Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea)
Abstract
:1. Introduction
2. Results
2.1. Sequence and Phylogenetic Analysis of Large Yellow Croaker elovl6
2.2. Tissue Distribution of Large Yellow Croaker elovl6
2.3. Transcriptional Expression of elovl6 in Response to Dietary Fatty Acids
2.4. Relative elovl6 Expression in Hepatocytes of Large Yellow Croaker in Response to Fatty Acids
2.5. Regulation of the elovl6 by Transcription Factors
2.6. Transcriptional Expression of hnf1α, cebpβ, rxrα, and creb1 in Response to Fatty Acids
3. Discussion
4. Materials and Methods
4.1. Animal Studies
4.2. RNA Extraction and cDNA Synthesis
4.3. Cloning, Sequence, and Phylogenetic Analysis of Elovl6
4.4. Relative mRNA Quantification
4.5. Cloning of elovl6 Promoters from Large Yellow Croaker
4.6. Construction of Transcription Factor Plasmids, Cell Culturing, Transfection, and Luciferase Assay
4.7. Primary Hepatocyte Isolation and Culture
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AA | amino acid |
ALA | α-linolenic acid |
CEBPβ | CCAAT-enhancer-binding protein β |
ChREB | carbohydrate response element binding protein |
CREB1 | cAMP response element-binding protein 1 |
Elovl | Elongation of very long chain fatty acids protein |
Elovl6 | Elongation of very long chain fatty acids protein 6 |
FA | fatty acid |
Fads | fatty acid desaturases |
FO | fish oil |
HNF1α | hepatocyte nuclear factor 1α |
HXXHH | histidine box |
SO | soybean oil |
LA | linoleic acid |
LCFAs | Long chain fatty acids |
LXRα | liver X receptor α |
RXRα | retinoid X receptor α |
ORF | open reading frame |
PO | palm oil |
PPARγ | peroxisome proliferator-activated receptor γ |
qPCR | Quantitative real-time PCR |
SP1 | transcriptional factor SP1 |
SREBP | sterol regulatory element binding protein |
LO | linseed oil |
PA | palmitic acid |
References
- Sprecher, H. Metabolism of highly unsaturated n-3 and n-6 fatty acids. Biochim. Biophys. Acta 2000, 1486, 219–231. [Google Scholar] [CrossRef]
- Chen, J.; Cui, Y.; Yan, J.; Jiang, J.; Cao, X.; Gao, J. Molecular characterization of elongase of very long-chain fatty acids 6 (elovl6) genes in Misgurnus anguillicaudatus and their potential roles in adaptation to cold temperature. Gene 2018, 666, 134–144. [Google Scholar] [CrossRef]
- Shi, H.B.; Wu, M.; Zhu, J.J.; Zhang, C.H.; Yao, D.W.; Luo, J.; Loor, J.J. Fatty acid elongase 6 plays a role in the synthesis of long-chain fatty acids in goat mammary epithelial cells. J. Dairy Sci. 2017, 100, 4987–4995. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.C.; Feng, Y.H.; Wu, H.T.; Huang, Y.S.; Tung, C.L.; Wu, P.; Chang, C.J.; Shiau, A.L.; Wu, C.L. Elovl6 is a negative clinical predictor for liver cancer and knockdown of Elovl6 reduces murine liver cancer progression. Sci. Rep. 2018, 8, 6586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moon, Y.; Shah, N.; Mohapatra, S.; Warrington, J.; Horton, J. Identification of a mammalian long chain fatty acyl elongase regulated by sterol regulatory element-binding proteins. J. Biol. Chem. 2001, 276, 45358–45366. [Google Scholar] [CrossRef]
- Takashi, M.; Hitoshi, S.; Naoya, Y.; Tomohiro, Y.; Michiyo, A.K.; Hasty, A.H.; Hiroaki, O.; Yoshiaki, T.; Yoko, I.; Ken, O. Cloning and characterization of a mammalian fatty acyl-CoA elongase as a lipogenic enzyme regulated by SREBPs. J. Lipid Res. 2002, 43, 911–920. [Google Scholar]
- Bae, J.S.; Oh, A.R.; Lee, H.J.; Ahn, Y.H.; Cha, J.Y. Hepatic Elovl6 gene expression is regulated by the synergistic action of ChREBP and SREBP-1c. Biochem. Biophys. Res. Commun. 2016, 478, 1060–1066. [Google Scholar] [CrossRef]
- Saito, R.; Matsuzaka, T.; Karasawa, T.; Sekiya, M.; Okada, N.; Igarashi, M.; Matsumori, R.; Ishii, K.; Nakagawa, Y.; Iwasaki, H. Macrophage Elovl6 deficiency ameliorates foam cell formation and reduces atherosclerosis in low-density lipoprotein receptor-deficient mice. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 1973–1979. [Google Scholar] [CrossRef]
- Matsuzaka, T.; Shimano, H.; Yahagi, N.; Kato, T.; Atsumi, A.; Yamamoto, T.; Inoue, N.; Ishikawa, M.; Okada, S.; Ishigaki, N. Crucial role of a long-chain fatty acid elongase, Elovl6, in obesity-induced insulin resistance. Nat. Med. 2007, 13, 1193–1202. [Google Scholar] [CrossRef]
- Takashi, M.; Ayaka, A.; Rie, M.; Tang, N.; Haruna, S.; Noriko, S.K.; Motoko, K.; Yoshimi, N.; Kiyoaki, I.; Masako, S. Elovl6 promotes nonalcoholic steatohepatitis. Hepatology 2012, 56, 2199–2208. [Google Scholar] [Green Version]
- Tan, C.Y.; Virtue, S.; Bidault, G.; Dale, M.; Hagen, R.; Griffin, J.; Vidal-Puig, A. Brown Adipose Tissue Thermogenic Capacity Is Regulated by Elovl6. Cell Rep. 2015, 13, 2039–2047. [Google Scholar] [CrossRef] [Green Version]
- Motoko, K.; Takashi, M.; Rie, M.; Ryo, S.; Naoko, K.; Hikari, T.; Kei, I.; Naduki, O.; Takuya, K.; Hiroshi, O. Absence of Elovl6 attenuates steatohepatitis but promotes gallstone formation in a lithogenic diet-fed Ldlr(-/-) mouse model. Sci. Rep. 2015, 5, 17604. [Google Scholar]
- Green, C.D.; Ozguden-Akkoc, C.G.; Yun, W.; Jump, D.B.; L Karl, O. Role of fatty acid elongases in determination of de novo synthesized monounsaturated fatty acid species. J. Lipid Res. 2010, 51, 1871–1877. [Google Scholar] [CrossRef]
- Leroux, C.; Bernard, L.; Faulconnier, Y.; Rouel, J.; Anne, D.L.F.; Domagalski, J.; Chilliard, Y. In Bovine mammary nutrigenomics and changes in the milk composition due to rapeseed or sunflower oil supplementation of high-forage or high-concentrate diets. Lifestyle Genomics 2016, 9, 65–82. [Google Scholar] [CrossRef]
- Ducheix, S.; Lobaccaro, J.M.A.; Martin, P.G.; Guillou, H. Liver X Receptor: An oxysterol sensor and a major player in the control of lipogenesis. Chem. Phys. Lipids 2011, 164, 500–514. [Google Scholar] [CrossRef]
- Zuo, R.; Ai, Q.; Mai, K.; Wei, X.; Wang, J.; Xu, H.; Liufu, Z.; Zhang, Y. Effects of dietary docosahexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of para. Aquaculture 2012, 334–337, 101–109. [Google Scholar] [CrossRef]
- Rantao, Z.; Qinghui, A.; Kangsen, M.; Wei, X. Effects of conjugated linoleic acid on growth, non-specific immunity, antioxidant capacity, lipid deposition and related gene expression in juvenile large yellow croaker (Larmichthys crocea) fed soyabean oil-based diets. Br. J. Nutr. 2013, 110, 1220–1232. [Google Scholar]
- Li, Q.; Ai, Q.; Mai, K.; Xu, W.; Zheng, Y. A comparative study: Invitro effects of EPA and DHA on immune functions of head-kidney macrophages isolated from large yellow croaker (Larmichthys crocea). Fish Shellfish Immunol. 2013, 35, 933–940. [Google Scholar] [CrossRef]
- Kai, L.; Jing, Y.; Kangsen, M.; Qinghui, A. Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in Large Yellow Croakers. J. Nutr. 2015, 145, 2479–2485. [Google Scholar] [Green Version]
- Zhang, W.; Sun, Z. Random local neighbor joining: A new method for reconstructing phylogenetic trees. Mol. Phylogenet. Evol. 2008, 47, 117–128. [Google Scholar] [CrossRef]
- Matsuzaka, T.; Shimano, H. Elovl6: A new player in fatty acid metabolism and insulin sensitivity. J. Mol. Med. 2017, 87, 379–384. [Google Scholar] [CrossRef]
- Cook, H.W.; McMaster, C.R. Fatty acid desaturation and chain elongation in eukaryotes. In New Comprehensive Biochemistry; Elsevier: Amsterdam, The Netherlands, 2002; Volume 36, pp. 181–204. [Google Scholar]
- Castro, L.F.; Tocher, D.R.; Monroig, O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef] [Green Version]
- Nayak, M.; Pradhan, A.; Giri, S.S.; Samanta, M.; Badireenath, V.K.; Saha, A. Molecular characterization, tissue distribution and differential nutritional regulation of putative Elovl5 elongase in silver barb (Puntius gonionotus). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2018, 217, 27–39. [Google Scholar] [CrossRef]
- Tocher, D.R. In Biochemical and molecular studies of the fatty acid desaturation pathway in fish. In Proceedings of the Big Fish Bang-Proceedings of the Larval Fish Conference, Solstrand Fjord Hotel, Os, Norway, 22–26 July 2002. [Google Scholar]
- Tocher, D.R. Metabolism and Functions of Lipids and Fatty Acids in Teleost Fish. Rev. Fish. Sci. 2003, 11, 107–184. [Google Scholar] [CrossRef] [Green Version]
- Maher, K.A.; Bajic, M.; Kajala, K.; Reynoso, M.; Pauluzzi, G.; West, D.; Zumstein, K.; Woodhouse, M.; Bubb, K.L.; Dorrity, M.W. Profiling of accessible chromatin regions across multiple plant species and cell types reveals common gene regulatory principles and new control modules. Plant Cell 2017, 30, 15–36. [Google Scholar] [CrossRef]
- Shin, K.; Takashi, M.; Toyonori, K.; Naoya, Y.; Takashi, Y.; Sumiyo, O.; Kazuto, K.; Akimitsu, T.; Shigeru, Y.; Hiroaki, S. Mouse Elovl-6 promoter is an SREBP target. Biochem. Biophys. Res. Commun. 2008, 368, 261–266. [Google Scholar]
- Sun, H.; Jiang, T.; Wang, S.; He, B.; Zhang, Y.; Piao, D.; Yu, C.; Wu, N.; Han, P. The effect of LXRα, ChREBP and Elovl6 in liver and white adipose tissue on medium- and long-chain fatty acid diet-induced insulin resistance. Diabetes Res. Clin. Pract. 2013, 102, 183–192. [Google Scholar] [CrossRef]
- Chen, S.; He, H.; Liu, X. Tissue expression profiles and transcriptional regulation of elongase of very long chain fatty acid 6 in bovine mammary epithelial cells. PLoS ONE 2017, 12, e0175777. [Google Scholar] [CrossRef]
- Li, S.; Mai, K.; Wei, X.; Yuan, Y.; Zhang, Y.; Zhou, H.; Ai, Q. Effects of dietary lipid level on growth, fatty acid composition, digestive enzymes and expression of some lipid metabolism related genes of orange-spotted grouper larvae (Epinephelus coioides H.). Aquac. Res. 2016, 47, 2481–2495. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Li, S.; Yuan, Y.; Wang, T.; Xu, W.; Li, M.; Mai, K.; Ai, Q. Molecular Cloning, Functional Characterization and Nutritional Regulation of the Putative Elongase Elovl5 in the Orange-Spotted Grouper (Epinephelus coioides). PLoS ONE 2016, 11, e0150544. [Google Scholar] [CrossRef]
- Li, S.; Monroig, Ó.; Wang, T.; Yuan, Y.; Navarro, J.C.; Hontoria, F.; Liao, K.; Tocher, D.R.; Mai, K.; Xu, W. Functional characterization and differential nutritional regulation of putative Elovl5 and Elovl4 elongases in large yellow croaker (Larimichthys crocea). Sci. Rep. 2017, 7, 2303. [Google Scholar] [CrossRef]
Primer | Sequences5′-3′ | Primer Information |
---|---|---|
ORF-F | ATGTCGGTGCTGGCTCTGCAAG | elovl6-ORF |
ORF-R | TTACTCGCTCTTCTTGGTGACAGCC | elovl6-ORF |
3′-Race-outer | GCCTACTTCGGCAAGTCCAAATCATCGG | elovl6-3′-Race |
3′-Race-inner | CCATGAACTACTTGGTCCACGCCGTCATG | elovl6-3′-Race |
5′-Race-outer | CGAATTCGTACTCTTGCAGAGCCAGCACCG | elovl6-5′-Race |
5′-Race-inner | CTGACAGGCCCGTTGTAAAAGCTCTGGTCAC | elovl6-5′-Race |
Elovl6-F | AGGGCTTAAACAGTCAGTTTGTGA | elovl6 q-PCR |
Elovl6-R | GAGTAGAGCAGCACGGTGATGTG | elovl6 q-PCR |
β-actin-F | CTACGAGGGTTATGCCCTGCC | β-actin q-PCR |
β-actin-R | TGAAGGAGTAACCGCGCTCTGT | β-actin q-PCR |
RXRα-F | GAGGGACATGCAGATGGATAAGACA | RXRα q-PCR |
RXRα-R | GAAGAAGAACAAGTGCTCCAGACACT | RXRα q-PCR |
HNF1α-F | AACACGGGGTGAAATACAGC | HNF1α q-PCR |
HNF1α-R | GACCAATGAGAAGCGAGGAC | HNF1α q-PCR |
CEBPβ-F | GCCCATACCCAAACCCTGAAC | CEBPβ q-PCR |
CEBPβ-R | GCACTGTCCTTGCTGATGCTCC | CEBPβ q-PCR |
CREB1-F | TCGACTGTTGCTGAGAGCG | CREB1 q-PCR |
CREB1-R | GCTGCTGGTCTGATAGATGGG | CREB1 q-PCR |
E6-P-F | CATCATCAGACCAGACTGCACAACC | Elovl6 promoter |
E6-P-R | GCTCTCTTCTTTCCGTTCACACGC | Elovl6 promoter |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Pang, Y.; Xiang, X.; Du, J.; Mai, K.; Ai, Q. Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea). Int. J. Mol. Sci. 2019, 20, 1801. https://doi.org/10.3390/ijms20071801
Li Y, Pang Y, Xiang X, Du J, Mai K, Ai Q. Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea). International Journal of Molecular Sciences. 2019; 20(7):1801. https://doi.org/10.3390/ijms20071801
Chicago/Turabian StyleLi, Yongnan, Yuning Pang, Xiaojun Xiang, Jianlong Du, Kangsen Mai, and Qinghui Ai. 2019. "Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea)" International Journal of Molecular Sciences 20, no. 7: 1801. https://doi.org/10.3390/ijms20071801
APA StyleLi, Y., Pang, Y., Xiang, X., Du, J., Mai, K., & Ai, Q. (2019). Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea). International Journal of Molecular Sciences, 20(7), 1801. https://doi.org/10.3390/ijms20071801