Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model
Abstract
1. Introduction
2. Results
2.1. Verification of IL-6 Gene Knockout
2.2. Histopathological and Clinical Characteristics
2.3. PCR Results
2.4. Intraluminal Fluorescent Endomicroscopy
2.5. Imaging Studies
3. Discussion
4. Materials and Methods
4.1. IL-6 Gene Knockout
4.2. Animals Used in the Experiments
4.3. Experimental Protocol
4.4. Quantitative Real-Time PCR
- rplp1 for TAAGGCCGCGTTGAGGTG
- rplp1 rev GATCTTATCCTCCGTGACCGT
- thbs1 for CAT GCC ATG GCC AAC AAA CA
- thbs1 rev TTG CAC TCA CAG CGG TAC AT
- thpo1 for CTT CTC CAC CCG GAC AGA GT
- thpo1 rev CTG GCC AGG GTG TCT AAC TG
4.5. In Vivo Imaging Using PET/MRI and Intraluminal Fluorescent Confocal Endomicroscopy
4.6. Image Analysis
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Global Burden of Disease Cancer Collaboration; Fitzmaurice, C.; Akinyemiju, T.F.; Al Lami, F.H.; Alam, T.; Alizadeh-Navaei, R.; Allen, C.; Alsharif, U.; Alvis-Guzman, N.; Amini, E.; et al. Global, regional, and national cancer incidence, mortality, years of life lost, years lived with disability, and disability-adjusted life-years for 29 cancer groups, 1990 to 2016: A systematic analysis for the global burden of disease study. JAMA Oncol. 2018, 4, 1553–1568. [Google Scholar] [CrossRef]
- Sasaki, K.; Kawai, K.; Tsuno, N.H.; Sunami, E.; Kitayama, J. Impact of preoperative thrombocytosis on the survival of patients with primary colorectal cancer. World J. Surg. 2012, 36, 192–200. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Cao, Y.; Lu, P.; Kang, Y.; Lin, Z.; Hao, T.; Song, Y. Evaluation of platelet indices as diagnostic biomarkers for colorectal cancer. Sci. Rep. 2018, 8, 11814. [Google Scholar] [CrossRef] [PubMed]
- Rao, X.D.; Zhang, H.; Xu, Z.S.; Cheng, H.; Shen, W.; Wang, X.P. Poor prognostic role of the pretreatment platelet counts in colorectal cancer: A meta-analysis. Medicine 2018, 97, e10831. [Google Scholar] [CrossRef] [PubMed]
- Erpenbeck, L.; Schon, M.P. Deadly allies: The fatal interplay between platelets and metastasizing cancer cells. Blood 2010, 115, 3427–3436. [Google Scholar] [CrossRef]
- Gay, L.J.; Felding-Habermann, B. Contribution of platelets to tumour metastasis. Nat. Rev. Cancer 2011, 11, 123–134. [Google Scholar] [CrossRef]
- Nieswandt, B.; Hafner, M.; Echtenacher, B.; Mannel, D.N. Lysis of tumor cells by natural killer cells in mice is impeded by platelets. Cancer Res. 1999, 59, 1295–1300. [Google Scholar]
- Palumbo, J.S.; Talmage, K.E.; Massari, J.V.; La Jeunesse, C.M.; Flick, M.J.; Kombrinck, K.W.; Jirouskova, M.; Degen, J.L. Platelets and fibrin(ogen) increase metastatic potential by impeding natural killer cell-mediated elimination of tumor cells. Blood 2005, 105, 178–185. [Google Scholar] [CrossRef]
- Assoian, R.K.; Sporn, M.B. Type beta transforming growth factor in human platelets: Release during platelet degranulation and action on vascular smooth muscle cells. J. Cell Biol. 1986, 102, 1217–1223. [Google Scholar] [CrossRef]
- Kaplan, K.L.; Broekman, M.J.; Chernoff, A.; Lesznik, G.R.; Drillings, M. Platelet alpha-granule proteins: Studies on release and subcellular localization. Blood 1979, 53, 604–618. [Google Scholar] [CrossRef]
- Verheul, H.M.; Hoekman, K.; Lupu, F.; Broxterman, H.J.; van der Valk, P.; Kakkar, A.K.; Pinedo, H.M. Platelet and coagulation activation with vascular endothelial growth factor generation in soft tissue sarcomas. Clin. Cancer Res. 2000, 6, 166–171. [Google Scholar]
- Banks, R.E.; Forbes, M.A.; Kinsey, S.E.; Stanley, A.; Ingham, E.; Walters, C.; Selby, P.J. Release of the angiogenic cytokine vascular endothelial growth factor (VEGF) from platelets: Significance for VEGF measurements and cancer biology. Br. J. Cancer 1998, 77, 956–964. [Google Scholar] [CrossRef]
- Gupta, G.P.; Massague, J. Platelets and metastasis revisited: A novel fatty link. J. Clin. Investig. 2004, 114, 1691–1693. [Google Scholar] [CrossRef]
- Tsuruo, T.; Fujita, N. Platelet aggregation in the formation of tumor metastasis. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2008, 84, 189–198. [Google Scholar] [CrossRef]
- Stone, R.L.; Nick, A.M.; McNeish, I.A.; Balkwill, F.; Han, H.D.; Bottsford-Miller, J.; Rupairmoole, R.; Armaiz-Pena, G.N.; Pecot, C.V.; Coward, J.; et al. Paraneoplastic thrombocytosis in ovarian cancer. N. Engl. J. Med. 2012, 366, 610–618. [Google Scholar] [CrossRef]
- Wang, C.; Li, P.; Xuan, J.; Zhu, C.; Liu, J.; Shan, L.; Du, Q.; Ren, Y.; Ye, J. Cholesterol enhances colorectal cancer progression via ROS elevation and MAPK signaling pathway activation. Cell. Physiol. Biochem. 2017, 42, 729–742. [Google Scholar] [CrossRef]
- Yassin, M.; Sadowska, Z.; Djurhuus, D.; Nielsen, B.; Tougaard, P.; Olsen, J.; Pedersen, A.E. Upregulation of PD-1 follows tumour development in the AOM/DSS model of inflammation-induced colorectal cancer in mice. Immunology 2019, 158, 35–46. [Google Scholar] [CrossRef]
- Saleiro, D.; Murillo, G.; Benya, R.V.; Bissonnette, M.; Hart, J.; Mehta, R.G. Estrogen receptor-beta protects against colitis-associated neoplasia in mice. Int. J. Cancer 2012, 131, 2553–2561. [Google Scholar] [CrossRef]
- Ray, A.L.; Berggren, K.L.; Restrepo Cruz, S.; Gan, G.N.; Beswick, E.J. Inhibition of MK2 suppresses IL-1beta, IL-6, and TNF-alpha-dependent colorectal cancer growth. Int. J. Cancer 2018, 142, 1702–1711. [Google Scholar] [CrossRef]
- Kaushansky, K. Thrombopoietin and the hematopoietic stem cell. Ann. N. Y. Acad. Sci. 2005, 1044, 139–141. [Google Scholar] [CrossRef]
- Deutsch, V.R.; Tomer, A. Megakaryocyte development and platelet production. Br. J. Haematol. 2006, 134, 453–466. [Google Scholar] [CrossRef]
- Fielder, P.J.; Gurney, A.L.; Stefanich, E.; Marian, M.; Moore, M.W.; Carver-Moore, K.; de Sauvage, F.J. Regulation of thrombopoietin levels by c-mpl-mediated binding to platelets. Blood 1996, 87, 2154–2161. [Google Scholar] [CrossRef]
- Kaser, A.; Brandacher, G.; Steurer, W.; Kaser, S.; Offner, F.A.; Zoller, H.; Theurl, I.; Widder, W.; Molnar, C.; Ludwiczek, O.; et al. Interleukin-6 stimulates thrombopoiesis through thrombopoietin: Role in inflammatory thrombocytosis. Blood 2001, 98, 2720–2725. [Google Scholar] [CrossRef]
- De Vita, F.; Romano, C.; Orditura, M.; Galizia, G.; Martinelli, E.; Lieto, E.; Catalano, G. Interleukin-6 serum level correlates with survival in advanced gastrointestinal cancer patients but is not an independent prognostic indicator. J. Interferon Cytokine Res. 2001, 21, 45–52. [Google Scholar] [CrossRef]
- Buergy, D.; Wenz, F.; Groden, C.; Brockmann, M.A. Tumor-platelet interaction in solid tumors. Int. J. Cancer 2012, 130, 2747–2760. [Google Scholar] [CrossRef]
- Knupfer, H.; Preiss, R. Serum interleukin-6 levels in colorectal cancer patients—A summary of published results. Int. J. Colorectal Dis. 2010, 25, 135–140. [Google Scholar] [CrossRef]
- Becker, C.; Fantini, M.C.; Schramm, C.; Lehr, H.A.; Wirtz, S.; Nikolaev, A.; Burg, J.; Strand, S.; Kiesslich, R.; Huber, S.; et al. TGF-beta suppresses tumor progression in colon cancer by inhibition of IL-6 trans-signaling. Immunity 2004, 21, 491–501. [Google Scholar] [CrossRef]
- Grivennikov, S.; Karin, E.; Terzic, J.; Mucida, D.; Yu, G.Y.; Vallabhapurapu, S.; Scheller, J.; Rose-John, S.; Cheroutre, H.; Eckmann, L.; et al. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer Cell 2009, 15, 103–113. [Google Scholar] [CrossRef]
- Bollrath, J.; Phesse, T.J.; von Burstin, V.A.; Putoczki, T.; Bennecke, M.; Bateman, T.; Nebelsiek, T.; Lundgren-May, T.; Canli, O.; Schwitalla, S.; et al. gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer Cell 2009, 15, 91–102. [Google Scholar] [CrossRef]
- Waldner, M.J.; Wirtz, S.; Jefremow, A.; Warntjen, M.; Neufert, C.; Atreya, R.; Becker, C.; Weigmann, B.; Vieth, M.; Rose-John, S.; et al. VEGF receptor signaling links inflammation and tumorigenesis in colitis-associated cancer. J. Exp. Med. 2010, 207, 2855–2868. [Google Scholar] [CrossRef]
- Matsumoto, S.; Hara, T.; Mitsuyama, K.; Yamamoto, M.; Tsuruta, O.; Sata, M.; Scheller, J.; Rose-John, S.; Kado, S.; Takada, T. Essential roles of IL-6 trans-signaling in colonic epithelial cells, induced by the IL-6/soluble-IL-6 receptor derived from lamina propria macrophages, on the development of colitis-associated premalignant cancer in a murine model. J. Immunol. 2010, 184, 1543–1551. [Google Scholar] [CrossRef]
- Kuhn, K.A.; Manieri, N.A.; Liu, T.C.; Stappenbeck, T.S. IL-6 stimulates intestinal epithelial proliferation and repair after injury. PLoS ONE 2014, 9, e114195. [Google Scholar] [CrossRef]
- Dann, S.M.; Spehlmann, M.E.; Hammond, D.C.; Iimura, M.; Hase, K.; Choi, L.J.; Hanson, E.; Eckmann, L. IL-6-dependent mucosal protection prevents establishment of a microbial niche for attaching/effacing lesion-forming enteric bacterial pathogens. J. Immunol. 2008, 180, 6816–6826. [Google Scholar] [CrossRef]
- Ferris, R.L.; Blumenschein, G., Jr.; Fayette, J.; Guigay, J.; Colevas, A.D.; Licitra, L.; Harrington, K.; Kasper, S.; Vokes, E.E.; Even, C.; et al. Nivolumab for Recurrent Squamous-Cell Carcinoma of the Head and Neck. N. Engl. J. Med. 2016, 375, 1856–1867. [Google Scholar] [CrossRef]
- Becker, C.; Fantini, M.C.; Wirtz, S.; Nikolaev, A.; Kiesslich, R.; Lehr, H.A.; Galle, P.R.; Neurath, M.F. In vivo imaging of colitis and colon cancer development in mice using high resolution chromoendoscopy. Gut 2005, 54, 950–954. [Google Scholar] [CrossRef]
- Neufert, C.; Becker, C.; Neurath, M.F. An inducible mouse model of colon carcinogenesis for the analysis of sporadic and inflammation-driven tumor progression. Nat. Protoc. 2007, 2, 1998–2004. [Google Scholar] [CrossRef]
Animal | Averaged Intestinal Standardized Uptake Value of Intestines (g/mL) | Radioactivity Content in Intestines vs. Whole-Body Radioactivity |
---|---|---|
Mouse 1 WT CRC | 0.43 | 20.1% |
Mouse 2 IL-6 KO CRC | 0.15 | 5.3% |
Mouse 3 IL-6 KO CRC | 0.27 | 6.8% |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Josa, V.; Ferenczi, S.; Szalai, R.; Fuder, E.; Kuti, D.; Horvath, K.; Hegedus, N.; Kovacs, T.; Bagamery, G.; Juhasz, B.; et al. Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model. Int. J. Mol. Sci. 2020, 21, 6218. https://doi.org/10.3390/ijms21176218
Josa V, Ferenczi S, Szalai R, Fuder E, Kuti D, Horvath K, Hegedus N, Kovacs T, Bagamery G, Juhasz B, et al. Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model. International Journal of Molecular Sciences. 2020; 21(17):6218. https://doi.org/10.3390/ijms21176218
Chicago/Turabian StyleJosa, Valeria, Szilamer Ferenczi, Rita Szalai, Eniko Fuder, Daniel Kuti, Krisztina Horvath, Nikolett Hegedus, Tibor Kovacs, Gergo Bagamery, Balazs Juhasz, and et al. 2020. "Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model" International Journal of Molecular Sciences 21, no. 17: 6218. https://doi.org/10.3390/ijms21176218
APA StyleJosa, V., Ferenczi, S., Szalai, R., Fuder, E., Kuti, D., Horvath, K., Hegedus, N., Kovacs, T., Bagamery, G., Juhasz, B., Winkler, Z., Veres, D. S., Zrubka, Z., Mathe, D., & Baranyai, Z. (2020). Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model. International Journal of Molecular Sciences, 21(17), 6218. https://doi.org/10.3390/ijms21176218