Next Article in Journal
Expression and Localization of BDNF/TrkB System in the Zebrafish Inner Ear
Next Article in Special Issue
The New Paradigm of Network Medicine to Analyze Breast Cancer Phenotypes
Previous Article in Journal
The Mitochondrial Dysfunction Hypothesis in Autism Spectrum Disorders: Current Status and Future Perspectives
Previous Article in Special Issue
Targeting Discoidin Domain Receptor 1 (DDR1) Signaling and Its Crosstalk with β1-Integrin Emerges as a Key Factor for Breast Cancer Chemosensitization upon Collagen Type 1 Binding
 
 
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Targeting Hypoxia Sensitizes TNBC to Cisplatin and Promotes Inhibition of Both Bulk and Cancer Stem Cells

1
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, 451 Smyth Road, Ottawa, ON K1H 8M5, Canada
2
Ottawa Institute of Systems Biology, University of Ottawa, 451 Smyth Road, Ottawa, ON K1H 8M5, Canada
3
Department of Basic Science, Kansas City University of Medicine and Bioscience, 1750 Independence Ave, Kansas City, MO 64106, USA
4
Centre for Cancer Therapeutics, Ottawa Hospital Research Institute, Ottawa, ON K1H 8L6, Canada
5
Centre for Biologics Evaluation, Biologics and Genetic Therapies Directorate, Health Canada, Sir Frederick G. Banting Research Centre, 251 Sir Frederick Banting Driveway, Ottawa, ON K1A 0K9, Canada
6
Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, ON K1H 8L6, Canada
*
Author to whom correspondence should be addressed.
These authors contributed equally.
Int. J. Mol. Sci. 2020, 21(16), 5788; https://doi.org/10.3390/ijms21165788
Received: 21 July 2020 / Revised: 6 August 2020 / Accepted: 10 August 2020 / Published: 12 August 2020
(This article belongs to the Special Issue Breast Cancer: From Pathophysiology to Novel Therapeutic Approaches)

Abstract

:
Development of targeted therapies for triple-negative breast cancer (TNBC) is an unmet medical need. Cisplatin has demonstrated its promising potential for the treatment of TNBC in clinical trials; however, cisplatin treatment is associated with hypoxia that, in turn, promotes cancer stem cell (CSC) enrichment and drug resistance. Therapeutic approaches to attenuate this may lead to increased cisplatin efficacy in the clinic for the treatment of TNBC. In this report we analyzed clinical datasets of TNBC and found that TNBC patients possessed higher levels of EGFR and hypoxia gene expression. A similar expression pattern was also observed in cisplatin-resistant ovarian cancer cells. We, thus, developed a new therapeutic approach to inhibit EGFR and hypoxia by combination treatment with metformin and gefitinib that sensitized TNBC cells to cisplatin and led to the inhibition of both CD44+/CD24− and ALDH+ CSCs. We demonstrated a similar inhibition efficacy on organotypic cultures of TNBC patient samples ex vivo. Since these drugs have already been used frequently in the clinic; this study illustrates a novel, clinically translatable therapeutic approach to treat patients with TNBC.

Graphical Abstract

1. Introduction

Breast cancer is one of the leading causes of cancer-related deaths in women throughout the world [1]. The triple-negative breast cancer (TNBC) subtype is characterized as negative for the estrogen receptor 1 (ESR1), progesterone receptor (PGR), and human epidermal growth factor receptor type 2 (HER2).
In contrast to other breast cancer subtypes, TNBC does not have specific targets and is reliant on chemotherapeutic regiments for systemic treatment and disproportionately accounts for the majority of breast cancer related deaths. Cisplatin is a platinum 2 complex capable of creating adducts, causing DNA damage, and subsequently inducing apoptosis in a multitude of cancers [2]. Recent clinical trials have showed efficacy of cisplatin in combinational chemotherapy in comparison to conventional chemotherapeutic approaches for the treatment of TNBC [3,4,5]. However, others have demonstrated lackluster outcomes, and underlying mechanisms remain convoluted [6,7].
Hypoxia following cisplatin treatment has been reported and associated with the onset of drug resistance and disease progression [8]. Additionally, while chemotherapy effectively inhibits bulk tumor populations, it enriches cancer stem cells (CSCs) [9]. CSCs retain stem cell-like characteristics and are highly associated with drug resistance, metastasis and tumorigenicity [10,11]. In breast cancer, two main populations of CSCs have been characterized according to the expression of CD44+/CD24− (mesenchymal-like CSC) or ALDH+ (epithelial-like CSC) [10,12,13]. Two populations of CSC exhibited plasticity and strong tumorigenic capacity, capable of generating new tumors and responsible for disease relapse. Thus, a new strategy to simultaneously target both CSC populations and suppress hypoxia will lead to the effective treatment of TNBC.
EGFR signaling has been shown to enhance aerobic glycolysis in TNBC cells to promote tumor growth, which has been considered as a potential target for TNBC treatment [14,15]. Gefitinib, an EGFR inhibitor, elicits anti-hypoxic properties and has been demonstrated to overcome cisplatin-induced hypoxia resistance in TNBC [16]. However, gefitinib is prone to resistance via stimulation of bypass signalling which in turn promotes Akt/mTORC1 and subsequent hypoxia, diminishing the efficacy of gefitinib for long-term treatment [17,18,19]. To circumvent this, metformin (an AMPK activator and first line treatment for type II diabetes) has been employed. Metformin exhibits anti-hypoxic effects via inhibition of mTORC1 activity and HIF-1α protein stability [20,21]. Metformin has been shown to reverse gefitinib hypoxia resistance in head and neck squamous cell carcinoma and attenuate hypoxia-induced cisplatin resistance; moreover, metformin has been found to target CSCs in TNBC [22,23,24]. However, whether the combination of metformin and gefitinib can prevent cisplatin-induced hypoxia in TNBC, increase apoptosis and inhibit CSCs has not yet been reported.
In this report, we found that TNBC tumors from patients expressed high levels of EGFR and hypoxia genes compared to normal mammary tissue in a clinical database. As such, we developed a combinational therapy consisting of metformin (AMPK activator), gefitinib (EGFR inhibitor) and cisplatin. We found that inhibition of EGFR and hypoxia sensitized TNBC cell lines to cisplatin treatment. Both ALDH+ epithelial and CD44+/CD24− mesenchymal CSC populations could be inhibited. These findings were further verified using ex vivo organotypic cultures of TNBC clinical samples and TNBC patient-derived xenograft tumors. Together, these findings present a new strategy to prevent cisplatin-induced CSCs and hypoxia, which may lead to an efficacy treatment to reduce disease relapse in TNBC patients.

2. Results

2.1. Upregulated Gene Expressions of EGFR and Hypoxia Associate with Cisplatin Resistance, Anti-Apoptosis, and Stemness

Clinical trials showed mixed results for the treatment of TNBC with cisplatin with convoluted mechanisms [3,4,5,6,7]. To identify potential targets associated with the cisplatin resistance (cisplatin sensitive and resistant) due to unavailable datasets for TNBC, we adopted an ovarian cancer bioinformatics model. We assessed gene overexpression in cisplatin resistant vs. naive ovarian cancer cells using the NCBI Gene Expression Omnibus (GEO2R). It was found that cisplatin resistance was associated with the increased expressions of EGFR, hypoxia, stemness and anti-apoptotic genes (Supplemental Figure S1A–D). We then analyzed NCBI Gene Expression Omnibus (GEO2R) to compare 30 TNBC with 13 normal mammary tissue samples and identified a similar trend where TNBC samples possessed high levels of EGFR, hypoxia, stemness and anti-apoptotic gene expressions compared to normal mammary tissues (Figure 1A–D). EGFR and hypoxia have both been associated with TNBC resistance to cisplatin [25,26], suggesting potentially clinical targets for further investigation.

2.2. Combination of Hypoxia and EGFR Inhibitors with Cisplatin Effectively Suppress TNBC Bulk and CSC Populations

To determine whether hypoxia and EGFR inhibition could increase cisplatin efficacy, 25 µM of metformin (an AMPK activator used to treat type II diabetes with anti-hypoxic effects), 5 µM gefitinib (an EGFR inhibitor), and 5 µM of cisplatin at clinically relevant concentrations were used in different combinations (designated as CMG). As shown in Figure 2A,B, CMG treatment for 120 h significantly reduced bulk cell viabilities in both SUM 149-PT and MDA-MB-231 TNBC cell lines.
To assess whether the CMG combinational therapy could also target both epithelial-like and mesenchymal-like CSC populations, we preformed FACs analysis on SUM 149-PT and MDA-MB-231 cells after 120 h of treatment. CSCs have been closely associated with drug resistance, cancer metastasis, and poor prognosis and chemotherapeutics enriched CSCs [9]. There are two main CSC populations characterized in TNBC: CD44+/CD24− mesenchymal and ALDH+ epithelial CSCs. Two CSC subpopulations exhibit plasticity and 100-fold greater tumor-initiating capacity than their non-CSC counterparts [11,27].
We found that CMG effectively inhibited CD44+/CD24− CSC population in both SUM 149-PT and MDA-MB-231 TNBC cell lines and reduced the living CSCs by ~90% (Figure 2C,D,G, Supplemental Figure S2A). In contrast, single and dual treatments exhibited weak or mixed results. Additionally, gefitinib alone did not inhibit CD44+/CD24− CSCs in MDA-MB-231 cells although it showed efficacy in SUM149-PT cells.
For the ALDH+ CSC subpopulation, we found that the combinations of cisplatin+gefitinib, metformin+gefitinib and CMG were all effective (Figure 2E,F,H, Supplemental Figures) with CMG reducing ALDH+ CSCs in both TNBC cell lines by ~90%. Together, these data demonstrate that the CMG combination can effectively inhibit TNBC bulk, CD44+/CD24− mesenchymal CSCs and ALDH+ epithelial CSC populations in both MDA-MB-231 and SUM149-PT cell lines at clinically relevant concentrations.

2.3. Combination of Metformin, Gefitinib and Cisplatin Effectively Repress Hypoxia and Promote Apoptosis in TNBC

As hypoxia has been closely associated with CSC enrichment and chemoresistance in breast cancer, we asked whether combinational CMG treatment suppressed hypoxia [28,29]. Hypoxia was assessed using a luciferase reporter plasmid containing three hypoxia response elements from the Pgk-1 gene upstream of firefly luciferase [30]. Using this system, active HIFs would bind to hypoxia response elements to mediate transcription and induce luciferase transcription [31]. We found that cisplatin increased the transcriptional activity of HIFs while the combination of metformin and gefitinib (MG) reduced HIF activity (Figure 3A). Moreover, the combination of CMG was able to antagonize cisplatin-upregulated HIF activity (Figure 3A). Similar findings were observed using a HIF1α oxygen-dependent degradation sequence luciferase reporter (ODD-Luc) hypoxia reporter (Figure 3B) [32]. Additionally, RT-qPCR analysis of hypoxia-response-element containing genes showed that CMG treatment suppressed PDK1 and LDH1 gene expression (Figure 3C,D) [33,34].
FACs analysis was preformed to assess whether inhibition of hypoxia with CMG would correlate with a sensitization of cells to cisplatin-mediated apoptosis. Individual and dual combinations of cisplatin, metformin and gefitinib did not significantly induce early apoptosis (Annexin-V+/7-AAD−) or late apoptosis (Annexin-V+/7-AAD+) in TNBC cells (Figure 3E). Early apoptotic cells represent the cells undergoing apoptosis while retaining an intact cell membrane at the time of analysis. Notably, only the CMG combination significantly increased both early and late apoptosis in MDA-MB-231 cells (Figure 3E). Together, these data suggest that the CMG combinational treatment is able to inhibit hypoxia and promote TNBC apoptosis.

2.4. CMG Treatment Effectively Inhibits the Viability of TNBC Organotypic Cultures and Reduces Their CSC Subpopulations

To verify the above findings in a clinically relevant model, we obtained two clinical samples (CRDCA and SEM-1) from patients with TNBC and three TNBC patient-derived xenograft (PDX) tumors (HCI-001, HCI-002 and HCI-016). Samples were sliced into 2 × 1 mm, cultured ex vivo and treated with the drug in different combinations at the clinically relevant concentrations for 144 h. Alamar blue viability analysis demonstrated the efficacy of CMG treatment in all five clinically heterologous samples, showing a significant reduction in cell viability post-treatment (Figure 4A). Moreover, CMG combination also significantly suppressed both epithelial (ALDH+) and mesenchymal (CD44+/CD24−) CSC subpopulations in all five clinically heterologous samples (Figure 4B–E).
Of note, the results from clinical TNBC samples (three PDX and two clinical samples) amongst the single drug inhibitors are not same as the results from TNBC cell lines (as shown in Figure 3). Indeed, the gene expressions of EGFR, apoptotic resistance, stemness and hypoxia between TNBC patient tumors and TNBC cell line were different in the NCBI Gene Expression Omnibus (GEO2R) (Supplemental Figure S3A–C). These differences also highlight the importance to use clinically translatable models such as PDX for the development of therapeutic interventions.

3. Discussion

Cisplatin is a chemotherapeutic drug and has been widely used for the effective treatment of ovarian, cervical, bone, esophageal and lung cancers [35,36,37,38,39,40]. Renewed interest in cisplatin has led to more clinical trials, showing efficacious results in the treatment of other types of cancer, including TNBC [41,42,43,44,45]. Clinical trials using cisplatin for the treatment of TNBC discourage the use of cisplatin alone as adjuvant or neoadjuvent therapy [7]. However, cisplatin in combination with gemcitabine/docetaxel or bevacizumab in clinical trials has shown better outcomes [3,46,47]. Trial CBCSG006 found that cisplatin and gemcitabine combination displayed superior efficacy in comparison to the conventional paclitaxel and gemcitabine combination for the treatment of metastatic TNBC [41].
A drawback for cisplatin treatment is its modulation of an assortment of signalling pathways that bars its long-term efficacy. Cisplatin has been found to induce interleukin-6 (IL-6) which promotes the accumulation of hypoxia inducible factors and CSC enrichment [8,48]. Cisplatin has also been demonstrated to induce STAT3 and NF-kβ expression following treatment. Of note, IL-6 triggers STAT3 and NF-kB signaling pathways in TNBC [49,50]; both STAT3 and NF-kB pathways are direct regulators to stimulate HIF-1α, chemoresistance and CSC enrichment [51,52,53]. With the expanding role of cisplatin in TNBC treatment, suppressing cisplatin-induced hypoxia is critical for preventing cisplatin-resistance and CSC enrichment following treatment [8,54,55,56].
To prevent cisplatin-induced hypoxia, we employed metformin (first-line therapy for the treatment of type II diabetes), which was found to potently suppress hypoxia [21,57,58,59]. Metformin inhibits complex I of the mitochondria to indirectly stimulate AMPK, which, in turn, activates TSC1/TSC2 to inhibit mTORC1 and subsequent hypoxia signalling. Mechanistic analysis of metformin in an esophageal cancer cell model demonstrated a widespread downregulation of P13K/mTOR related proteins and stemness-related proteins, which correlated with a reduction in ALDH+ CSCs and increased apoptosis when combined with chemotherapy [60]. However, a study using AMPKα siRNA on HEP2G and Huh7 liver cancer cell lines showed that AMPK activation did not affect HIF-1α. Interestingly, treatment with metformin was still able to potently suppress HIF-1α protein levels and transcriptional activity via AMPK independent modulation of HIF1α protein stability [21]. Thus, metformin exhibits anti-hypoxic properties through AMPK dependent and independent mechanisms.
Short-term Gefitinib treatment prevents EGFR activity and subsequently activate Akt/mTORC1, leading to inhibition of cisplatin-induced hypoxia [16,61]. Long-term gefitinib treatment promotes Akt/mTORC1 signalling via activation of STAT3, PLAUR and/or TGF-α, which leads to hypoxia, CSC related gene expression and gefitinib resistance [18,62]. We found that even short-term treatment of TNBC cells with gefitinib led to the upregulation of hypoxia-related PDK1 gene, a potential early sign of resistance (Figure 3C).
Since gene expressions of hypoxia and EGFR were upregulated in TNBC patient tumors in comparison to normal mammary tissue (Figure 1A,B), we reasoned that their inhibition may increase cisplatin efficacy in TNBC. In addition, upregulation of hypoxia and EGFR is also associated with cisplatin resistance in ovarian cancer models (Supplemental Figure S1A–D), which further supports this possibility. Indeed, CMG combination effectively reducing TNBC cell viability and inhibiting both mesenchymal CD44+/CD24− CSCs and epithelial ALDH+ CSCs (Figure 2A–H and Supplemental Figure S2A,B). Luciferase-gene reporter analysis demonstrated that cisplatin promoted TNBC hypoxia (Figure 3A–C), which may associate with drug resistance and CSC enrichment. However, CMG combination was able prevent cisplatin-induced hypoxia and promote apoptosis (Figure 3A–E).
Using organotypic cultures of five TNBC patient tumor fragments, we further verified our findings. Importantly, we revealed a differential pattern of gene expressions between TNBC patient tumors TNBC cell lines (Supplemental Figure S3A–C). This highlights the importance to use ex vivo patient tumors in experiments or in addition, in vivo patient tumors in mouse models, for clinical translation. Of note, the patient tumors from PDX samples were selected to represent a clinical setting, including paclitaxel-resistant HCI-001, paclitaxel-sensitive HCI-002 and naïve HCI-016 (obtained from patient without prior exposure to chemotherapy) [63,64]. Importantly, combination of CMG at clinically relevant dosages was capable of inhibiting both bulk and CSC subpopulations in all five clinical tumors in ex vivo organotypic cultures (Figure 4A–E) [65,66,67]. As assessment of drug efficacy using short-term organotypic cultures of PDX have demonstrated clinical concordance [68,69,70,71], our data support the clinical translatability of the CMG treatment. As cisplatin, gefitinib, and metformin are all currently used in clinic, our study may lead to a new avenue in TNBC treatment.

4. Materials and Methods

4.1. Cell Culture and Reagents

MDA-MB-231 breast cancer cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM-F12 media supplemented with 10% Fetal bovine serum (FBS, HyClone, Logan, UT, USA) and 1% penicillin/streptomycin. SUM 149-PT breast cancer cells were obtained from Asterand (Detroit, MI, USA) and cultured in Hams F-12 media (Mediatech, Manassas, VA, USA) containing 5% FBS, 5 μg/mL insulin, 1 μg/mL hydrocortisone, 10 mm HEPES, and 1% penicillin/streptomycin. Cells were cultured at 37 °C in a 5% CO2 incubator. Cisplatin was purchased from Caymen Chemical Company (Ann Arbor, MI, USA), gefitinib from LC Labs- G-4408 (Woburn, MA, USA) and metformin from Caymen Chemical Company (Ann Arbor, MI, USA).

4.2. Organotypic Cultures of Patient TNBC Breast Tumor and Patient-Derived Xenograft Fragments

Tumor tissues from two TNBC patients undergoing routine surgical procedures were obtained following the protocol approved by The Ottawa Hospital Research Ethics Board (Protocol# 20120559-01H). Approximately 2 mm cores were obtained using a sterile biopsy punch that was further sliced with a scalpel to obtain approximately 2 × 1 mm tumor slices. The slices were randomized and placed into a well of 24-well plate and cultured in DMEM-F12 medium supplemented with 10% FBS, 1% penicillin/streptomycin, 1 µg/mL insulin, 0.5 ng/mL hydrocortisol and 3 ng/mL epidermal growth factor. The tissue fragments were treated with the same concentrations of inhibitors as described in the figures, followed by a viability assay and flow cytometric analysis as previously described [72,73]. The TNBC patient-derived xenograft samples HCI-001, HCI-002, HCI-016 was obtained from University of Utah, cut similarly to the patient tumor samples and cultured in the same conditions as the clinical samples.

4.3. Flow Cytometry Analysis

Dissociated cancer cells were filtered through a 4 µm strainer and suspended in PBS supplemented with 2% FBS and 2 mM EDTA (FACS buffer) as previously described [73]. One µL of mouse IgG (1 mg/mL) was added and incubated at 4 °C for 10 min. The cells were then re-suspended in 1× binding buffer and anti-CD44 (APC) in combination with anti-CD24 (PE) antibodies (BD, Mississauga, ON, Canada) according to the manufacturer’s instructions for 30 min. The cells were washed twice with FACS buffer and 7-aminoactinomycin D (7-AAD, eBioscience, San Diego, CA, USA) and Annexin-V/V450 (BD) was added and incubated for 15 min at room temperature to assess dead and apoptotic cells. Flow cytometry was performed on the BD LSRFortessa. Data were analyzed with FlowJo software (Ashland, OR, USA).

4.4. Quantitative Real-Time PCR

Total RNAs were extracted using RNeasy kit (QIAGEN) and real-time qPCR (RT-qPCR) analysis was performed using Bio-Rad MyiQ (Bio-Rad, Hercules, CA, USA) as described previously [72]. The conditions for RT-qPCR reactions were one cycle at 95 °C for 20 s followed by 45 cycles at 95 °C for three seconds and annealing at 60 °C for 30 s. Results were normalized to the housekeeping gene 18S ribosomal RNA (18S). Relative expression level of genes from different groups were calculated with the 2−ΔΔCt method and compared with the expression levels of appropriate control cells. Specific primer sequences for individual genes are listed in Table 1.

4.5. Luciferase Reporter

MDA-MB-231 TNBC cells were seeded into 24-well plates and transfected with 500 ng of ODD-Luciferase-pcDNA3 (Addgene Plasmid # 18965, a gift from William Kaelin) [32], or HRE-luciferase (Addgene Plasmid # 26731, a gift from Navdeep Chandel) [73] in conjunction with 500 ng Renilla pRL-SV40P construct (Addgene Plasmid #27163, a gift from Dr. Ron Prywes) [74] using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. After 18 h, cells were treated with either DMSO (vehicle), cisplatin (5 µM), metformin (25 µM), gefitinib (5 µM) or different combinations for 24 h, after which cells were lysed and both Firefly and Renilla luciferase activities were quantified using a Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA) following the manufacturer’s instructions.

4.6. Cell Viability Assays

MDA-MB-231 cells were seeded into 24 well plates (5 × 104 cells/well). After 120 h of treatment, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, 5 mg/mL) was added to determine cellular viability. Absorbance was read at 570 nm. For clinical/PDX tumors, Alamar blue viability analysis was performed by incubation with 10% Alamar blue reagent (Thermo Fisher Scientific, Waltham, MA, USA) for 4 h. Florescence was measured at 560 nm excitation and 590 nm emission. Alternatively, cell counting was preformed after trypsinization of cells into single cell suspension followed by 1:10 dilution with trypan blue dye, followed by counting viable cells in haemocytometer under microscopy.

4.7. Clinical Database Analysis

Gene Expression Omnibus2R database [75,76] was used to analyze various datasets. Dataset: GSE15709 was used to compare cisplatin resistant and sensitive ovarian cancer cell lines [77]: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE15709 (Supplemental Figure S1). Dataset GSE38959 was used to compare 30 TNBC patient samples to 13 normal mammary tissue samples [78]: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38959. Dataset GSE65216 was used to compare 55 TNBC patient samples to 12 TNBC cell lines [79,80,81]: https://www.ncbi.nlm.nih.gov/geo/geo2r/?acc=GSE65216&platform=GPL570.

4.8. Statistical Analysis

For all clinical databases, the log rank test was performed to determine the statistical differences between groups. Data are expressed as means +/− standard deviation (SD) or standard error (SE). Data distributions were tested by one-way ANOVA and statistical differences between groups were assessed by unpaired Student’s t-test (comparison of two groups). Results were considered significant when * p < 0.05, ** p < 0.01, or *** p < 0.001.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/21/16/5788/s1.

Author Contributions

Conceptualization, A.S., S.M. and L.W.; methodology, A.S., S.M., J.C., E.A.-K., A.P., L.L., K.M.; validation, A.S., S.M., J.C., E.A.-K., A.P., L.L. and K.M.; formal analysis, A.S., S.M., J.C., E.A.-K. and A.P.; investigation, A.S., S.M., J.C., E.A.-K., A.P., L.L. and K.M.; resources, J.D. and C.A.; data curation, A.S. and S.M.; writing—original draft preparation, A.S. and S.M.; writing—review and editing, S.M. and L.W.; supervision, A.S., X.L. and L.W.; project administration, A.S. and L.W.; funding acquisition, L.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by operating grants Cancer Research Society/University of Ottawa (24064) and Natural Sciences and Engineering Research Council (NSERC, RGPIN-2019-0522) to LW; Alexander Graham Bell Canada Graduate Scholarship of NSERC and the Michael Smith Foreign Study Supplements to AS.

Acknowledgments

We thank the Huntsman Cancer Institute in Salt Lake City, UT for the use of the Preclinical Research Resource (PRR) to provide the PDX (HCI-001, HCI-002, and HCI-016) samples.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

EGFREpidermal growth factor receptor
CD44Cluster of differentiation 44 (hyaluronic acid receptor)
CD24Cluster of differentiation 24
CSCCancer stem cell
ALDHAldehyde dehydrogenase
ESR1Estrogen receptor 1 (alpha)
PGRProgesterone receptor
HER2Human epidermal growth factor receptor type 2
PDXPatient-derived xenograft
TNBCTriple negative breast cancer
CMGCisplatin, Metformin and Gefitinib combination
MGMetformin and gefitinib combination

References

  1. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2017. Ca A Cancer J. Clin. 2017, 67, 7–30. [Google Scholar] [CrossRef][Green Version]
  2. Go, R.S.; Adjei, A.A. Review of the comparative pharmacology and clinical activity of cisplatin and carboplatin. J. Clin. Oncol. 1999, 17, 409. [Google Scholar] [CrossRef]
  3. Hu, X.C.; Zhang, J.; Xu, B.H.; Cai, L.; Ragaz, J.; Wang, Z.H.; Wang, B.Y.; Teng, Y.E.; Tong, Z.S.; Pan, Y.Y.; et al. Cisplatin plus gemcitabine versus paclitaxel plus gemcitabine as first-line therapy for metastatic triple-negative breast cancer (CBCSG006): A randomised, open-label, multicentre, phase 3 trial. Lancet Oncol. 2015, 16, 436–446. [Google Scholar] [CrossRef]
  4. Rodler, E.T.; Kurland, B.F.; Griffin, M.; Gralow, J.R.; Porter, P.; Yeh, R.F.; Gadi, V.K.; Guenthoer, J.; Beumer, J.H.; Korde, L.; et al. Phase I study of veliparib (ABT-888) combined with cisplatin and vinorelbine in advanced triple-negative breast cancer and/or BRCA mutation–associated breast cancer. Clin. Cancer Res. 2016, 22, 2855–2864. [Google Scholar] [CrossRef][Green Version]
  5. Ferreira, A.R.; Metzger-Filho, O.; Sarmento, R.; Bines, J. Neoadjuvant Treatment of Stage IIB/III Triple Negative Breast Cancer with Cyclophosphamide, Doxorubicin, and Cisplatin (CAP Regimen): A Single Arm, Single Center Phase II Study (GBECAM 2008/02). Front. Oncol. 2018, 7, 329. [Google Scholar] [CrossRef][Green Version]
  6. Su, Y.W.; Hung, C.Y.; Lam, H.B.; Chang, Y.C.; Yang, P.S. A single institution experience of incorporation of cisplatin into adjuvant chemotherapy for patients with triple-negative breast cancer of unknown BRCA mutation status. Clin. Med. Insights Oncol. 2018, 12, 1179554918794672. [Google Scholar] [CrossRef]
  7. Silver, D.P.; Richardson, A.L.; Eklund, A.C.; Wang, Z.C.; Szallasi, Z.; Li, Q.; Juul, N.; Leong, C.O.; Calogrias, D.; Buraimoh, A.; et al. Efficacy of neoadjuvant Cisplatin in triple-negative breast cancer. J. Clin. Oncol 2010, 28, 1145. [Google Scholar] [CrossRef]
  8. Zhang, F.; Duan, S.; Tsai, Y.; Keng, P.C.; Chen, Y.; Lee, S.O.; Chen, Y. Cisplatin treatment increases stemness through upregulation of hypoxia-inducible factors by interleukin-6 in non-small cell lung cancer. Cancer Sci. 2016, 107, 746–754. [Google Scholar] [CrossRef]
  9. Jia, D.; Tan, Y.; Liu, H.; Ooi, S.; Li, L.; Wright, K.; Bennett, S.; Addison, C.L.; Wang, L.J.O. Cardamonin reduces chemotherapy-enriched breast cancer stem-like cells in vitro and in vivo. Oncotarget 2016, 7, 771. [Google Scholar] [CrossRef][Green Version]
  10. Liu, S.; Cong, Y.; Wang, D.; Sun, Y.; Deng, L.; Liu, Y.; Martin-Trevino, R.; Shang, L.; McDermott, S.P.; Landis, M.D.; et al. Breast cancer stem cells transition between epithelial and mesenchymal states reflective of their normal counterparts. Stem Cell Rep. 2014, 2, 78–91. [Google Scholar] [CrossRef]
  11. Al-Hajj, M.; Wicha, M.S.; Benito-Hernandez, A.; Morrison, S.J.; Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 3983–3988. [Google Scholar] [CrossRef][Green Version]
  12. Sulaiman, A.; McGarry, S.; Li, L.; Jia, D.; Ooi, S.; Addison, C.; Dimitroulakos, J.; Arnaout, A.; Nessim, C.; Yao, Z.; et al. Dual inhibition of Wnt and Yes-associated protein signaling retards the growth of triple-negative breast cancer in both mesenchymal and epithelial states. Mol. Oncol. 2018, 12, 423–440. [Google Scholar] [CrossRef]
  13. Li, W.; Ma, H.; Zhang, J.; Zhu, L.; Wang, C.; Yang, Y. Unraveling the roles of CD44/CD24 and ALDH1 as cancer stem cell markers in tumorigenesis and metastasis. Sci. Rep. 2017, 7, 13856. [Google Scholar] [CrossRef][Green Version]
  14. Lim, S.O.; Li, C.W.; Xia, W.; Lee, H.H.; Chang, S.S.; Shen, J.; Hsu, J.L.; Raftery, D.; Djukovic, D.; Gu, H.; et al. EGFR signaling enhances aerobic glycolysis in triple-negative breast cancer cells to promote tumor growth and immune escape. Cancer Res. 2016, 76, 1284–1296. [Google Scholar] [CrossRef][Green Version]
  15. Nakai, K.; Hung, M.C.; Yamaguchi, H. A perspective on anti-EGFR therapies targeting triple-negative breast cancer. Am. J. Cancer Res. 2016, 6, 1609. [Google Scholar]
  16. Rho, J.K.; Choi, Y.J.; Lee, J.K.; Ryoo, B.Y.; Na, I.I.; Yang, S.H.; Kim, C.H.; Yoo, Y.D.; Lee, J.C. Gefitinib circumvents hypoxia-induced drug resistance by the modulation of HIF-1α. Oncol. Rep. 2009, 21, 801–807. [Google Scholar]
  17. Liu, S.; Yang, H.; Ge, X.; Su, L.; Zhang, A.; Liang, L. Drug resistance analysis of gefitinib-targeted therapy in non-small cell lung cancer. Oncol. Lett. 2016, 12, 3941–3943. [Google Scholar] [CrossRef][Green Version]
  18. Minakata, K.; Takahashi, F.; Nara, T.; Hashimoto, M.; Tajima, K.; Murakami, A.; Nurwidya, F.; Yae, S.; Koizumi, F.; Moriyama, H.; et al. Hypoxia induces gefitinib resistance in non-small-cell lung cancer with both mutant and wild-type epidermal growth factor receptors. Cancer Sci. 2012, 103, 1946–1954. [Google Scholar] [CrossRef]
  19. Huang, W.C.; Chen, Y.J.; Li, L.Y.; Wei, Y.L.; Hsu, S.C.; Tsai, S.L.; Chiu, P.C.; Huang, W.P.; Wang, Y.N.; Chen, C.H.; et al. Nuclear translocation of epidermal growth factor receptor by Akt-dependent phosphorylation enhances breast cancer-resistant protein expression in gefitinib-resistant cells. J. Biol. Chem. 2011, 286, 20558–20568. [Google Scholar] [CrossRef][Green Version]
  20. Kalender, A.; Selvaraj, A.; Kim, S.Y.; Gulati, P.; Brûlé, S.; Viollet, B.; Kemp, B.E.; Bardeesy, N.; Dennis, P.; Schlager, J.J.; et al. Metformin, independent of AMPK, inhibits mTORC1 in a rag GTPase-dependent manner. Cell Metab. 2010, 11, 390–401. [Google Scholar] [CrossRef][Green Version]
  21. Zhou, X.; Chen, J.; Yi, G.; Deng, M.; Liu, H.; Liang, M.; Shi, B.; Fu, X.; Chen, Y.; Chen, L.; et al. Metformin suppresses hypoxia-induced stabilization of HIF-1α through reprogramming of oxygen metabolism in hepatocellular carcinoma. Oncotarget 2016, 7, 873. [Google Scholar] [CrossRef][Green Version]
  22. Yin, X.; Wei, Z.; Song, C.; Tang, C.; Xu, W.; Wang, Y.; Xie, J.; Lin, Z.; Han, W. Metformin sensitizes hypoxia-induced gefitinib treatment resistance of HNSCC via cell cycle regulation and EMT reversal. Cancer Manag. Res. 2018, 10, 5785. [Google Scholar] [CrossRef][Green Version]
  23. Fujita, H.; Hirose, K.; Sato, M.; Fujioka, I.; Fujita, T.; Aoki, M.; Takai, Y. Metformin attenuates hypoxia-induced resistance to cisplatin in the HepG2 cell line. Oncol. Lett. 2019, 17, 2431–2440. [Google Scholar] [CrossRef]
  24. Shi, P.; Liu, W.; Wang, H.; Li, F.; Zhang, H.; Wu, Y.; Kong, Y.; Zhou, Z.; Wang, C.; Chen, W.; et al. Metformin suppresses triple-negative breast cancer stem cells by targeting KLF5 for degradation. Cell Discov. 2017, 3, 1–13. [Google Scholar] [CrossRef]
  25. Soleymani Abyaneh, H.; Gupta, N.; Radziwon-Balicka, A.; Jurasz, P.; Seubert, J.; Lai, R.; Lavasanifar, A.J.C. STAT3 but not HIF-1α is important in mediating Hypoxia-Induced chemoresistance in MDA-MB-231, a triple negative breast cancer cell line. Cancers 2017, 9, 137. [Google Scholar] [CrossRef][Green Version]
  26. Kim, E.M.; Mueller, K.; Gartner, E.; Boerner, J. Dasatinib is synergistic with cetuximab and cisplatin in triple-negative breast cancer cells. J. Surg. Res. 2013, 185, 231–239. [Google Scholar] [CrossRef]
  27. Ginestier, C.; Hur, M.H.; Charafe-Jauffret, E.; Monville, F.; Dutcher, J.; Brown, M.; Jacquemier, J.; Viens, P.; Kleer, C.G.; Liu, S.; et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 2007, 1, 555–567. [Google Scholar] [CrossRef][Green Version]
  28. Shiraishi, A.; Tachi, K.; Essid, N.; Tsuboi, I.; Nagano, M.; Kato, T.; Yamashita, T.; Bando, H.; Hara, H.; Ohneda, O. Hypoxia promotes the phenotypic change of aldehyde dehydrogenase activity of breast cancer stem cells. Cancer Sci. 2017, 108, 362–372. [Google Scholar] [CrossRef][Green Version]
  29. Crowder, S.W.; Balikov, D.A.; Hwang, Y.S.; Sung, H.J. Cancer stem cells under hypoxia as a chemoresistance factor in the breast and brain. Curr. Pathobiol. Rep. 2014, 2, 33–40. [Google Scholar] [CrossRef]
  30. Emerling, B.M.; Weinberg, F.; Liu, J.L.; Mak, T.W.; Chandel, N.S. PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a). Proc. Natl. Acad. Sci. USA 2008, 105, 2622–2627. [Google Scholar] [CrossRef][Green Version]
  31. Dengler, V.L.; Galbraith, M.D.; Espinosa, J.M. Transcriptional regulation by hypoxia inducible factors. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 1–15. [Google Scholar] [CrossRef][Green Version]
  32. Safran, M.; Kim, W.Y.; O’Connell, F.; Flippin, L.; Günzler, V.; Horner, J.W.; DePinho, R.A.; Kaelin, W.G. Mouse model for noninvasive imaging of HIF prolyl hydroxylase activity: Assessment of an oral agent that stimulates erythropoietin production. Proc. Natl. Acad. Sci. USA 2006, 103, 105–110. [Google Scholar] [CrossRef][Green Version]
  33. Semba, H.; Takeda, N.; Isagawa, T.; Sugiura, Y.; Honda, K.; Wake, M.; Miyazawa, H.; Yamaguchi, Y.; Miura, M.; Jenkins, D.M.R.; et al. HIF-1α-PDK1 axis-induced active glycolysis plays an essential role in macrophage migratory capacity. Nat. Commun. 2016, 7, 11635. [Google Scholar] [CrossRef]
  34. McGinn, O.; Gupta, V.K.; Dauer, P.; Arora, N.; Sharma, N.; Nomura, A.; Dudeja, V.; Saluja, A.; Banerjee, S. Inhibition of hypoxic response decreases stemness and reduces tumorigenic signaling due to impaired assembly of HIF1 transcription complex in pancreatic cancer. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef]
  35. Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef][Green Version]
  36. Group, I.A.L.C.T.C. Cisplatin-based adjuvant chemotherapy in patients with completely resected non–small-cell lung cancer. New Engl. J. Med. 2004, 350, 351–360. [Google Scholar]
  37. Collaboration, N.C.f.L.A.C.C.M. Neoadjuvant chemotherapy for locally advanced cervical cancer: A systematic review and meta-analysis of individual patient data from 21 randomised trials. Eur. J. Cancer 2003, 39, 2470–2486. [Google Scholar]
  38. McClay, E.F.; Howell, S.B. A review: Intraperitoneal cisplatin in the management of patients with ovarian cancer. Gynecol. Oncol. 1990, 36, 1–6. [Google Scholar] [CrossRef]
  39. Andronescu, E.; Ficai, A.; Albu, M.G.; Mitran, V.; Sonmez, M.; Ficai, D.; Ion, R.; Cimpean, A. Collagen-hydroxyapatite/cisplatin drug delivery systems for locoregional treatment of bone cancer. Technol. Cancer Res. Treat. 2013, 12, 275–284. [Google Scholar] [CrossRef]
  40. Walsh, T.N.; Noonan, N.; Hollywood, D.; Kelly, A.; Keeling, N.; Hennessy, T.P. A comparison of multimodal therapy and surgery for esophageal adenocarcinoma. New Engl. J. Med. 1996, 335, 462–467. [Google Scholar] [CrossRef][Green Version]
  41. Zhang, J.; Lin, Y.; Sun, X.; Wang, B.; Wang, Z.; Luo, J.; Wang, L.; Zhang, S.; Cao, J.; Tao, Z.; et al. Biomarker assessment of the CBCSG006 trial: A randomized phase III trial of cisplatin plus gemcitabine compared with paclitaxel plus gemcitabine as first-line therapy for patients with metastatic triple-negative breast cancer. Ann. Oncol. 2018, 29, 1741–1747. [Google Scholar] [CrossRef]
  42. Baselga, J.; Gómez, P.; Greil, R.; Braga, S.; Climent, M.A.; Wardley, A.M.; Kaufman, B.; Stemmer, S.M.; Pêgo, A.; Chan, A.; et al. Randomized phase II study of the anti–epidermal growth factor receptor monoclonal antibody cetuximab with cisplatin versus cisplatin alone in patients with metastatic triple-negative breast cancer. J. Clin. Oncol. 2013, 31, 2586. [Google Scholar] [CrossRef]
  43. Jovanović, B.; Mayer, I.A.; Mayer, E.L.; Abramson, V.G.; Bardia, A.; Sanders, M.E.; Kuba, M.G.; Estrada, M.V.; Beeler, J.S.; Shaver, T.M.; et al. A randomized phase II neoadjuvant study of cisplatin, paclitaxel with or without everolimus in patients with stage II/III Triple-Negative Breast Cancer (TNBC): Responses and long-term outcome correlated with increased frequency of DNA damage response gene mutations, TNBC Subtype, AR Status, and Ki67. Clin. Cancer Res. 2017, 23, 4035–4045. [Google Scholar]
  44. Isakoff, S.J.; Mayer, E.L.; He, L.; Traina, T.A.; Carey, L.A.; Krag, K.J.; Rugo, H.S.; Liu, M.C.; Stearns, V.; Come, S.E.; et al. TBCRC009: A multicenter phase II clinical trial of platinum monotherapy with biomarker assessment in metastatic triple-negative breast cancer. J. Clin. Oncol. 2015, 33, 1902. [Google Scholar] [CrossRef]
  45. Baek, D.W.; Park, J.Y.; Lee, S.J.; Chae, Y.S. Impressive effect of cisplatin monotherapy on a patient with heavily pretreated triple-negative breast cancer with poor performance. Yeungnam Univ. J. Med. 2020, 37, 230–235. [Google Scholar] [CrossRef]
  46. Fan, Y.; Xu, B.; Yuan, P.; Ma, F.; Wang, J.; Ding, X.; Zhang, P.; Li, Q.; Cai, R. Docetaxel–cisplatin might be superior to docetaxel–capecitabine in the first-line treatment of metastatic triple-negative breast cancer. Ann. Oncol. 2012, 24, 1219–1225. [Google Scholar] [CrossRef]
  47. Ryan, P.; Tung, N.; Isakoff, S.; Golshan, M.; Richardson, A.; Corben, A.; Smith, B.; Gelman, R.; Winer, E.; Garber, J. Neoadjuvant cisplatin and bevacizumab in triple negative breast cancer (TNBC): Safety and efficacy. J. Clin. Oncol. 2009, 27, 551. [Google Scholar]
  48. Liu, C.C.; Lin, J.H.; Hsu, T.W.; Su, K.; Li, A.F.Y.; Hsu, H.S.; Hung, S.C. IL-6 enriched lung cancer stem-like cell population by inhibition of cell cycle regulators via DNMT1 upregulation. Int. J. Cancer 2015, 136, 547–559. [Google Scholar]
  49. Qin, J.J.; Yan, L.; Zhang, J.; Zhang, W.D. STAT3 as a potential therapeutic target in triple negative breast cancer: A systematic review. J. Exp. Clin. Cancer Res. 2019, 38, 195. [Google Scholar] [CrossRef]
  50. Hartman, Z.C.; Poage, G.M.; Den Hollander, P.; Tsimelzon, A.; Hill, J.; Panupinthu, N.; Zhang, Y.; Mazumdar, A.; Hilsenbeck, S.G.; Mills, G.B.; et al. Growth of triple-negative breast cancer cells relies upon coordinate autocrine expression of the proinflammatory cytokines IL-6 and IL-8. Cancer Res. 2013, 73, 3470–3480. [Google Scholar] [CrossRef][Green Version]
  51. Kuo, W.Y.; Hwu, L.; Wu, C.Y.; Lee, J.S.; Chang, C.W.; Liu, R.S. STAT3/NF-κB-Regulated Lentiviral TK/GCV Suicide Gene Therapy for Cisplatin-Resistant Triple-Negative Breast Cancer. Theranostics 2017, 7, 647. [Google Scholar] [CrossRef] [PubMed][Green Version]
  52. Morais, C.; Gobe, G.; Johnson, D.W.; Healy, H. Inhibition of nuclear factor kappa B transcription activity drives a synergistic effect of pyrrolidine dithiocarbamate and cisplatin for treatment of renal cell carcinoma. Apoptosis 2010, 15, 412–425. [Google Scholar] [CrossRef] [PubMed]
  53. Gu, F.; Ma, Y.; Zhang, Z.; Zhao, J.; Kobayashi, H.; Zhang, L.; Fu, L. Expression of Stat3 and Notch1 is associated with cisplatin resistance in head and neck squamous cell carcinoma. Oncol. Rep. 2010, 23, 671–676. [Google Scholar] [PubMed][Green Version]
  54. Shin, D.H.; Choi, Y.J.; Park, J.W. SIRT1 and AMPK mediate hypoxia-induced resistance of non–small cell lung cancers to cisplatin and doxorubicin. Cancer Res. 2014, 74, 298–308. [Google Scholar] [CrossRef] [PubMed][Green Version]
  55. Fischer, C.; Leithner, K.; Wohlkoenig, C.; Quehenberger, F.; Bertsch, A.; Olschewski, A.; Olschewski, H.; Hrzenjak, A. Panobinostat reduces hypoxia-induced cisplatin resistance of non-small cell lung carcinoma cells via HIF-1α destabilization. Mol. Cancer 2015, 14, 1. [Google Scholar] [CrossRef]
  56. Samanta, D.; Park, Y.; Ni, X.; Li, H.; Zahnow, C.A.; Gabrielson, E.; Pan, F.; Semenza, G.L. Chemotherapy induces enrichment of CD47+/CD73+/PDL1+ immune evasive triple-negative breast cancer cells. Proc. Natl. Acad. Sci. USA 2018, 201718197. [Google Scholar] [CrossRef][Green Version]
  57. Ye, J.; Chen, K.; Qi, L.; Li, R.; Tang, H.; Zhou, C.; Zhai, W. Metformin suppresses hypoxia-induced migration via the HIF-1α/VEGF pathway in gallbladder cancer in vitro and in vivo. Oncol. Rep. 2018, 40, 3501–3510. [Google Scholar] [CrossRef][Green Version]
  58. Tadakawa, M.; Takeda, T.; Li, B.; Tsuiji, K.; Yaegashi, N. The anti-diabetic drug metformin inhibits vascular endothelial growth factor expression via the mammalian target of rapamycin complex 1/hypoxia-inducible factor-1α signaling pathway in ELT-3 cells. Mol. Cell. Endocrinol. 2015, 399, 1–8. [Google Scholar] [CrossRef]
  59. Sahra, I.B.; Regazzetti, C.; Robert, G.; Laurent, K.; Le Marchand-Brustel, Y.; Auberger, P.; Tanti, J.-F.; Giorgetti-Peraldi, S.; Bost, F. Metformin, independent of AMPK, induces mTOR inhibition and cell-cycle arrest through REDD1. Cancer Res. 2011, 71, 4366–4372. [Google Scholar] [CrossRef][Green Version]
  60. Honjo, S.; Ajani, J.A.; Scott, A.W.; Chen, Q.; Skinner, H.D.; Stroehlein, J.; Johnson, R.L.; Song, S. Metformin sensitizes chemotherapy by targeting cancer stem cells and the mTOR pathway in esophageal cancer. Int. J. Oncol. 2014, 45, 567–574. [Google Scholar] [CrossRef][Green Version]
  61. Solomon, B.; Binns, D.; Roselt, P.; Weibe, L.I.; McArthur, G.A.; Cullinane, C.; Hicks, R.J. Modulation of intratumoral hypoxia by the epidermal growth factor receptor inhibitor gefitinib detected using small animal PET imaging. Mol. Cancer Ther. 2005, 4, 1417–1422. [Google Scholar] [CrossRef] [PubMed][Green Version]
  62. Murakami, A.; Takahashi, F.; Nurwidya, F.; Kobayashi, I.; Minakata, K.; Hashimoto, M.; Nara, T.; Kato, M.; Tajima, K.; Shimada, N.; et al. Hypoxia increases gefitinib-resistant lung cancer stem cells through the activation of insulin-like growth factor 1 receptor. PLoS ONE 2014, 9, e86459. [Google Scholar] [CrossRef] [PubMed]
  63. PDXNet. PDX Delopment and Trial Centers Research Network. Available online: https://brandi-davis-7wsf.squarespace.com/hcibcm. (accessed on 20 June 2020).
  64. DeRose, Y.S.; Wang, G.; Lin, Y.C.; Bernard, P.S.; Buys, S.S.; Ebbert, M.T.; Factor, R.; Matsen, C.; Milash, B.A.; Nelson, E.; et al. Tumor grafts derived from women with breast cancer authentically reflect tumor pathology, growth, metastasis and disease outcomes. Nat. Med. 2011, 17, 1514–1520. [Google Scholar] [CrossRef] [PubMed]
  65. Rajkumar, P.; Mathew, B.S.; Das, S.; Isaiah, R.; John, S.; Prabha, R.; Fleming, D.H. Cisplatin concentrations in long and short duration infusion: Implications for the optimal time of radiation delivery. J. Clin. Diagn. Res. 2016, 10, XC01–XC04. [Google Scholar] [CrossRef]
  66. McCreight, L.J.; Stage, T.B.; Connelly, P.; Lonergan, M.; Nielsen, F.; Prehn, C.; Adamski, J.; Brøsen, K.; Pearson, E.R. Pharmacokinetics of metformin in patients with gastrointestinal intolerance. Diabetes Obes. Metab. 2018, 20, 1593–1601. [Google Scholar] [CrossRef][Green Version]
  67. McKillop, D.; Partridge, E.A.; Kemp, J.V.; Spence, M.P.; Kendrew, J.; Barnett, S.; Wood, P.G.; Giles, P.B.; Patterson, A.B.; Bichat, F.; et al. Tumor penetration of gefitinib (Iressa), an epidermal growth factor receptor tyrosine kinase inhibitor. Mol. Cancer Ther. 2005, 4, 641–649. [Google Scholar] [CrossRef][Green Version]
  68. Borodovsky, A.; McQuiston, T.J.; Stetson, D.; Ahmed, A.; Whitston, D.; Zhang, J.; Grondine, M.; Lawson, D.; Challberg, S.S.; Zinda, M.; et al. Generation of stable PDX derived cell lines using conditional reprogramming. Mol. Cancer 2017, 16, 177. [Google Scholar] [CrossRef][Green Version]
  69. Yuan, H.; Myers, S.; Wang, J.; Zhou, D.; Woo, J.A.; Kallakury, B.; Ju, A.; Bazylewicz, M.; Carter, Y.M.; Albanese, C.; et al. Use of reprogrammed cells to identify therapy for respiratory papillomatosis. New Engl. J. Med. 2012, 367, 1220–1227. [Google Scholar] [CrossRef][Green Version]
  70. Fong, E.L.S.; Toh, T.B.; Lin, Q.X.X.; Liu, Z.; Hooi, L.; Rashid, M.B.M.A.; Benoukraf, T.; Chow, E.K.H.; Huynh, T.H.; Yu, H. Generation of matched patient-derived xenograft in vitro-in vivo models using 3D macroporous hydrogels for the study of liver cancer. Biomaterials 2018, 159, 229–240. [Google Scholar] [CrossRef]
  71. Roife, D.; Dai, B.; Kang, Y.a.; Perez, M.V.R.; Pratt, M.; Li, X.; Fleming, J.B. Ex vivo testing of patient-derived xenografts mirrors the clinical outcome of patients with pancreatic ductal adenocarcinoma. Clin. Cancer Res. 2016, 22, 6021–6030. [Google Scholar] [CrossRef][Green Version]
  72. Sulaiman, A.; Sulaiman, B.; Khouri, L.; McGarry, S.; Nessim, C.; Arnaout, A.; Li, X.; Addison, C.; Dimitroulakos, J.; Wang, L. Both bulk and cancer stem cell subpopulations in triple-negative breast cancer are susceptible to Wnt, HDAC, and ERα coinhibition. Febs Lett. 2016, 590, 4606–4616. [Google Scholar] [CrossRef] [PubMed]
  73. Sulaiman, A.; McGarry, S.; Lam, K.M.; El-Sahli, S.; Chambers, J.; Kaczmarek, S.; Li, L.; Addison, C.; Dimitroulakos, J.; Arnaout, A.; et al. Co-inhibition of mTORC1, HDAC and ESR1α retards the growth of triple-negative breast cancer and suppresses cancer stem cells. Cell Death Dis. 2018, 9, 815. [Google Scholar] [CrossRef] [PubMed][Green Version]
  74. Chen, X.; Prywes, R. Serum-induced expression of the cdc25AGene by relief of E2F-mediated repression. Mol. Cell. Biol. 1999, 19, 4695–4702. [Google Scholar] [CrossRef][Green Version]
  75. Edgar, R.; Domrachev, M.; Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef][Green Version]
  76. Barrett, T.; Wilhite, S.E.; Ledoux, P.; Evangelista, C.; Kim, I.F.; Tomashevsky, M.; Marshall, K.A.; Phillippy, K.H.; Sherman, P.M.; Holko, M.; et al. NCBI GEO: Archive for functional genomics data sets—update. Nucleic Acids Res. 2012, 41, D991–D995. [Google Scholar] [CrossRef] [PubMed][Green Version]
  77. Li, M.; Balch, C.; Montgomery, J.S.; Jeong, M.; Chung, J.H.; Yan, P.; Huang, T.H.; Kim, S.; Nephew, K.P. Integrated analysis of DNA methylation and gene expression reveals specific signaling pathways associated with platinum resistance in ovarian cancer. Bmc Med. Genom. 2009, 2, 34. [Google Scholar] [CrossRef][Green Version]
  78. Komatsu, M.; Yoshimaru, T.; Matsuo, T.; Kiyotani, K.; Miyoshi, Y.; Tanahashi, T.; Rokutan, K.; Yamaguchi, R.; Saito, A.; Imoto, S.; et al. Molecular features of triple negative breast cancer cells by genome-wide gene expression profiling analysis. Int. J. Oncol. 2013, 42, 478–506. [Google Scholar] [CrossRef][Green Version]
  79. Maubant, S.; Tesson, B.; Maire, V.; Ye, M.; Rigaill, G.; Gentien, D.; Cruzalegui, F.; Tucker, G.C.; Roman-Roman, S.; Dubois, T. Transcriptome analysis of Wnt3a-treated triple-negative breast cancer cells. PLoS ONE 2015, 10, e0122333. [Google Scholar] [CrossRef][Green Version]
  80. Maire, V.; Baldeyron, C.; Richardson, M.; Tesson, B.; Vincent-Salomon, A.; Gravier, E.; Marty-Prouvost, B.; De Koning, L.; Rigaill, G.; Dumont, A.; et al. TTK/hMPS1 is an attractive therapeutic target for triple-negative breast cancer. PLoS ONE 2013, 8, e63712. [Google Scholar] [CrossRef]
  81. Maire, V.; Némati, F.; Richardson, M.; Vincent-Salomon, A.; Tesson, B.; Rigaill, G.; Gravier, E.; Marty-Prouvost, B.; De Koning, L.; Lang, G.; et al. Polo-like kinase 1: A potential therapeutic option in combination with conventional chemotherapy for the management of patients with triple-negative breast cancer. Cancer Res. 2013, 73, 813–823. [Google Scholar] [CrossRef][Green Version]
Figure 1. TNBC is associated with high levels of hypoxia, EGFR, stemness-related and anti-apoptosis related gene expression. (AD) The relative expression levels (A.U arbitrary unit) of genes in 30 TNBC and 13 normal mammary tissue samples using the NCBI Gene Expression Omnibus (GEO2R). GSE38959 samples were analyzed using the GPL4133 Agilent-014850 Whole Human Genome Microarray 4 × 44K.
Figure 1. TNBC is associated with high levels of hypoxia, EGFR, stemness-related and anti-apoptosis related gene expression. (AD) The relative expression levels (A.U arbitrary unit) of genes in 30 TNBC and 13 normal mammary tissue samples using the NCBI Gene Expression Omnibus (GEO2R). GSE38959 samples were analyzed using the GPL4133 Agilent-014850 Whole Human Genome Microarray 4 × 44K.
Ijms 21 05788 g001
Figure 2. Co-inhibition of hypoxia and EGFR in combination with cisplatin effectively suppress bulk tumor cells and CSC subpopulations in TNBC. (A) Relative viability (MTT assay) of SUM 149-PT TNBC cells after 120 h of exposure to DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). (B) Relative viability (viable cell counting) of MDA-MB-231 TNBC cells after 120 h of the same treatment as described in (A) (C,D) Living CSCs (CD44+/CD24−) in SUM 149-PT and MDA-MB-231 cells after 120 h of exposure to the drugs as described in (A). (E,F) Living CSCs (ALDH+) in SUM 149-PT and MDA-MB-231 cells after 120 h of exposure to the drugs as described in (A). (G,H) Representative flow cytometric plots of the CSC subpopulations (CD44+/CD24− or ALDH+) in MDA-MB-231 cells after 120 h of treatment with the drugs as described in (A). Data represent means ± SD, n = 3 repeats; * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 2. Co-inhibition of hypoxia and EGFR in combination with cisplatin effectively suppress bulk tumor cells and CSC subpopulations in TNBC. (A) Relative viability (MTT assay) of SUM 149-PT TNBC cells after 120 h of exposure to DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). (B) Relative viability (viable cell counting) of MDA-MB-231 TNBC cells after 120 h of the same treatment as described in (A) (C,D) Living CSCs (CD44+/CD24−) in SUM 149-PT and MDA-MB-231 cells after 120 h of exposure to the drugs as described in (A). (E,F) Living CSCs (ALDH+) in SUM 149-PT and MDA-MB-231 cells after 120 h of exposure to the drugs as described in (A). (G,H) Representative flow cytometric plots of the CSC subpopulations (CD44+/CD24− or ALDH+) in MDA-MB-231 cells after 120 h of treatment with the drugs as described in (A). Data represent means ± SD, n = 3 repeats; * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 21 05788 g002
Figure 3. Co-inhibition of hypoxia and EGFR suppresses cisplatin-upregulated hypoxia and promotes apoptosis in TNBC. (A,B) Relative luciferase reporter expression of MDA-MB-231 TNBC cells after 24 h of drug treatment. Cells were transfected with HRE-Luciferase or ODD-Luciferase and normalized with the pRL-SV40P Renilla construct. The following day, cells were treated with DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). Data represent means ± SD, n = 3 repeats; * p < 0.05, ** p < 0.01. (C,D) RT-qPCR analysis and comparison of relative mRNA expression levels of hypoxia genes (PDK1 and LDH1) after treatment for 48 h as described in (A,B). Data represent means ± SD, n = 3 repeats; * p < 0.05, ** p < 0.01. (E) Flow cytometric analysis of cell states (Dead, Alive, Early Apoptosis or Late Apoptosis) based on Annexin-V/7-AAD markers after 72 h of exposure to DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). Data represent means ± SE, n = 3 repeats; * p < 0.05, ** p < 0.01.
Figure 3. Co-inhibition of hypoxia and EGFR suppresses cisplatin-upregulated hypoxia and promotes apoptosis in TNBC. (A,B) Relative luciferase reporter expression of MDA-MB-231 TNBC cells after 24 h of drug treatment. Cells were transfected with HRE-Luciferase or ODD-Luciferase and normalized with the pRL-SV40P Renilla construct. The following day, cells were treated with DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). Data represent means ± SD, n = 3 repeats; * p < 0.05, ** p < 0.01. (C,D) RT-qPCR analysis and comparison of relative mRNA expression levels of hypoxia genes (PDK1 and LDH1) after treatment for 48 h as described in (A,B). Data represent means ± SD, n = 3 repeats; * p < 0.05, ** p < 0.01. (E) Flow cytometric analysis of cell states (Dead, Alive, Early Apoptosis or Late Apoptosis) based on Annexin-V/7-AAD markers after 72 h of exposure to DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). Data represent means ± SE, n = 3 repeats; * p < 0.05, ** p < 0.01.
Ijms 21 05788 g003
Figure 4. Co-inhibition of hypoxia and EGFR in combination with cisplatin effectively inhibits the viability of patient tumors and CSC populations in ex vivo organotypic cultures. (A) Alamar blue viability analysis of organotypic cultures from two primary patient TNBC tumors (CRDCA and SEM-1 samples) and three patient-derived xenograft samples (HCI-001, HCI-002, HCI-016) after 144 h of exposure to DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). (B,C) Representative flow cytometric plots of the CSC subpopulations (CD44+/CD24− or ALDH+) in SEM-1 and HCI-001 cells after 144 h of treatment with the different drugs as described in (A). (D,E) Flow cytometric data of the relative living CSC (CD44+/CD24− or ALDH+) populations in SEM-1, CRDCA, HCI-016 and HCI-001 patient TNBC tumors after 144 h of exposure to the drugs as described in (A). Each bar represents individual patient sample, n = 4–5 samples; * p < 0.05, ** p < 0.01.
Figure 4. Co-inhibition of hypoxia and EGFR in combination with cisplatin effectively inhibits the viability of patient tumors and CSC populations in ex vivo organotypic cultures. (A) Alamar blue viability analysis of organotypic cultures from two primary patient TNBC tumors (CRDCA and SEM-1 samples) and three patient-derived xenograft samples (HCI-001, HCI-002, HCI-016) after 144 h of exposure to DMSO (vehicle control), cisplatin (Cis, 5 µM), gefitinib (Gef, 5 µM) and/or metformin (Met, 25 µM). (B,C) Representative flow cytometric plots of the CSC subpopulations (CD44+/CD24− or ALDH+) in SEM-1 and HCI-001 cells after 144 h of treatment with the different drugs as described in (A). (D,E) Flow cytometric data of the relative living CSC (CD44+/CD24− or ALDH+) populations in SEM-1, CRDCA, HCI-016 and HCI-001 patient TNBC tumors after 144 h of exposure to the drugs as described in (A). Each bar represents individual patient sample, n = 4–5 samples; * p < 0.05, ** p < 0.01.
Ijms 21 05788 g004
Table 1. Primers used in qPCR.
Table 1. Primers used in qPCR.
GenesForwardReverse
18SAACCCGTTGAACCCCATTCCATCCAATCGGTAGTAGCG
GAPDHACAGTCAGCCGCATCTTCTTGACAAGCTTCCCGTTCTCAG
PDK1CAACAGAGGTGTTTACCCCCATTTTCCTCAAAGGAACGCC
LDH1GGCCTGTGCCATCAGTATCTGGAGATCCATCATCTCTCCC

Share and Cite

MDPI and ACS Style

Sulaiman, A.; McGarry, S.; Chambers, J.; Al-Kadi, E.; Phan, A.; Li, L.; Mediratta, K.; Dimitroulakos, J.; Addison, C.; Li, X.; Wang, L. Targeting Hypoxia Sensitizes TNBC to Cisplatin and Promotes Inhibition of Both Bulk and Cancer Stem Cells. Int. J. Mol. Sci. 2020, 21, 5788. https://doi.org/10.3390/ijms21165788

AMA Style

Sulaiman A, McGarry S, Chambers J, Al-Kadi E, Phan A, Li L, Mediratta K, Dimitroulakos J, Addison C, Li X, Wang L. Targeting Hypoxia Sensitizes TNBC to Cisplatin and Promotes Inhibition of Both Bulk and Cancer Stem Cells. International Journal of Molecular Sciences. 2020; 21(16):5788. https://doi.org/10.3390/ijms21165788

Chicago/Turabian Style

Sulaiman, Andrew, Sarah McGarry, Jason Chambers, Emil Al-Kadi, Alexandra Phan, Li Li, Karan Mediratta, Jim Dimitroulakos, Christina Addison, Xuguang Li, and Lisheng Wang. 2020. "Targeting Hypoxia Sensitizes TNBC to Cisplatin and Promotes Inhibition of Both Bulk and Cancer Stem Cells" International Journal of Molecular Sciences 21, no. 16: 5788. https://doi.org/10.3390/ijms21165788

Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop