial and smooth muscle cells. Circ. Res. 2000, 86, 960–966. [Google Scholar] [CrossRef] [PubMed]
- Sies, H.; Jones, D.P. Reactive oxygen species (ROS) as pleiotropic physiological signalling agents. Nat. Rev. Mol. Cell Biol. 2020, 21, 363–383. [Google Scholar] [CrossRef] [PubMed]
- Johnson, V.E.; Stewart, W.; Smith, D.H. Traumatic brain injury and amyloid-β pathology: A link to Alzheimer’s disease? Nat. Rev. Neurosci. 2010, 11, 361–370. [Google Scholar] [CrossRef] [PubMed]
- Mizushima, N.; Yoshimori, T. How to interpret LC3 immunoblotting. Autophagy 2007, 3, 542–545. [Google Scholar] [CrossRef]
- Mizushima, N.; Yoshimori, T.; Levine, B. Methods in mammalian autophagy research. Cell 2010, 140, 313–326. [Google Scholar] [CrossRef]
- Johnson, V.E.; Stewart, J.E.; Begbie, F.D.; Trojanowski, J.Q.; Smith, D.H.; Stewart, W. Inflammation and white matter degeneration persist for years after a single traumatic brain injury. Brain 2013, 136, 28–42. [Google Scholar] [CrossRef]
- Li, W.; Risacher, S.L.; McAllister, T.W.; Saykin, A.J. Age at injury is associated with the long-term cognitive outcome of traumatic brain injuries. Alzheimer’s Dement. Diagn. Assess. Dis. Monit. 2017, 6, 196–200. [Google Scholar] [CrossRef] [PubMed]
- Demetriades, D.; Kuncir, E.; Murray, J.; Velmahos, G.C.; Rhee, P.; Chan, L. Mortality prediction of head Abbreviated Injury Score and Glasgow Coma Scale: Analysis of 7764 head injuries. J. Am. Coll. Surg. 2004, 199, 216–222. [Google Scholar] [CrossRef] [PubMed]
- Susman, M.; DiRusso, S.M.; Sullivan, T.; Risucci, D.; Nealon, P.; Cuff, S.; Haider, A.; Benzil, D. Traumatic brain injury in the elderly: Increased mortality and worse functional outcome at discharge despite lower injury severity. J. Trauma 2002, 53, 219–223. [Google Scholar] [CrossRef] [PubMed]
- Czosnyka, M.; Balestreri, M.; Steiner, L.; Smielewski, P.; Hutchinson, P.J.; Matta, B.; Pickard, J.D. Age, intracranial pressure, autoregulation, and outcome after brain trauma. J. Neurosurg. 2005, 102, 450–454. [Google Scholar] [CrossRef]
- Lecky, F.; Woodford, M.; Edwards, A.; Bouamra, O.; Coats, T. Trauma scoring systems and databases. Br. J. Anaesth. 2014, 113, 286–294. [Google Scholar] [CrossRef]
- Baker, S.P.; O’Neill, B. The injury severity score: An update. J. Trauma 1976, 16, 882–885. [Google Scholar] [CrossRef]
- Grote, S.; Bocker, W.; Mutschler, W.; Bouillon, B.; Lefering, R. Diagnostic value of the Glasgow Coma Scale for traumatic brain injury in 18,002 patients with severe multiple injuries. J. Neurotrauma 2011, 28, 527–534. [Google Scholar] [CrossRef]
- Tohira, H.; Jacobs, I.; Mountain, D.; Gibson, N.; Yeo, A. Systematic review of predictive performance of injury severity scoring tools. Scand. J. Trauma Resusc. Emerg. Med. 2012, 20, 63. [Google Scholar] [CrossRef]
- Harad, F.T.; Kerstein, M.D. Inadequacy of bedside clinical indicators in identifying significant intracranial injury in trauma patients. J. Trauma 1992, 32, 359–361. [Google Scholar] [CrossRef]
- Haydel, M.J.; Preston, C.A.; Mills, T.J.; Luber, S.; Blaudeau, E.; DeBlieux, P.M. Indications for computed tomography in patients with minor head injury. N. Engl. J. Med. 2000, 343, 100–105. [Google Scholar] [CrossRef]
- Yuh, E.L.; Mukherjee, P.; Lingsma, H.F.; Yue, J.K.; Ferguson, A.R.; Gordon, W.A.; Valadka, A.B.; Schnyer, D.M.; Okonkwo, D.O.; Maas, A.I.; et al. Magnetic resonance imaging improves 3-month outcome prediction in mild traumatic brain injury. Ann. Neurol. 2013, 73, 224–235. [Google Scholar] [CrossRef]
- Oddo, M.; Schmidt, J.M.; Carrera, E.; Badjatia, N.; Connolly, E.S.; Presciutti, M.; Ostapkovich, N.D.; Levine, J.M.; Le Roux, P.; Mayer, S.A. Impact of tight glycemic control on cerebral glucose metabolism after severe brain injury: A microdialysis study. Crit. Care Med. 2008, 36, 3233–3238. [Google Scholar] [CrossRef]
- Le, T.H.; Gean, A.D. Neuroimaging of traumatic brain injury. Mt. Sinai J. Med. J. Transl. Personal. Med. 2009, 76, 145–162. [Google Scholar] [CrossRef]
- Kolias, A.G.; Adams, H.; Timofeev, I.; Czosnyka, M.; Corteen, E.A.; Pickard, J.D.; Turner, C.; Gregson, B.A.; Kirkpatrick, P.J.; Murray, G.D.; et al. Decompressive craniectomy following traumatic brain injury: Developing the evidence base. Br. J. Neurosurg. 2016, 30, 246–250. [Google Scholar] [CrossRef]
- Lazaridis, C.; Czosnyka, M. Cerebral blood flow, brain tissue oxygen, and metabolic effects of decompressive craniectomy. Neurocrit. Care 2012, 16, 478–484. [Google Scholar] [CrossRef]
- Cecil, S.; Chen, P.M.; Callaway, S.E.; Rowland, S.M.; Adler, D.E.; Chen, J.W. Traumatic brain injury: Advanced multimodal neuromonitoring from theory to clinical practice. Crit. Care Nurse 2011, 31, 25–36. [Google Scholar] [CrossRef]
- Rosenthal, G.; Hemphill, J.C., III; Sorani, M.; Martin, C.; Morabito, D.; Obrist, W.D.; Manley, G.T. Brain tissue oxygen tension is more indicative of oxygen diffusion than oxygen delivery and metabolism in patients with traumatic brain injury. Crit. Care Med. 2008, 36, 1917–1924. [Google Scholar] [CrossRef]
- Choi, A.M.; Ryter, S.W.; Levine, B. Autophagy in human health and disease. N. Engl. J. Med. 2013, 368, 651–662. [Google Scholar] [CrossRef]
- Prabhakar, H.; Sandhu, K.; Bhagat, H.; Durga, P.; Chawla, R. Current concepts of optimal cerebral perfusion pressure in traumatic brain injury. J. Anaesthesiol. Clin. Pharmacol. 2014, 30, 318–327. [Google Scholar]
- Zhao, H.; Steinberg, G.K.; Sapolsky, R.M. General versus Specific Actions of Mild-Moderate Hypothermia in Attenuating Cerebral Ischemic Damage. J. Cereb. Blood Flow Metab. 2007, 27, 1879–1894. [Google Scholar] [CrossRef] [PubMed]
- Diller, K.R.; Zhu, L. Hypothermia therapy for brain injury. Annu. Rev. Biomed. Eng. 2009, 11, 135–162. [Google Scholar] [CrossRef] [PubMed]
- Mutch, C.A.; Talbott, J.F.; Gean, A. Imaging Evaluation of Acute Traumatic Brain Injury. Neurosurg. Clin. N. Am. 2016, 27, 409–439. [Google Scholar] [CrossRef] [PubMed]
- Zetterberg, H.; Blennow, K. Fluid biomarkers for mild traumatic brain injury and related conditions. Nat. Rev. Neurol. 2016, 12, 563–574. [Google Scholar] [CrossRef]
- Agoston, D.V.; Shutes-David, A.; Peskind, E.R. Biofluid biomarkers of traumatic brain injury. Brain Inj. 2017, 31, 1195–1203. [Google Scholar] [CrossRef] [PubMed]
- Lei, Z.; Deng, M.; Yi, Z.; Sun, Q.; Shapiro, R.A.; Xu, H.; Li, T.; Loughran, P.A.; Griepentrog, J.E.; Huang, H.; et al. cGAS-mediated autophagy protects the liver from ischemia-reperfusion injury independently of STING. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 314, G655–G667. [Google Scholar] [CrossRef]
- Twentyman, P.R.; Luscombe, M. A study of some variables in a tetrazolium dye (MTT) based assay for cell growth and chemosensitivity. Br. J. Cancer 1987, 56, 279–285. [Google Scholar] [CrossRef] [PubMed]
- Loh, K.; Deng, H.; Fukushima, A.; Cai, X.; Boivin, B.; Galic, S.; Bruce, C.; Shields, B.J.; Skiba, B.; Ooms, L.M.; et al. Reactive oxygen species enhance insulin sensitivity. Cell Metab. 2009, 10, 260–272. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCtMethod. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Species | Refseq | Amplicon Length (bp) | Catalogue No |
---|---|---|---|---|
GAPDH | Mouse | NM_008084.2 | 107 | Mm99999915_m1 |
IFNβ | Mouse | NM_010510.1 | 69 | Mm00439552_s1 |
IRF3 | Mouse | NM_016849.4 | 59 | Mm00516779_m1 |
IRF7 | Mouse | NM_001252600.1 | 67 | Mm00516788_m1 |
NM_001252601.1 | ||||
NM_016850.3 | ||||
STING | Mouse | NM_028261.1 | 173 | Mm01158117_m1 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | ATCTTCTTGTGCAGTGCCAGC | ACTCCACGACATACTCAGCACC |
IFNα | GCAATCCTCCTAGACTCACTTCTGCA | TATAGTTCCTCACAGCCAGCAG |
IFNαE4 | - | TATTTCTTCATAGCCAGCTG |
Primary Antibodies | Origin | Dilution | Company | Catalogue No |
---|---|---|---|---|
anti-pSTING (s365) | rabbit | 1 in 500 | Cell Signaling (Danvers, MA, USA) | 72971 |
anti-STING | rabbit | 1 in 1000 | Cell Signaling (Danvers, MA, USA) | 13647 |
anti-LC3 | rabbit | 1 in 1000 | MBL (Woburn, MA, USA) | PM036 |
anti-SQSTM1/p62 | mouse | 1 in 1000 | Abcam (Cambridge, UK) | ab56416 |
anti-β-Actin | mouse | 1 in 1000 | Sigma-Aldrich (St. Louis, MO, USA) | A5441 |
anti-LAMP2 | rat | 1 in 1000 | Abcam (Cambridge, UK) | ab25339 |
anti-pTBK1(s172) | rabbit | 1 in 1000 | Abcam (Cambridge, UK) | ab109272 |
anti-NAK/TBK1 | rabbit | 1 in 1000 | Abcam(Cambridge, UK) | ab40676 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdullah, A.; Mobilio, F.; Crack, P.J.; Taylor, J.M. STING-Mediated Autophagy Is Protective against H2O2-Induced Cell Death. Int. J. Mol. Sci. 2020, 21, 7059. https://doi.org/10.3390/ijms21197059
Abdullah A, Mobilio F, Crack PJ, Taylor JM. STING-Mediated Autophagy Is Protective against H2O2-Induced Cell Death. International Journal of Molecular Sciences. 2020; 21(19):7059. https://doi.org/10.3390/ijms21197059
Chicago/Turabian StyleAbdullah, Amar, Frank Mobilio, Peter J. Crack, and Juliet M. Taylor. 2020. "STING-Mediated Autophagy Is Protective against H2O2-Induced Cell Death" International Journal of Molecular Sciences 21, no. 19: 7059. https://doi.org/10.3390/ijms21197059
APA StyleAbdullah, A., Mobilio, F., Crack, P. J., & Taylor, J. M. (2020). STING-Mediated Autophagy Is Protective against H2O2-Induced Cell Death. International Journal of Molecular Sciences, 21(19), 7059. https://doi.org/10.3390/ijms21197059