Characterization and High-Level Periplasmic Expression of Thermostable α-Carbonic Anhydrase from Thermosulfurimonas Dismutans in Escherichia Coli for CO2 Capture and Utilization
Abstract
1. Introduction
2. Results and Discussion
2.1. Comparative Analysis of Bacterial Thermostable α-CA Sequences
2.2. Expression and Purification of Recombinant CAs
2.3. Activity and Stability Comparison of Recombinant CAs
2.4. Engineering of tdCA for High-Level Expression
2.5. Ultra-Efficient Whole-Cell Biocatalysts Based on tdCA
3. Materials and Methods
3.1. General Culture Conditions, Bacterial Strains, and Plasmids Construction
3.2. Expression of Recombinant CA Enzymes
3.3. Purification of Recombinant CA Enzymes.
3.4. Protein Quantification
3.5. SDS-PAGE and Western Blot
3.6. CO2 Hydration Assay
3.7. Thermostability Test
3.8. Whole-cell Activity
3.9. In Silico Calculations
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Supuran, C.T.; Capasso, C. An overview of the bacterial carbonic anhydrases. Metabolites 2017, 56. [Google Scholar] [CrossRef]
- Luca, V.D.; Vullo, D.; Scozzafava, A.; Carginale, V.; Rossi, M.; Supuran, C.T.; Capasso, C. An α-carbonic anhydrase from the thermophilic bacterium Sulphurihydrogenibium azorense is the fastest enzyme known for the CO2 hydration reaction. Bioorg. Med. Chem. 2013, 21, 1465–1469. [Google Scholar] [CrossRef]
- Bond, G.M.; Stringer, J.; Brandvold, D.K.; Simsek, F.A.; Medina, M.G.; Egeland, G. Development of integrated system for biomimetic CO2 sequestration using the enzyme carbonic anhydrase. Energy Fuels 2001, 15, 309–316. [Google Scholar] [CrossRef]
- Power, I.M.; Harrison, A.L.; Dipple, G.M. Accelerating mineral carbonation using carbonic anhydrase. Environ. Sci. Technol. 2016, 50, 2610–2618. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.G.; Jo, B.H.; Kang, D.G.; Kim, C.S.; Choi, Y.S.; Cha, H.J. Biomineralization-based conversion of carbon dioxide to calcium carbonate using recombinant carbonic anhydrase. Chemosphere 2012, 87, 1091–1096. [Google Scholar] [CrossRef] [PubMed]
- Srikanth, S.; Alvarez-Gallego, Y.; Vanbroekhoven, K.; Pant, D. Enzymatic electrosynthesis of formic acid through carbon dioxide reduction in a bioelectrochemical system: effect of immobilization and carbonic anhydrase addition. Chemphyschem 2017, 18, 3174–3181. [Google Scholar] [CrossRef]
- Chang, K.S.; Jeon, H.; Gu, M.B.; Pack, S.P.; Jin, E. Conversion of carbon dioxide to oxaloacetate using integrated carbonic anhydrase and phosphoenolpyruvate carboxylase. Bioprocess Biosyst. Eng. 2013, 36, 1923–1928. [Google Scholar] [CrossRef]
- Hong, S.G.; Jeon, H.; Kim, H.S.; Jun, S.H.; Jin, E.; Kim, J. One-pot enzymatic conversion of carbon dioxide and utilization for improved microbial growth. Environ. Sci. Technol. 2015, 49, 4466–4472. [Google Scholar] [CrossRef]
- Jo, B.H.; Seo, J.H.; Cha, H.J. Bacterial extremo-α-carbonic anhydrases from deep-sea hydrothermal vents as potential biocatalysts for CO2 sequestration. J. Mol. Catal. B: Enzym. 2014, 109, 31–39. [Google Scholar] [CrossRef]
- Kanth, B.K.; Jun, S.-Y.; Kumari, S.; Pack, S.P. Highly thermostable carbonic anhydrase from Persephonella marina EX-H1: its expression and characterization for CO2-sequestration applications. Process Biochem. 2014, 49, 2114–2121. [Google Scholar] [CrossRef]
- Capasso, C.; De Luca, V.; Carginale, V.; Cannio, R.; Rossi, M. Biochemical properties of a novel and highly thermostable bacterial α-carbonic anhydrase from Sulfurihydrogenibium yellowstonense YO3AOP1. J. Enzyme Inhib. Med. Chem. 2012, 27, 892–897. [Google Scholar] [CrossRef] [PubMed]
- Jo, B.H.; Im, S.-K.; Cha, H.J. Halotolerant carbonic anhydrase with unusual N-terminal extension from marine Hydrogenovibrio marinus as novel biocatalyst for carbon sequestration under high-salt environments. J. CO2 Util. 2018, 26, 415–424. [Google Scholar] [CrossRef]
- Faridi, S.; Satyanarayana, T. Novel alkalistable α-carbonic anhydrase from the polyextremophilic bacterium Bacillus halodurans: characteristics and applicability in flue gas CO2 sequestration. Environ. Sci. Pollut. Res. Int. 2016, 23, 15236–15249. [Google Scholar] [CrossRef] [PubMed]
- Ki, M.-R.; Nguyen, T.K.M.; Kim, S.H.; Kwon, I.; Pack, S.P. Chimeric protein of internally duplicated α-type carbonic anhydrase from Dunaliella species for improved expression and CO2 sequestration. Process Biochem. 2016, 51, 1222–1229. [Google Scholar] [CrossRef]
- Jun, S.Y.; Kim, S.H.; Kanth, B.K.; Lee, J.; Pack, S.P. Expression and characterization of a codon-optimized alkaline-stable carbonic anhydrase from Aliivibrio salmonicida for CO2 sequestration applications. Bioprocess Biosyst. Eng. 2017, 40, 413–421. [Google Scholar] [CrossRef]
- Martensson, L.G.; Karlsson, M.; Carlsson, U. Dramatic stabilization of the native state of human carbonic anhydrase II by an engineered disulfide bond. Biochemistry 2002, 41, 15867–15875. [Google Scholar] [CrossRef]
- Jo, B.H.; Park, T.Y.; Park, H.J.; Yeon, Y.J.; Yoo, Y.J.; Cha, H.J. Engineering de novo disulfide bond in bacterial α-type carbonic anhydrase for thermostable carbon sequestration. Sci. Rep. 2016, 6, 29322. [Google Scholar] [CrossRef]
- Warden, A.C.; Williams, M.; Peat, T.S.; Seabrook, S.A.; Newman, J.; Dojchinov, G.; Haritos, V.S. Rational engineering of a mesohalophilic carbonic anhydrase to an extreme halotolerant biocatalyst. Nat. Commun. 2015. [Google Scholar] [CrossRef]
- Parra-Cruz, R.; Jager, C.M.; Lau, P.L.; Gomes, R.L.; Pordea, A. Rational design of thermostable carbonic anhydrase mutants using molecular dynamics simulations. J. Phys. Chem. B 2018, 122, 8526–8536. [Google Scholar] [CrossRef]
- Parra-Cruz, R.; Lau, P.L.; Loh, H.-S.; Pordea, A. Engineering of Thermovibrio ammonificans carbonic anhydrase mutants with increased thermostability. J. CO2 Util. 2020, 37, 1–8. [Google Scholar] [CrossRef]
- Alvizo, O.; Nguyen, L.J.; Savile, C.K.; Bresson, J.A.; Lakhapatri, S.L.; Solis, E.O.; Fox, R.J.; Broering, J.M.; Benoit, M.R.; Zimmerman, S.A.; et al. Directed evolution of an ultrastable carbonic anhydrase for highly efficient carbon capture from flue gas. Proc. Natl. Acad. Sci. USA 2014, 111, 16436–16441. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.K.M.; Ki, M.R.; Son, R.G.; Pack, S.P. The NT11, a novel fusion tag for enhancing protein expression in Escherichia coli. Appl. Microbiol. Biotechnol. 2019, 103, 2205–2216. [Google Scholar] [CrossRef] [PubMed]
- Minic, Z.; Thongbam, P.D. The biological deep sea hydrothermal vent as a model to study carbon dioxide capturing enzymes. Mar. Drugs 2011, 9, 719–738. [Google Scholar] [CrossRef] [PubMed]
- Slobodkin, A.I.; Reysenbach, A.L.; Slobodkina, G.B.; Baslerov, R.V.; Kostrikina, N.A.; Wagner, I.D.; Bonch-Osmolovskaya, E.A. Thermosulfurimonas dismutans gen. nov., sp. nov., an extremely thermophilic sulfur-disproportionating bacterium from a deep-sea hydrothermal vent. Int. J. Syst. Evol. Microbiol. 2012, 62, 2565–2571. [Google Scholar] [CrossRef] [PubMed]
- Vetriani, C.; Speck, M.D.; Ellor, S.V.; Lutz, R.A.; Starovoytov, V. Thermovibrio ammonificans sp. nov., a thermophilic, chemolithotrophic, nitrate-ammonifying bacterium from deep-sea hydrothermal vents. Int. J. Syst. Evol. Microbiol. 2004, 54, 175–181. [Google Scholar] [CrossRef] [PubMed]
- James, P.; Isupov, M.N.; Sayer, C.; Saneei, V.; Berg, S.; Lioliou, M.; Kotlar, H.K.; Littlechild, J.A. The structure of a tetrameric α-carbonic anhydrase from Thermovibrio ammonificans reveals a core formed around intermolecular disulfides that contribute to its thermostability. Acta Crystallogr. D Biol. Crystallogr. 2014, 70, 2607–2618. [Google Scholar] [CrossRef]
- Puskas, L.G.; Inui, M.; Zahn, K.; Yukawa, H. A periplasmic, α-type carbonic anhydrase from Rhodopseudomonas palustris is essential for bicarbonate uptake. Microbiol. 2000, 146, 2957–2966. [Google Scholar] [CrossRef]
- Gai, C.S.; Lu, J.; Brigham, C.J.; Bernardi, A.C.; Sinskey, A.J. Insights into bacterial CO2 metabolism revealed by the characterization of four carbonic anhydrases in Ralstonia eutropha H16. Amb Express 2014. [Google Scholar] [CrossRef]
- Smith, K.S.; Ferry, J.G. Prokaryotic carbonic anhydrases. FEMS Microbiol. Rev. 2000, 24, 335–366. [Google Scholar] [CrossRef]
- Chan, P.; Curtis, R.A.; Warwicker, J. Soluble expression of proteins correlates with a lack of positively-charged surface. Sci. Rep. 2013. [Google Scholar] [CrossRef]
- Kazlauskas, R. Engineering more stable proteins. Chem. Soc. Rev. 2018, 47, 9026–9045. [Google Scholar] [CrossRef] [PubMed]
- Soysal, C.; Soylemez, Z. Kinetics and inactivation of carrot peroxidase by heat treatment. J. Food Eng. 2005, 68, 349–356. [Google Scholar] [CrossRef]
- Jo, B.H.; Moon, H.; Cha, H.J. Engineering the genetic components of a whole-cell catalyst for improved enzymatic CO2 capture and utilization. Biotechnol. Bioeng. 2019. [Google Scholar] [CrossRef]
- Baumgarten, T.; Ytterberg, A.J.; Zubarev, R.A.; de Gier, J.W. Optimizing recombinant protein production in the Escherichia coli periplasm alleviates stress. Appl. Environ. Microbiol. 2018. [Google Scholar] [CrossRef]
- Urban, A.; Neukirchen, S.; Jaeger, K.E. A rapid and efficient method for site-directed mutagenesis using one-step overlap extension PCR. Nucleic Acids Res. 1997, 25, 2227–2228. [Google Scholar] [CrossRef]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar]
- Wilbur, K.M.; Anderson, N.G. Electrometric and colorimetric determination of carbonic anhydrase. J. Biol. Chem. 1948, 176, 147–154. [Google Scholar]
- Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [Google Scholar] [CrossRef]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera–a visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef]
- Almagro Armenteros, J.J.; Tsirigos, K.D.; Sonderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]






| Strains, Plasmids, or Primers | Genotypes, Relevant Characteristics, or Sequences | Source or References |
|---|---|---|
| Strains | ||
| E. coli TOP10 | F− mcrA Δ(mrr-hsdRMS-mcrBC) Ф80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL(Strr) endA1 nupG | Thermo Fisher Scientific |
| E. coli BL21(DE3) | F− ompT hsdSB(rB− mB−) gal dcm lon λ(DE3), carrying T7 RNA polymerase gene | Novagen |
| Plasmids | ||
| pET-22b(+) | T7lac promoter, pBR322 ori, Ampr, parental expression vector | Novagen |
| pET-taCA | pET-22b(+) carrying taCA gene | [9] |
| pET-tdCA | pET-22b(+) carrying tdCA gene | This study |
| pET-tdCA-S82Y | pET-22b(+) carrying tdCAS82Y gene | This study |
| pET-PelB-ss::tdCA | pET-22b(+) carrying SPPelB::tdCA gene | This study |
| pET-PelB-ss::tdCA-S82Y | pET-22b(+) carrying SPPelB::tdCAS82Y gene | This study |
| pET-PelB-ss::Nhis_tdCA-S82Y | pET-22b(+) carrying SPPelB::His6-tdCAS82Y gene | This study |
| pRBS2PelB-ss::hmCA | pET-22b(+) carrying periplasmic hmCA gene and a mutant RBS | [33] |
| Primers 1 | ||
| tdCA-S82Ymut | Forward: TAACTTTCACTACCGTGACCAAATCTATGGCGAGATTGTGAACAACG | This study |
| Reverse: CGTTGTTCACAATCTCGCCATAGATTTGGTCACGGTAGTGAAAGTTA | ||
| sec-tdCA | Forward: CCATGGGTGGCGGTCA | This study |
| Reverse: CTCGAGTTTCAGAATCTTACGCGCG | ||
| sec-Nhis_tdCA | Forward: CCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGTGGCGGTCACGT | This study |
| Reverse: CTCGAGTTATTTCAGAATCTTACGCGCG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jo, B.H.; Hwang, I.S. Characterization and High-Level Periplasmic Expression of Thermostable α-Carbonic Anhydrase from Thermosulfurimonas Dismutans in Escherichia Coli for CO2 Capture and Utilization. Int. J. Mol. Sci. 2020, 21, 103. https://doi.org/10.3390/ijms21010103
Jo BH, Hwang IS. Characterization and High-Level Periplasmic Expression of Thermostable α-Carbonic Anhydrase from Thermosulfurimonas Dismutans in Escherichia Coli for CO2 Capture and Utilization. International Journal of Molecular Sciences. 2020; 21(1):103. https://doi.org/10.3390/ijms21010103
Chicago/Turabian StyleJo, Byung Hoon, and In Seong Hwang. 2020. "Characterization and High-Level Periplasmic Expression of Thermostable α-Carbonic Anhydrase from Thermosulfurimonas Dismutans in Escherichia Coli for CO2 Capture and Utilization" International Journal of Molecular Sciences 21, no. 1: 103. https://doi.org/10.3390/ijms21010103
APA StyleJo, B. H., & Hwang, I. S. (2020). Characterization and High-Level Periplasmic Expression of Thermostable α-Carbonic Anhydrase from Thermosulfurimonas Dismutans in Escherichia Coli for CO2 Capture and Utilization. International Journal of Molecular Sciences, 21(1), 103. https://doi.org/10.3390/ijms21010103

