Differences in the Role of HDACs 4 and 5 in the Modulation of Processes Regulating MAFbx and MuRF1 Expression during Muscle Unloading
Abstract
1. Introduction
2. Results
2.1. Effect of HDAC Inhibitors on the Expression and Activity of HDACs 4 and 5
2.2. Effect of HDAC Inhibitors on Skeletal Muscle Atrophy
2.3. Effect of HDAC Inhibitors on Transcription Factors Regulating Expression of MAFbx and MuRF1
3. Discussion and Conclusions
4. Materials and Methods
4.1. Ethical Approval
4.2. Animal Procedures
4.3. Hindlimb Suspension
4.4. Protein Extraction and Western Blot Analysis
4.5. RNA Isolation and Reverse Transcription
4.6. Quantitative PCR Analysis
4.7. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Brocca, L.; Toniolo, L.; Reggiani, C.; Bottinelli, R.; Sandri, M.; Pellegrino, M.A. FoxO-dependent atrogenes vary among catabolic conditions and play a key role in muscle atrophy induced by hindlimb suspension. J. Physiol. 2017, 595, 1143–1158. [Google Scholar] [CrossRef] [PubMed]
- Khalil, R. Ubiquitin-Proteasome Pathway and Muscle Atrophy. Adv. Exp. Med. Biol. 2018, 1088, 235–248. [Google Scholar] [PubMed]
- Belova, S.P.; Shenkman, B.S.; Kostrominova, T.Y.; Nemirovskaya, T.L. Paradoxical effect of IKKbeta inhibition on the expression of E3 ubiquitin ligases and unloading-induced skeletal muscle atrophy. Physiol. Rep. 2017, 5, e13291. [Google Scholar] [CrossRef] [PubMed]
- Lomonosova, Y.N.; Shenkman, B.S.; Nemirovskaya, T.L. Attenuation of unloading-induced rat soleus atrophy with the heat-shock protein inducer 17-(allylamino)-17-demethoxygeldanamycin. Faseb J. 2012, 26, 4295–4301. [Google Scholar] [CrossRef]
- Takaya, T.; Kawamura, T.; Morimoto, T.; Ono, K.; Kita, T.; Shimatsu, A.; Hasegawa, K. Identification of p300-targeted acetylated residues in GATA4 during hypertrophic responses in cardiac myocytes. J. Biol. Chem. 2008, 283, 9828–9835. [Google Scholar] [CrossRef]
- Nebbioso, A.; Carafa, V.; Conte, M.; Tambaro, F.P.; Abbondanza, C.; Martens, J.; Nees, M.; Benedetti, R.; Pallavicini, I.; Minucci, S.; et al. c-Myc Modulation and Acetylation Is a Key HDAC Inhibitor Target in Cancer. Clin. Cancer Res. 2017, 23, 2542–2555. [Google Scholar] [CrossRef]
- You, W.; Song, L.; Wang, K. Acetylation of GATA4 on Lysine Residue K313 Promotes Osteoblastic Cells Growth. Cell Physiol. Biochem. 2018, 46, 269–278. [Google Scholar] [CrossRef]
- Mielcarek, M.; Toczek, M.; Smeets, C.J.; Franklin, S.A.; Bondulich, M.K.; Jolinon, N.; Muller, T.; Ahmed, M.; Dick, J.R.; Piotrowska, I.; et al. HDAC4-myogenin axis as an important marker of HD-related skeletal muscle atrophy. PLoS Genet. 2015, 11, e1005021. [Google Scholar] [CrossRef]
- Shin, K.; Ko, Y.G.; Jeong, J.; Kwon, H. Fbxw7beta is an inducing mediator of dexamethasone-induced skeletal muscle atrophy in vivo with the axis of Fbxw7beta-myogenin-atrogenes. Mol. Biol. Rep. 2018, 45, 625–631. [Google Scholar] [CrossRef]
- Dupre-Aucouturier, S.; Castells, J.; Freyssenet, D.; Desplanches, D. Trichostatin A, a histone deacetylase inhibitor, modulates unloaded-induced skeletal muscle atrophy. J. Appl. Physiol. 2015, 119, 342–351. [Google Scholar] [CrossRef]
- Kachaeva, E.V.; Shenkman, B.S. Various jobs of proteolytic enzymes in skeletal muscle during unloading: Facts and speculations. J. Biomed. Biotechnol. 2012, 2012, 493618. [Google Scholar] [CrossRef] [PubMed]
- Hanson, A.M.; Harrison, B.C.; Young, M.H.; Stodieck, L.S.; Ferguson, V.L. Longitudinal characterization of functional, morphologic, and biochemical adaptations in mouse skeletal muscle with hindlimb suspension. Muscle Nerve 2013, 48, 393–402. [Google Scholar] [CrossRef] [PubMed]
- Shenkman, B.S.; Belova, S.P.; Lomonosova, Y.N.; Kostrominova, T.Y.; Nemirovskaya, T.L. Calpain-dependent regulation of the skeletal muscle atrophy following unloading. Arch. Biochem. Biophys. 2015, 584, 36–41. [Google Scholar] [CrossRef]
- Hornberger, T.A.; Hunter, R.B.; Kandarian, S.C.; Esser, K.A. Regulation of translation factors during hindlimb unloading and denervation of skeletal muscle in rats. Am. J. Physiol. Cell Physiol. 2001, 281, C179–C187. [Google Scholar] [CrossRef]
- Belova, S.P.; Mochalova, E.P.; Kostrominova, T.Y.; Shenkman, B.S.; Nemirovskaya, T.L. P38alpha-MAPK Signaling Inhibition Attenuates Soleus Atrophy during Early Stages of Muscle Unloading. Int. J. Mol. Sci. 2020, 21, 2756. [Google Scholar] [CrossRef]
- Bodine, S.C.; Baehr, L.M. Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E469–E484. [Google Scholar] [CrossRef] [PubMed]
- Glass, D.J. Signaling pathways perturbing muscle mass. Curr. Opin. Clin. Nutr. Metab. Care 2010, 13, 225–229. [Google Scholar] [CrossRef]
- Giger, J.M.; Bodell, P.W.; Zeng, M.; Baldwin, K.M.; Haddad, F. Rapid muscle atrophy response to unloading: Pretranslational processes involving MHC and actin. J. Appl. Physiol. 2009, 107, 1204–1212. [Google Scholar] [CrossRef]
- Cohen, S.; Brault, J.J.; Gygi, S.P.; Glass, D.J.; Valenzuela, D.M.; Gartner, C.; Latres, E.; Goldberg, A.L. During muscle atrophy, thick, but not thin, filament components are degraded by MuRF1-dependent ubiquitylation. J. Cell Biol. 2009, 185, 1083–1095. [Google Scholar] [CrossRef]
- Fareed, M.U.; Evenson, A.R.; Wei, W.; Menconi, M.; Poylin, V.; Petkova, V.; Pignol, B.; Hasselgren, P.O. Treatment of rats with calpain inhibitors prevents sepsis-induced muscle proteolysis independent of atrogin-1/MAFbx and MuRF1 expression. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 290, R1589–R1597. [Google Scholar] [CrossRef]
- Redpath, N.T.; Foulstone, E.J.; Proud, C.G. Regulation of translation elongation factor-2 by insulin via a rapamycin-sensitive signalling pathway. Embo J. 1996, 15, 2291–2297. [Google Scholar] [CrossRef] [PubMed]
- Du Bois, P.; Pablo Tortola, C.; Lodka, D.; Kny, M.; Schmidt, F.; Song, K.; Schmidt, S.; Bassel-Duby, R.; Olson, E.N.; Fielitz, J. Angiotensin II Induces Skeletal Muscle Atrophy by Activating TFEB-Mediated MuRF1 Expression. Circ. Res. 2015, 117, 424–436. [Google Scholar] [CrossRef] [PubMed]
- Beharry, A.W.; Sandesara, P.B.; Roberts, B.M.; Ferreira, L.F.; Senf, S.M.; Judge, A.R. HDAC1 activates FoxO and is both sufficient and required for skeletal muscle atrophy. J. Cell Sci. 2014, 127, 1441–1453. [Google Scholar] [CrossRef] [PubMed]
- Moresi, V.; Williams, A.H.; Meadows, E.; Flynn, J.M.; Potthoff, M.J.; McAnally, J.; Shelton, J.M.; Backs, J.; Klein, W.H.; Richardson, J.A.; et al. Myogenin and class II HDACs control neurogenic muscle atrophy by inducing E3 ubiquitin ligases. Cell 2010, 143, 35–45. [Google Scholar] [CrossRef]
- Bricceno, K.V.; Sampognaro, P.J.; Van Meerbeke, J.P.; Sumner, C.J.; Fischbeck, K.H.; Burnett, B.G. Histone deacetylase inhibition suppresses myogenin-dependent atrogene activation in spinal muscular atrophy mice. Hum. Mol. Genet. 2012, 21, 4448–4459. [Google Scholar] [CrossRef]
- Furlow, J.D.; Watson, M.L.; Waddell, D.S.; Neff, E.S.; Baehr, L.M.; Ross, A.P.; Bodine, S.C. Altered gene expression patterns in muscle ring finger 1 null mice during denervation- and dexamethasone-induced muscle atrophy. Physiol. Genom. 2013, 45, 1168–1185. [Google Scholar] [CrossRef]
- Yoshihara, T.; Machida, S.; Kurosaka, Y.; Kakigi, R.; Sugiura, T.; Naito, H. Immobilization induces nuclear accumulation of HDAC4 in rat skeletal muscle. J. Physiol. Sci. 2016, 66, 337–343. [Google Scholar] [CrossRef]
- Sandri, M.; Sandri, C.; Gilbert, A.; Skurk, C.; Calabria, E.; Picard, A.; Walsh, K.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117, 399–412. [Google Scholar] [CrossRef]
- Clavel, S.; Siffroi-Fernandez, S.; Coldefy, A.S.; Boulukos, K.; Pisani, D.F.; Derijard, B. Regulation of the intracellular localization of Foxo3a by stress-activated protein kinase signaling pathways in skeletal muscle cells. Mol. Cell Biol. 2010, 30, 470–480. [Google Scholar] [CrossRef]
- Mihaylova, M.M.; Vasquez, D.S.; Ravnskjaer, K.; Denechaud, P.D.; Yu, R.T.; Alvarez, J.G.; Downes, M.; Evans, R.M.; Montminy, M.; Shaw, R.J. Class IIa histone deacetylases are hormone-activated regulators of FOXO and mammalian glucose homeostasis. Cell 2011, 145, 607–621. [Google Scholar] [CrossRef]
- Kuo, M.H.; Allis, C.D. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 1998, 20, 615–626. [Google Scholar] [CrossRef]
- Miska, E.A.; Karlsson, C.; Langley, E.; Nielsen, S.J.; Pines, J.; Kouzarides, T. HDAC4 deacetylase associates with and represses the MEF2 transcription factor. Embo J. 1999, 18, 5099–5107. [Google Scholar] [CrossRef] [PubMed]
- McKinsey, T.A.; Zhang, C.L.; Lu, J.; Olson, E.N. Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature 2000, 408, 106–111. [Google Scholar] [CrossRef] [PubMed]
- Bertaggia, E.; Coletto, L.; Sandri, M. Posttranslational modifications control FoxO3 activity during denervation. Am. J. Physiol. Cell Physiol. 2012, 302, C587–C596. [Google Scholar] [CrossRef] [PubMed]
- Senf, S.M.; Sandesara, P.B.; Reed, S.A.; Judge, A.R. p300 Acetyltransferase activity differentially regulates the localization and activity of the FOXO homologues in skeletal muscle. Am. J. Physiol. Cell Physiol. 2011, 300, C1490–C1501. [Google Scholar] [CrossRef] [PubMed]
- Grundy, D. Principles and standards for reporting animal experiments in The Journal of Physiology and Experimental Physiology. Exp. Physiol. 2015, 100, 755–758. [Google Scholar] [CrossRef] [PubMed]
- Trazzi, S.; Fuchs, C.; Viggiano, R.; De Franceschi, M.; Valli, E.; Jedynak, P.; Hansen, F.K.; Perini, G.; Rimondini, R.; Kurz, T.; et al. HDAC4: A key factor underlying brain developmental alterations in CDKL5 disorder. Hum. Mol. Genet. 2016, 25, 3887–3907. [Google Scholar] [CrossRef]
- Marek, L.; Hamacher, A.; Hansen, F.K.; Kuna, K.; Gohlke, H.; Kassack, M.U.; Kurz, T. Histone deacetylase (HDAC) inhibitors with a novel connecting unit linker region reveal a selectivity profile for HDAC4 and HDAC5 with improved activity against chemoresistant cancer cells. J. Med. Chem. 2013, 56, 427–436. [Google Scholar] [CrossRef]
- Isaacs, J.T.; Antony, L.; Dalrymple, S.L.; Brennen, W.N.; Gerber, S.; Hammers, H.; Wissing, M.; Kachhap, S.; Luo, J.; Xing, L.; et al. Tasquinimod Is an Allosteric Modulator of HDAC4 survival signaling within the compromised cancer microenvironment. Cancer Res. 2013, 73, 1386–1399. [Google Scholar] [CrossRef]
- Morey-Holton, E.; Globus, R.K.; Kaplansky, A.; Durnova, G. The hindlimb unloading rat model: Literature overview, technique update and comparison with space flight data. Adv. Space Biol. Med. 2005, 10, 7–40. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
β-actin | 5′- TCATGAAGTGTGACGTTGACATCC -3′ | 5′- GTAAAACGCAGCTCAGTAACAGTC -3′ |
Calpain-1 | 5′- CATGGCTAAGAGCAGGAAGG -3′ | 5′- CGAAGTCTGCAGGTCTAGGG -3′ |
eEF2k | 5′- AGAAGCTGGTGACAGGCAGT -3′ | 5′- GGGTTCTTGTCCAGTCCAAA -3′ |
GAPDH | 5′- ACGGCAAGTTCAACGGCACAGTCAA -3′ | 5′- GCTTTCCAGAGGGGCCATCCACA -3′ |
HDAC 4 | 5′- CTACAACCACCCTGTCTTGG -3′ | 5′-ATGCGGAGTCTGTAACATCC-3′ |
MAFbx | 5′- CTACGATGTTGCAGCCAAGA -3′ | 5′- GGCAGTCGAGAAGTCCAGTC -3′ |
MuRF1 | 5′- GCCAATTTGGTGCTTTTTGT -3′ | 5′- AAATTCAGTCCTCTCCCCGT -3′ |
MYOG | 5′- ACTCCCTTACGTCCATCGTG -3′ | 5′- CAGGACAGCCCCACTTAAAA -3′ |
Ubiquitin | 5′- CACCAAGAAGGTCAAACAGGA -3′ | 5′- GCAAGAACTTTATTCAAAGTGCAA -3′ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mochalova, E.P.; Belova, S.P.; Kostrominova, T.Y.; Shenkman, B.S.; Nemirovskaya, T.L. Differences in the Role of HDACs 4 and 5 in the Modulation of Processes Regulating MAFbx and MuRF1 Expression during Muscle Unloading. Int. J. Mol. Sci. 2020, 21, 4815. https://doi.org/10.3390/ijms21134815
Mochalova EP, Belova SP, Kostrominova TY, Shenkman BS, Nemirovskaya TL. Differences in the Role of HDACs 4 and 5 in the Modulation of Processes Regulating MAFbx and MuRF1 Expression during Muscle Unloading. International Journal of Molecular Sciences. 2020; 21(13):4815. https://doi.org/10.3390/ijms21134815
Chicago/Turabian StyleMochalova, Ekaterina P., Svetlana P. Belova, Tatiana Y. Kostrominova, Boris S. Shenkman, and Tatiana L. Nemirovskaya. 2020. "Differences in the Role of HDACs 4 and 5 in the Modulation of Processes Regulating MAFbx and MuRF1 Expression during Muscle Unloading" International Journal of Molecular Sciences 21, no. 13: 4815. https://doi.org/10.3390/ijms21134815
APA StyleMochalova, E. P., Belova, S. P., Kostrominova, T. Y., Shenkman, B. S., & Nemirovskaya, T. L. (2020). Differences in the Role of HDACs 4 and 5 in the Modulation of Processes Regulating MAFbx and MuRF1 Expression during Muscle Unloading. International Journal of Molecular Sciences, 21(13), 4815. https://doi.org/10.3390/ijms21134815