Next Article in Journal
IMM-H004 Protects against Cerebral Ischemia Injury and Cardiopulmonary Complications via CKLF1 Mediated Inflammation Pathway in Adult and Aged Rats
Next Article in Special Issue
Genetic Variation for Seed Metabolite Levels in Brachypodium distachyon
Previous Article in Journal
Fritillariae Thunbergii Bulbus: Traditional Uses, Phytochemistry, Pharmacodynamics, Pharmacokinetics and Toxicity
Previous Article in Special Issue
Chemical Variability of the Essential Oil of Origanum ehrenbergii Boiss. from Lebanon, Assessed by Independent Component Analysis (ICA) and Common Component and Specific Weight Analysis (CCSWA)
Article

A New Subclade of Leptosphaeria biglobosa Identified from Brassica rapa

1
Department of Plant Science, University of Manitoba, 66 Dafoe Road, Winnipeg, MB R3T 2N2, Canada
2
Department of Plant Pathology, Washington State University Mount Vernon NWREC, Mount Vernon, WA 98273-4768, USA
3
School of BioSciences, University of Melbourne, Parkville 3010, Victoria, Australia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2019, 20(7), 1668; https://doi.org/10.3390/ijms20071668
Received: 16 February 2019 / Revised: 23 March 2019 / Accepted: 27 March 2019 / Published: 3 April 2019
(This article belongs to the Collection Feature Papers in Molecular Plant Sciences)

Abstract

Blackleg (Phoma stem canker) of crucifers is a globally important disease caused by the ascomycete species complex comprising of Leptosphaeria maculans and Leptosphaeria biglobosa. Six blackleg isolates recovered from Brassica rapa cv. Mizspoona in the Willamette Valley of Oregon were characterized as L. biglobosa based on standard pathogenicity tests and molecular phylogenetic analysis. These isolates were compared to 88 characterized L. biglobosa isolates from western Canada, 22 isolates from Australia, and 6 L. maculans isolates from Idaho, USA using maximum parsimony and distance analysis of phylogenetic trees generated from the ITS rDNA (internal transcribed spacer rDNA) sequence, and the actin and β-tubulin gene sequences. The L. biglobosa isolates derived from B. rapa collected in Oregon formed a separate subclade based on concatenated gene sequences or a single gene sequence, regardless of the analyses. Pathogenicity tests showed that these isolates failed to infect either resistant or susceptible B. napus cultivars, but caused severe symptoms on three B. rapa cultivars (Accession number: UM1113, UM1112, and UM1161), a B. oleracea var. capitata (cabbage) cultivar (Copenhagen Market), and two B. juncea cultivars (CBM, a common brown Mustard, and Forge). These findings demonstrated that the L. biglobosa isolates derived from a B. rapa crop in Oregon were genetically distinct from existing species of L. biglobosa, and constitute a new subclade, herein proposed as L. biglobosa ‘americensis’.
Keywords: Leptosphaeria maculans; Leptosphaeria biglobosa; Brassica napus; Brassica rapa; Brassica juncea; Brassica oleracea; subclades; brassicae; canadensis; thlaspii; erysimii; australensis; occiaustralensis; ITS rDNA; actin; β-tubulin Leptosphaeria maculans; Leptosphaeria biglobosa; Brassica napus; Brassica rapa; Brassica juncea; Brassica oleracea; subclades; brassicae; canadensis; thlaspii; erysimii; australensis; occiaustralensis; ITS rDNA; actin; β-tubulin

1. Introduction

Leptosphaeria maculans and L. biglobosa are two closely related fungal species that together form a species complex that causes blackleg or Phoma stem canker of crucifers, including Brassica napus, B. juncea, B. oleracea, and B. rapa [1,2]. L. maculans and L. biglobosa were previously described as virulent and weakly-virulent, respectively, with genetic differences and distinct phenotypic (disease) expression on oilseed rape (B. napus) leaves or stems [2]. During infection of B. napus, L. maculans produces large grey/green leaf lesions, and then grows down the vascular tissue to the stem, where the fungus causes necrotic stem cankers [2]. In contrast, L. biglobosa causes small, dark leaf lesions and typically is restricted to infection of the upper stem [3]. Consequently, L. maculans has been considered much more damaging than L. biglobosa.
L. biglobosa and L. maculans have been estimated to have diverged approximately 22 million years ago based on comparative genome sequencing analysis of 19 conserved proteins [4,5]. L. maculans has been categorized into two subclades: ‘Brassicae’ and ‘lepidii’; while L. biglobosa isolates have been categorized into six subclades: ‘Brassicae’, ‘canadensis’, ‘thlaspii’, ‘erysimii’, ‘australensis’, and ‘occiaustralensis’ [6,7]. L. biglobosa ‘brassicae’ is the most common of the L. biglobosa species and has been found in most oilseed rape growing regions [8]. Although isolates of L. biglobosa are often found in association with L. maculans, L. biglobosa ‘brassicae’ is the sole subspecies that has been identified in China to date [8]. L. biglobosa ‘canadensis’ has been isolated from both B. napus and B. juncea crops in both Canada and Australia, and is most closely related to L. biglobosa ‘brassicae’ [9,10]. The remaining four L. biglobosa subspecies are less common and have only been reported in specific situations: L. biglobosa ‘thlaspii’ was obtained from the cruciferous weed, Thlaspi arvense, in central Canada; L. biglobosa ‘erysimii’ was obtained from a weed of an Erysimum sp., also in Canada [6]; L. biglobosa ‘australensis’ has been isolated from B. napus and B. juncea in the United States of America and Australia [11,12]; and L. biglobosa ‘occiaustralensis’ has been isolated mainly from oilseed rape cultivars with resistance derived from B. rapa sp. sylvestris, and wild radish (Raphanus raphanistrum) in western Australia, Chile, and Georgia [7,9]. L. maculansL. biglobosa species complex had been separated into seven distinct groups using the sequence of the ITS region. In these studies, ITS rDNA, and actin and β-tubulin sequences have been widely used for the phylogeny analysis of the Leptosphaeria complex and new subclade identification. Parsimony and distance analyses separated these species with groups corresponding to specific host plants and geographic origin [6]. In 2008, Vincenot et al. identified a new subclade of L. biglobosa (L. biglobosa ‘occiaustralensis’) using ITS rDNA, actin, and β-tubulin sequences in western Australia [7]. The phylogeny of L. biglobosa isolates on the American continent has also been analyzed by using ITS rDNA, actin, and β-tubulin sequences [9]. In addition, other important host-pathogen systems, such as fusarium and wheat, where F. graminearum causes the fusarium head blight (FHB) disease, conserved gene sequences, i.e., ITS, histone H3, elongation factor 1-α, and β-tubulin, have been widely used to identify species of Fusarium [13,14]. More recently, 16 monophyletic species have been identified within the Fusarium graminearum species complex using a high-throughput multilocus assay of portions of housekeeping genes [15,16,17]. L. maculans has spread recently into many areas where only L. biglobosa was present, suggesting that L. biglobosa may have evolved earlier than L. maculans from a common ancestor [18].
In 2014, a vegetable seed grower in the Willamette Valley in Oregon, USA submitted samples from a certified organic seed crop of the B. rapa vegetable cv. Mizspoona. The plants had typical foliar and stem symptoms of blackleg. Six isolates of Leptosphaeria were recovered from the Brassica rapa seed crop, Mizspoona, and were characterized using standard pathogenicity tests and sequence analysis of the ITS rDNA and actin and β-tubulin genes to determine the species of these isolates.

2. Results

2.1. Pathogenicity Tests

Small, dark brown, necrotic lesions without pycnidia were observed on cotyledons of the B. napus differential cultivars or lines, including the universal susceptible cultivar, Westar, when inoculated with each of the six isolates (Phl002 (Phoma lingam002) to Phl007) of Leptosphaeria derived from a B. rapa vegetable seed crop in the Willamette Valley of Oregon (Figure 1). Conversely, all six isolates caused susceptible reactions on the B. juncea cultivars, Forge and CBM; and on the three B. rapa lines, UM1161, UM1113, and UM1112, by 11 dpi (Figure 1 and Table 1). Six additional isolates (Phl010 to Phl015) derived from B. napus infected plants collected from Idaho (Table S1) were all virulent on Westar, as expected, and showed avirulent or virulent reactions on a range of cultivars of B. napus differing in resistance genotypes. There were no disease symptoms or a hypersensitive reaction on the Brassica germplasm inoculated with water.
Since all the B. rapa-derived isolates were avirulent on all the B. napus cultivars and lines tested, but virulent on several B. juncea (CBM and Forge) and B. rapa (UM1113, UM1112, and UM1161) cultivars and lines, it was deemed necessary to assess whether these isolates were L. maculans or L. biglobosa. Therefore, the B. rapa-derived isolates from Oregon were subjected to a PCR (Polymerase chain reaction) assay of the ITS rDNA, and the amplified sequences used for species identification.

2.2. Characterization of B. rapa-Derived Isolates from the Willamette Valley of Oregon

PCR amplification of the six Oregon isolates of Leptosphaeria obtained from a B. rapa seed crop, using the PN3 and PN10 primers, illustrated that each of the isolates, Phl002 to Phl007, produced amplified DNA bands matching the size of the L. biglobosa DNA band (Figure 2). Evaluation of the mating type alleles indicated that none of the six isolates could be positively amplified and characterized to either of the two known mating types of L. maculans, i.e., the isolates could not be categorized as L. maculans, which supported their possible assignment to L. biglobosa based on the ITS rDNA size.
The ITS rDNA sequences and the actin and β-tubulin gene sequences were obtained from B. rapa-derived isolates, Phl002 to Phl007, and compared with sequences deposited in the NCBI (National Center for Biotechnology Information) database. The B. rapa-derived isolates (Phl002 to Phl007) had 99.00% or 99.01% ITS rDNA sequence similarities (deposited in Genbank: MG321243) to the ITS rDNA sequence from L. biglobosa ‘brassicae’ DQ133890, compared with only 95.59% to 96.01% for that of L. maculans JX648199. Similarly, the actin gene sequences (deposited in Genbank: MG282088) of the B. rapa-derived isolates showed 99.00% to 99.02% and 93.56% to 93.58% similarities to actin sequences of the L. biglobosa ‘brassicae’ group strain (AY748949) and L. maculans ‘brassicae’ group strain (AY748971), respectively. In addition, the B. rapa-derived isolates had 99.00% to 99.02% β-tubulin gene (deposited in Genbank: MG282089) similarities to the L. biglobosa ‘canadensis’ group strain, AY749006 compared with only 92.45% or 92.46% for that of L. maculans ‘brassicae’ group strain AY749018, in the NCBI database (Table S3). In summary, the six B. rapa-derived isolates from Oregon were categorized as L. biglobosa through sequencing of the ITS rDNA and the actin and β-tubulin genes, and based on pathogenicity tests.

2.3. Identification of a New Subclade of L. biglobosa by Phylogenetic Analysis

All 88 isolates from western Canada were characterized as L. biglobosa ‘canadensis’, while 12 isolates from Australia had been characterized as L. biglobosa ‘canadensis’ and six as L. biglobosa ‘occiaustralensis’. Since 88 isolates from western Canada and 12 isolates from Australia were characterized as the same subspecies, L. biglobosa ‘canadensis’, 9 and 6 isolates were randomly selected from Canada and Australia, respectively, for phylogenetic analysis. Deposited sequences of ITS rDNA, actin, and β-tubulin in Genbank of L. biglobosa subspecies were extracted as references in the analysis (Table S1). The nucleotide identity between different subclades of L. biglobosa isolates of ITS rDNA sequences ranged from 91.33% to 99.64%. Only two nucleotide differences were detected between B. rapa derived isolate (i.e., an Oregon isolate) and L. biglobosa ‘brassicae’, and they shared the most sequence similarity (99.64%) among the subclades of L. biglobosa. A total of 9, 6, 18, 26, and 28 SNPs (single nucleotide polymorphism)/Indels were identified between the B. rapa derived isolate and L. biglobosa ‘canadensis’, ‘occiaustralensis’, ‘australensis’, ‘erysimii’, and ‘thlaspii’, respectively (Figure S1). The nucleotide identity of the actin gene sequences between different subclades of L. biglobosa isolates ranged from 94.34% to 99.13%. Similar with ITS rDNA, the actin sequence of B. rapa derived isolate showed the highest identity with L. biglobosa ‘brassicae’ with only three SNPs detected. In total, 9, 10, 14, 17, and 23 SNPs/Indels were filtered in the actin sequence of B. rapa derived isolate when compared to L. biglobosa ‘canadensis’, ‘occiaustralensis’, ‘australensis’, ‘erysimii’, and ‘thlaspii’, respectively (Figure S2). While the ITS rDNA and actin sequences were most similar with those of L. biglobosa ‘brassicae’, the β-tubulin gene sequences of B. rapa derived isolates showed the greatest identity with L. biglobosa ‘canadensis’ and contained four SNPs. The nucleotide acid identity of the β-tubulin gene sequences between different subclades of L. biglobosa isolates ranged from 92.77% to 98.72%. In addition, there were 13, 12, 17, 21, and 31 SNPs/Indels in β-tubulin between B. rapa derived isolate and L. biglobosa ‘brassicae’, ‘occiaustralensis’, ‘australensis’, ‘erysimii’, and ‘thlaspii’, respectively (Figure S3).
Alignment of the ITS rDNA sequences resulted in a dataset of 573 characters of which 43 (7.5%) were considered to be informative characters. The actin sequence alignment resulted in a dataset of 477 characters of which 43 (9.0%) were parsimony informative. The β-tubulin sequence alignment resulted in 501 characters of which 26 (2.6%) were parsimony informative. Finally, a set of data with concatenate sequences of these three conserved genes resulted in a dataset of 1551 characters of which 112 (7.2%) were parsimony informative for phylogenetic tree construction (CI (Consistency index) = 0.84, RI (Retention index) = 0.91). A total of six subclades contained all the L. biglobosa isolates by concatenated ITS rDNA, actin, and β-tubulin sequences, which were differentiated clearly from the two L. maculans subclades (Figure 3). As expected, the isolates, ICBN89 and IBCN91, grouped in the L. biglobosa ‘brassicae’ and L. biglobosa ‘australensis’ clades, respectively. The L. biglobosa ‘thlaspii’ isolates were differentiated from a strongly supported clade that included all other subclades, and was most closely aligned with the L. maculans subclades. L. biglobosa ‘australensis’ and L. biglobosa ‘erysimii’ isolates formed one branch based on the ITS rDNA sequence (Figure S4). The close phylogenetic relationship observed between L. biglobosa ‘canadensis’ and L. bilobosa ‘occiaustralensis’ was similar to that published by Vincenot et al. (2008) [7]. Interestingly, the six B. rapa-derived L. biglobosa isolates from Oregon formed a distinct subclade most closely related to L. biglobosa ‘brassicae’ isolates, and were clearly separated from the outgroup of L. maculans isolates (Figure 3). The distance and parsimony analyses on a concatenated set of three gene sequences resulted in threes of similar topology to those analyses on a single sequence of ITS rDNA or the actin gene (Figures S4 and S5). Phylogenetic trees constructed using the maximum likelihood, minimum evolution, and unweighted pair group method with arithmetic mean (UPGMA) were very similar to those obtained using the neighbour joining and parsimony analyses, and showed that the B. rapa-derived isolates, Phl002 to Phl007, clustered into a unique subclade distinct from other L. biglobosa isolates and from L. maculans isolates (data not shown).
The six B. rapa-derived isolates formed a distinct subclade using the β-tubulin gene sequences. While the ITS rDNA and actin sequences placed the B. rapa-derived isolates closest to the L. biglobosa ‘brassicae’ subclade, the β-tubulin gene sequences of the B. rapa-derived isolates showed the greatest identity with L. biglobosa ‘canadensis’ isolates (Figure S6). This probably reflected the greater level of sequence polymorphism detected in the β-tubulin sequences between B. rapa-derived isolates and L. biglobosa ‘brassicae’ isolates compared to those of the L. biglobosa ‘canadensis’ isolates (Figure S3). Since the B. rapa-derived isolates fell into a distinct clade, based on the conserved gene regions and concatenated sequences analyzed, a new subclade, L. biglobosa ‘americensis’, is proposed.

2.4. Differences in the Pathogenicity of Isolates of L. biglobosa ‘americensis’ and Other L. biglobosa Subspecies

To determine whether isolates of this proposed new subspecies, L. biglobosa ‘americensis’, have similar disease profiles to isolates of the other L. biglobosa species, pathogenicity tests were carried out with representative isolates from L. biglobosa ‘canadensis, L. biglobosa ‘brassicae’, and L. biglobosa ‘occiaustralensis’. Compared to the severity of cotyledon symptoms caused by isolates of the other subclades of L. biglobosa, the L. biglobosa ‘americensis’ isolates caused significantly larger lesions on cotyledons of the cultivar, Westar (Figure 4 and Figure 5a), although these lesions were still significantly smaller than the lesions caused by the L. maculans control isolate. Alternatively, on the cultivar, Jet Neuf, no significant differences in lesion size were detected among the subclades of the L. biglobosa isolates (Figure 4 and Figure 5a). In the pathogenicity test of the two B. juncea cultivars (CBM and Forge), lesion sizes on CBM inoculated with L. biglobosa ‘americensis’ isolates were all significantly larger than those on plants inoculated with the other L. biglobosa isolates, which were all rated in the susceptible or intermediate categories (Figure 5b). Most of the L. biglobosa ‘americensis’ isolates caused significantly larger lesions on Forge seedlings compared to lesions caused by isolates of L. biglobosa ‘canadensis’ and ‘occiaustralensis’, but not of ‘brassicae’ (Figure 5b and Figure S7). The lesion sizes were significantly larger on B. rapa (cultivar ‘Mizspoona’, where L. biglobosa ‘americensis’ isolates identified from) and B. oleracea plants inoculated with the L. biglobosa ‘americensis’ isolates than on plants inoculated with isolates of the other subclades of L. biglobosa (Figure 5c). These results suggest that the L. biglobosa ‘americensis’ isolates have a significantly different disease profile to the other L. biglobosa subspecies tested.

3. Discussion

This study describes isolates of a proposed new subclade of L. biglobosa obtained from a certified organic B. rapa vegetable seed crop of the cv., Mizspoona, grown in the Willamette Valley of Oregon, USA in 2013 to 2014 that had developed classic symptoms of blackleg. Pathogenicity and molecular characterization clearly identified these isolates as belonging to a distinct subclade compared to isolates of the six known subclades of this species. We propose naming the new subclade L. biglobosa ‘americensis’.
Relationships between members of the two Leptosphaeria species, L. maculans and L. biglobosa, based on three conserved DNA regions yielded fairly consistent phylogenetic trees and were extremely comparable to previously published studies [6,7,11]. For example, previous studies found that isolates of the subclade, L. biglobosa ‘occiaustralensis’, were most closely related to isolates of L. biglobosa ‘canadensis’, while isolates of L. biglobosa ‘australensis’ and ‘erysimii’ were closely related to each other [6,7]. Indeed, the topologies of these subclades are consistent with the data generated in this study. In addition, L. biglobosa ‘thlaspii’ isolates were most closely related to L. maculans isolates in the phylogenetic trees constructed previously and in this study. The distance and parsimony analyses on concatenated sequences or a single gene sequence with high bootstrap value supported that subclades including the six L. biglobosa isolates is indeed a new subspecies. L. biglobosa ‘canadensis’ was close to L. biglobosa ‘occiaustralensis’ through concatenated/single gene sequence analysis. The six B. rapa derived isolates formed an independent group and was mostly close to L. biglobosa ‘brassicae’ when using concatenated sequences of three conserved genes and consistent with those trees constructed by single sequence of ITS rDNA or actin. The inconsistent tree obtained by phylogeny analysis using the β-tubulin sequence, which showed the new six isolates as closer to L. biglobosa ‘canadensis’, reinforced that these six isolates cannot be categorized into either ‘brassicae’ or ‘canadensis’ and formed a distinct group. To eliminate the bias of the phylogenetic tree constructed by the single gene sequence, concatenated sequences of three conserved genes were applied for parsimony analyses, the result being that these six isolates formed a separate subclade that was closer to L. biglobosa ‘brassicae’. More genomic or transcription data will provide further insights on the characterization of the new subclade in the future for investigation of the difference between this new subclade and other subclades of L. biglobosa. Trees obtained through parsimony analyses were similar to those obtained by the NJ method, and sufficient bootstraps supported the hypothesis that the B. rapa-derived isolates formed a monophyletic clade. Phylogenic analysis using NJ, parsimony, maximum likelihood, and minimum evolution analyses resulted in trees of similar topologies, with greater bootstrap values for the NJ trees compared with the other trees. It remains unclear why the different subspecies of L. biglobosa are so distinct from one another. With the exception of L. biglobosa ‘brassicae’ and L. biglobosa ‘canadensis’, generally, few isolates have been cultured from each of the subspecies, making population surveys difficult. Therefore, limited information is known regarding gene flow across geographical regions.
Isolates of L. biglobosa, which can coexist on host plants with isolates of L. maculans, typically are associated with upper stem lesions on infected Brassica plants, and are considered weakly virulent or even avirulent. L. biglobosa isolates have only caused significant losses in areas with high summer temperatures, e.g., in Poland [19]. Vincenot et al. (2008) demonstrated that L. biglobosa ‘occiaustralensis’ isolates were more virulent than L. biglobosa ‘canadensis’ or ‘australensis’ isolates, and L. biglobosa ‘brassicae’ isolates produced large leaf lesions on B. napus plants [7]. The pathogenicity of L. biglobosa ‘americensis’ isolates on Brassica spp. in this study indicated that these isolates were intermediate in virulence on B. napus and caused more severe disease on B. juncea and B. rapa. Van de Wouw et al. (2008) reported that L. biglobosa ‘canadensis’ isolates induced similar size lesions on B. juncea cotyledons as L. maculans isolates [10]. In contrast, L. biglobosa ‘americensis’ isolates in this study caused significantly larger lesions than L. biglobosa ‘canadensis’ isolates on both resistant and susceptible lines of B. napus, and large lesions on B. juncea and B. rapa lines. These results were confirmed by the accumulation of lignified material observed in stained, infected cotyledons, with more diffuse and less lignified material in the cotyledons caused by L. biglobosa ‘americensis’ and L. maculans isolates than isolates of other subclades of L. biglobosa. It remains unclear why the different subspecies of L. biglobosa show different reactions on different Brassica species, however, it raises the question of whether effector genes are present in these L. biglobosa subspecies and whether they may play a role in the pathogenicity of the various Brassica species. The genome sequencing of a subset of L. biglobosa species has shown different suites of effector-like proteins, thus supporting this hypothesis, however, the functions of these effector-like proteins remain unknown in these subspecies [4].
In contrast to isolates of other L. biglobosa subclades, L. biglobosa ‘americensis’ isolates characterized in this study represent the first L. biglobosa subclade derived from B. rapa that caused severe symptoms on B. rapa, B. oleracea, and B. juncea cultivars. The evolution of Leptosphaeria isolates appears to be influenced by internal and external forces, including mutation, reproduction, gene flow, genetic drift, natural selection (e.g., temperature and geography) [20], and host specificity [21]. Unlike the well understood gene-for-gene relationship of R genes and corresponding avirulence genes in the B. napusL. maculans pathosystem [22], it remains unclear whether a gene-for-gene interaction exists among L. biglobosa isolates and Brassica species. The results of this study validated and enriched the known diversity of L. biglobosa isolates, and provide a resource not only to help determine whether the evolutionary process of L. biglobosa isolates is influenced by geographic location and host selection pressures, but also to underline the possible existence of plant defense responses among Brassica species and L. biglobosa isolates. As reflected by the more severe disease symptoms associated with the L. biglobosa ‘americensis’ isolates on cultivars of three Brassica spp. evaluated in this study compared to isolates of other subclades, further research is needed to investigate potential differences in resistance to L. biglobosa ‘americensis’ isolates vs. isolates of other subclades, and to find sources of resistance to isolates of the different subclades of L. biglobosa.

4. Materials and Methods

4.1. Isolate Collection

A total of 122 Leptosphaeria isolates (12 from the USA, 88 from western Canada, and 22 from Australia) were included in this study (Table S1). For the USA isolates, six were cultured from stems and roots of canola crop residues from northern Idaho (Phl010 to Phl015), and six were cultured from B. rapa stems of six plants of the cv., Mizspoona, sampled from a certified organic seed crop grown in the Willamette Valley, Oregon (Phl002 to Phl007) (Table S1). Of the 88 isolates from western Canada, 67 were sampled from infected stems or stubble sections of canola crops (B. napus) grown in 2010, 2011, 2012, 2013, or 2014. The remaining 21 isolates were sampled from the dockage of canola (B. napus) seeds. All Canadian and USA isolates were cultured by plating small pieces of surface-sterilized stubble, stem, or seed onto potato dextrose agar (PDA) medium amended with chloramphenicol (100 mg/L medium) (for USA isolates) or V8 agar amended with 0.35% streptomycin sulfate (for Canadian isolates) (Table S1). The individual isolates were then obtained by streaking pink cirrhi that developed from pycnidia on the infected tissues, followed by hyphal tip transfers from single colonies that germinated from the pycnidiospores separated on the agar surface. The isolates were then subjected to a second round of single-spore isolation. The 22 Australian isolates were collected from infected canola stems in field trials at the end of the 2006 and 2014 growing season. The stems were left to mature over the summer, and once pseduothecia (sexual fruiting bodies) formed the following year, ascospores were obtained as described previously [23]. In summary, to obtain single-spore cultures, individual ascospores were collected using a dissecting microscope with a sterilized needle. L. maculans ‘brassicae’ isolate (06LM) collected from Canada was used as a control isolate throughout this study, and is hereafter referred to as L. maculans. All isolates were maintained on V8 agar medium.

4.2. Initial Pathogenicity Testing of the Oregon B. rapa-Derived Leptosphaeria Isolates on Brassica Species

Pycnidiospore inoculum of each isolate of Leptosphaeria was harvested by flooding 8- to 11-day-old cultures of the appropriate single-spore isolate using distilled water (2 mL/plate). The concentration of spores was adjusted to 2 × 107 spores/mL for the cotyledon inoculation test. The seed of 10 B. napus differential cultivars or lines carrying different L. maculans related resistance genes, eight B. juncea cultivars or lines, and eight B. rapa cultivars or lines (Table S2) were each sown into 96-cell flats filled with Pro-Mix BX (Premier Tech, Rivière-du-Loup, QC, Canada) and placed in a growth chamber at 16 °C (night) and 21 °C (day) with a 16-h photoperiod/day. The cotyledons of each 7-day-old seedling were each punctured and inoculated with a 10 µL droplet of inoculum at each of two wound sites/cotyledon (four wound sites/seedling) as previously described [24]. As a negative control treatment, the cotyledons of seedlings of each cultivar of each Brassica species were punctured and inoculated with a droplet of water instead of a spore suspension. A rating scale of 0 to 9, based on lesion size, chlorosis or necrosis, and the presence of pycnidia, was used to evaluate the interaction phenotype 11 to 14 dpi as described by Zhang et al. (2016) [24]. For each isolate screened, an average score was calculated from the 24 inoculation sites (four wound sites/plant for each of six plants): A mean of 6.1 to 9.0 was considered a susceptible (S) reaction, 4.6 to 6.0 an intermediate (I) reaction, and ≤4.5 a resistant (R) reaction [24,25].

4.3. PCR Identification of Isolates

A mixture of hyphae, pycnidia, and pycnidiospores was collected from a V8 agar plate of each isolate of Leptosphaeria, and stored in 1.5 mL micro-centrifuge tubes at −20 °C before DNA extraction. DNA extraction was performed using the cetyl trimethylammonium bromide (CTAB) method described previously by Calderon et al. (2002) with some minor modifications [26].
To confirm the species of the B. rapa-derived isolates from Oregon and six isolates from B. napus infected tissues in Idaho, the ITS rDNA was amplified using ITS F (PN3) and ITS R (PN10) primers designed from the 18S rDNA and 28S rDNA of Saccharomyces cerivisiae, respectively (Table 2) [6]. This primer set generates a 555 to 560 bp fragment for L. maculans and a 580 to 588 bp fragment for L. biglobosa [6]. A multiplex PCR assay developed by Cozijnsen and Howlett (2003) was employed to characterize the mating type of those isolates [27]. Therefore, we were able to further clarify whether these isolates can be categorized as L. maculans or not. A 686 bp band was amplified from all MAT1-1 isolates, while a 443 bp band was amplified from all MAT1-2 isolates (Table 2) [27]. The annealing temperatures for primers used in this study are presented in Table 2.

4.4. Conserved Gene Sequencing and Sequence Alignment

For sequencing the ITS rDNA, actin gene, and β-tubulin gene of each of the 88 isolates from western Canada and 12 isolates from USA, PCR amplification was performed as described above. The ITS rDNA, actin, and β-tubulin PCR products were then sent to AGTC (Advanced Genetic Technologies Center, University of Kentucky, Lexington, KY) for sequencing in both directions. Of the total 122 isolates, determined and available ITS rDNA, actin gene, and β-tubulin gene sequences of 22 isolates from Australia were included as different subspecies of L. biglobosa. In addition, 28 previously published sequences of these conserved genes available in GenBank were also employed as references for the analysis (Table S1). For the conserved gene similarity analysis, an L. biglobosa (Table S3) DNA sequence similarity analysis was performed using the BLAST search tool [28].

4.5. Phylogenetic Analysis

Initially, sequence alignments were carried out on the ITS rDNA, actin, and β-tubulin sequences from the six B. rapa-derived isolates compared to ITS rDNA, actin, and β-tubulin sequences from L. biglobosa isolates recovered from different Brassica spp. (Table S1) using Clustal Omega [29] with default parameters (https://www.ebi.ac.uk/Tools/msa/clustalo/) and Genedoc [30]. Since the Canadian isolates were characterized to be L. biglobosa ‘canadensis’ and to eliminate the genetic bias of using gene sequences of the same isolates in the phylogenetic analysis, the sequences from the six Oregon isolates were compared to randomly selected and representative isolates of the L. biglobosa-L. maculans complex using ITS rDNA (31 determined sequences and 8 deposited sequences from Genbank), actin (24 determined sequences and 7 deposited sequences from Genebank), and β-tubulin (20 determined sequences and 6 deposited sequences from Genbank) (Table S1). Therefore, we were able to determine whether the six B. rapa-derived isolates formed a separate and consistent species clade compared to previously characterized L. biglobosa subspecies. Analyses of sequences and phylogenetic relationships were calculated using MEGA6 [31]. The phylogenetic tree was reconstructed using the neighbor-joining method by the Kimura two-parameter model, with bootstrap calculation using 1000 replications. Phylogenetic analyses were also conducted on the conserved gene sequences using maximum parsimony (MP) analysis with the subtree-pruning-regrafting algorithm and maximum likelihood (ML) with the Kimura two-parameter distance method using MEGA6 [31]. For each analysis, 1000 bootstrap resamplings were used to assess clade stability, and L. maculans isolates were designated as the outgroup in all rooted trees.

4.6. Pathogenicity of L. biglobosa Subclade Isolates on Brassica Species

The B. rapa-derived isolate Phl004, L. biglobosa ‘brassicae’ isolate LL1-PG1, L. biglobosa ‘canadensis’ isolate 06J37, and L. biglobosa ‘occiaustralensis’ isolate 14P207 were inoculated onto punctured cotyledons of seedlings of B. napus cultivars, Westar and Jet Neuf, seven days after seeding, as described above. In addition to the pathogenicity tests done on two B. napus cultivars (Westar and Jet Neuf), the severity of symptoms caused by isolates of each subclade of L. biglobosa was evaluated on two B. juncea cultivars, CBM and Forge, a B. rapa line (a turnip from the Willamette Valley), and the B. oleracea cabbage cultivar, Copenhagen Market. Cotyledons of seedlings inoculated with L. maculans isolate 06LM and with water served as positive and negative control treatments, respectively, for each of the Brassica species tested. Each isolate was inoculated onto the cotyledons of at least six plants, and the experiment was repeated two or more times. Lesion size was quantified 14 dpi using Assess 2.0 (American Phytopathological Society, St Paul, MN, USA) for each experiment, isolate, and Brassica cultivar interaction, as described above, and statistical analyses performed using SAS Version 9.4 for ANOVA and means comparison with Tukey’s HSD Studentized range test at p ≤ 0.05.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/20/7/1668/s1. Table S1. List and characteristics of Leptosphaeria isolates used in this study for phylogenetic and/or pathogenicity analyses. Table S2. Brassica species and cultivars/lines used to test the pathogenicity of B. rapa-derived isolates of Leptosphaeria biglobosa from the Willamette Valley of Oregon, USA. Table S3. Sequence similarity analysis of conserved DNA regions of Leptosphaeria isolates obtained from Brassica spp. Figure S1. Nucleotide sequence alignment of the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) for isolates of different subclades of Leptosphaeria biglobosa. The level of shading corresponds to the level of conservation of the residues. The asterisks represent the boundary of every 20 nucleotides. Sequence data of L. biglobosa ‘erysimii’ (isolate AJ550852) is from the NCBI database. L. maculans ‘lepidii’ (IBCN84) and L. maculans ‘brassicae’ were used as an outgroup. The Brassica rapa derived isolates from a certified organic vegetable seed crop in the Willamette Valley of Oregon were characterized and named as isolates of a new subclade, L. biglobosa ‘americensis’. Figure S2. Nucleotide sequence alignment of the actin region of DNA of isolates of different subclades of Leptosphaeria biglobosa. The level of shading corresponds to the level of conservation of the residues. The asterisks represent the boundary of every 20 nucleotides. Sequence data of L. biglobosa ‘erysimii’ (isolate AY748960), L. biglobosa ‘australensis’ (AY748952), L. biglobosa ‘brassicae’ (AY748949), and L. biglobosa ‘thlaspii’ (AY748961) are from the NCBI database. L. maculans ‘brassicae’ (Phl010) was used as an outgroup. The Brassica rapa derived isolates from a certified organic vegetable seed crop in the Willamette Valley of Oregon were characterized and named as isolates of a new subclade, L. biglobosa ‘americensis’. Figure S3. Nucleotide sequence alignment of the β-tubulin region of DNA for isolates of different subclades of Leptosphaeria biglobosa. The level of shading corresponds to the level of conservation of the residues. The asterisks represent the boundary of every 20 nucleotides. Sequence data of L. biglobosa ‘erysimii’ (isolate AY749008), L. biglobosa ‘australensis’ (AY749001), L. biglobosa ‘brassicae’ (AY748997), and L. biglobosa ‘thlaspii’ (AY749009) are from the NCBI database. L. maculans ‘brassicae’ (Phl010) was used as an outgroup. The Brassica. rapa derived isolates from a certified organic vegetable seed crop in the Willamette Valley of Oregon were characterized and named as isolates of a new subclade, L. biglobosa ‘americensis’. Figure S4. Phylogenetic analysis of the Leptosphaeria maculansL. biglobosa species complex based on neighbor-joining analysis of the sequence of the internal transcribed spacer (ITS) region of ribosomal DNA. The tree was similar to trees constructed by maximum parsimony (MP) or maximum likelihood (ML) analyses. Three L. maculans isolates with asterisks were included as outgroup control isolates. The reference sequences of L. biglobosa subspecies derived from the NCBI database are each noted with an asterisk and include isolates of L. biglobosa ‘canadensis’, L. biglobosa ‘occiaustralensis’, L. biglobosa ‘australensis’, L. biglobosa ‘brassicae’, L. biglobosa ‘thlaspii’, and L. biglobosa ‘erysimii’ as described in Table S1. Figure S5. Phylogenetic analysis of the Leptosphaeria maculansL. biglobosa species complex based on neighbor-joining analysis for the actin gene sequence. The tree was similar to trees constructed by the maximum parsimony (MP) or maximum likelihood (ML) methods. Two L. maculans isolates with asterisks were included as outgroup control isolates. The reference sequences of L. biglobosa subspecies derived from NCBI are each noted with an asterisk, including isolates of L. biglobosa ‘canadensis’, L. biglobosa ‘occiaustralensis’, L. biglobosa ‘australensis’, L. biglobosa ‘brassicae’, L. biglobosa ‘thlaspii’, and L. biglobosa ‘erysimii’ as described in Table S1. Figure S6. Phylogenetic analysis of the Leptosphaeria maculansL. biglobosa species complex based on the neighbor-joining analysis of the β-tubulin gene sequence. The tree was similar to trees constructed by maximum parsimony (MP) or maximum likelihood (ML) methods. Two L. maculans isolates with asterisks were included as outgroup control isolates. The reference sequences of L. biglobosa subspecies derived from NCBI are each noted with an asterisk, including isolates of L. biglobosa ‘canadensis’, L. biglobosa ‘occiaustralensis’, L. biglobosa ‘australensis’, L. biglobosa ‘brassicae’, L. biglobosa ‘thlaspii’, and L. biglobosa ‘erysimii’ as described in Table S1. Figure S7. Disease symptoms on cotyledons of Brassica rapa cv., Mizspoona (a); B. oleracea cabbage cv., Copenhagen Market (b); Brassica juncea cv., Forge (c); and B. juncea cv., common brown mustard (CBM) (d) 14 days’ post-inoculation with water, Leptosphaeria biglobosa (Lb) ‘americensis’ isolate Phl004, L. biglobosa (Lb) ‘brassicae’ isolate LL1-PG1, L. biglobosa (Lb) 06J37, L. biglobosa (Lb) ‘occiaustralensis’ isolate 14P207, and L. maculans isolate 06LM (left to right, respectively).

Author Contributions

Z.Z. and W.G.D.F. designed the experiments. Z.Z., X.Z., P.P. performed the experiments. L.J.d.T. and A.P.V.d.W. collected isolates and provides the isolates of other L. biglobosa subspecies, respectively. Z.Z., A.P.V.d.W. and W.G.D.F. analyzed and interpreted the data. Z.Z. and W.G.D.F. wrote and revised the manuscript.

Funding

This work was funded by the Natural Sciences and Engineering Research Council of Canada Discovery Program, and The Growing Forward 2 canola cluster funds awarded to W.G.D.F. through SaskCanola Agri-Science Project ASP program. The authors wish to thank Grains Research and Development Corporation for funding the Australian part of this study, and Washington State University and the Alfred Christianson Endowment for funding the Washington State component of the work.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Brun, H.; Levivier, S.; Eber, F.; Renard, M.; Chèvre, A.M. Electrophoretic analysis of natural populations of Leptosphaeria maculans directly from leaf lesions. Plant Pathol. 1997, 46, 147–154. [Google Scholar] [CrossRef]
  2. West, J.S.; Kharbanda, P.D.; Barbetti, M.J.; Fitt, B.D.L. Epidemiology and management of Leptosphaeria maculans (Phoma stem canker) on oilseed rape in Australia, Canada and Europe. Plant Pathol. 2001, 50, 10–27. [Google Scholar] [CrossRef]
  3. Fitt, B.D.L.; Brun, H.; Barbetti, M.J.; Rimmer, S.R. World-wide importance of Phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus). Eur. J. Plant Pathol. 2006, 114, 3–15. [Google Scholar] [CrossRef]
  4. Ghanbarnia, K.; Fudal, I.; Larkan, N.J.; Links, M.G.; Balesdent, M.H.; Profotova, B.; Fernando, W.G.D.; Borhan, M.H. Rapid identification of the Leptosphaeria maculans avirulence gene AvrLm2 using an intraspecific comparative genomics approach. Mol. Plant Pathol. 2015, 16, 699–709. [Google Scholar] [CrossRef] [PubMed]
  5. Lowe, R.G.; Cassin, A.; Grandaubert, J.; Clark, B.L.; Van de Wouw, A.P.; Rouxel, T.; Howlett, B.J. Genomes and transcriptomes of partners in plant-fungal-interactions between canola (Brassica napus) and two Leptosphaeria species. PLoS ONE 2014, 9, e103098. [Google Scholar] [CrossRef]
  6. Mendes-Pereira, E.; Balesdent, M.H.; Hortense, B.; Rouxel, T. Molecular phylogeny of the Leptosphaeria maculans–L. biglobosa species complex. Mycol. Res. 2003, 107, 1287–1304. [Google Scholar] [CrossRef]
  7. Vincenot, L.; Balesdent, M.H.; Li, H.; Barbetti, M.J.; Sivasithamparam, K.; Gout, L.; Rouxel, T. Occurrence of a new subclade of Leptosphaeria biglobosa in Western Australia. Phytopathology 2008, 98, 321–329. [Google Scholar] [CrossRef] [PubMed]
  8. Liu, Z.; Latunde-Dada, A.O.; Hall, A.M.; Fitt, B.D.L. Phoma stem canker disease on oilseed rape (Brassica napus) in China is caused by Leptosphaeria biglobosa ‘brassicae’. Eur. J. Plant Pathol. 2014, 140, 841–857. [Google Scholar] [CrossRef]
  9. Dilmaghani, A.; Balesdent, M.H.; Didier, J.P.; Wu, C.; Davey, J.; Barbetti, M.J.; Li, H.; Moreno-Rico, O.; Phillips, D.; Despeghel, J.P.; et al. The Leptosphaeria maculansLeptosphaeria biglobosa species complex in the American continent. Plant Pathol. 2009, 58, 1044–1058. [Google Scholar] [CrossRef]
  10. Van de Wouw, A.P.; Thomas, V.L.; Cozijnsen, A.J.; Marcroft, S.J.; Salisbury, P.A.; Howlett, B.J. Identification of Leptosphaeria biglobosa ‘canadensis’ on Brassica juncea stubble from northern New South Wales, Australia. Australas. Plant Dis. Notes 2008, 3, 124–128. [Google Scholar] [CrossRef]
  11. Voigt, K.; Cozijnsen, A.J.; Kroymann, J.; Pöggeler, S.; Howlett, B.J. Phylogenetic relationships between members of the crucifer pathogenic Leptosphaeria maculans species complex as shown by mating type (MAT1-2), actin, and β-tubulin sequences. Mol. Phylogenetics Evol. 2005, 37, 541–557. [Google Scholar] [CrossRef] [PubMed]
  12. Plummer, K.M.; Dunse, K.; Howlett, B.J. Non-aggressive strains of the blackleg fungus, Leptosphaeria maculans, are present in Australia and can be distinguished from aggressive strains by molecular analysis. Aust. J. Bot. 1994, 42, 1–8. [Google Scholar] [CrossRef]
  13. O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Kistler, H.C.; Aoki, T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef]
  14. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Wiley-Blackwell: Ames, IA, USA, 2006; pp. 81–96. [Google Scholar]
  15. Gale, L.R.; Harrison, S.A.; Ward, T.J.; O’Donnell, K.; Milus, E.A.; Gale, S.W.; Kistler, H.C. Nivalenol-type populations of Fusarium graminearum and F. asiaticum are prevalent on wheat in Southern Louisiana. Phytopathology 2011, 101, 124–134. [Google Scholar] [CrossRef]
  16. Sarver, B.A.; Ward, T.J.; Gale, L.R.; Broz, K.; Kistler, H.C.; Aoki, T.; Nicholson, P.; Carter, J.; O’Donnell, K. Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical concordance. Fungal Genet. Biol. 2011, 48, 1096–1107. [Google Scholar] [CrossRef]
  17. Wang, J.; Ndoye, M.; Zhang, J.; Li, H.; Liao, Y. Population structure and genetic diversity of Fusarium graminearum species complex. Toxin 2011, 3, 1020–1037. [Google Scholar] [CrossRef] [PubMed]
  18. Rouxel, T.; Balesdent, M.H. The stem canker (blackleg) fungus, Leptosphaeria maculans, enters the genomic era. Mol. Plant Pathol. 2005, 6, 225–241. [Google Scholar] [CrossRef] [PubMed]
  19. Huang, Y.J.; Fitt, B.D.L.; Jedryczka, M.; Dakowska, S.; West, J.S.; Gladders, P.; Steed, J.M.; Li, Z. Patterns of ascospore release in relation to Phoma stem canker epidemiology in England (Leptosphaeria maculans) and Poland (Leptosphaeria biglobosa). Eur. J. Plant Pathol. 2005, 111, 263–277. [Google Scholar] [CrossRef]
  20. El Hadrami, A.; Fernando, W.G.D.; Daayf, F. Variations in relative humidity modulate Leptosphaeria spp. pathogenicity and interfere with canola mechanisms of defence. Eur. J. Plant Pathol. 2010, 126, 187–202. [Google Scholar] [CrossRef]
  21. Rouxel, T.; Grandaubert, J.; Hane, J.K.; Hoede, C.; Van de Wouw, A.P.; Couloux, A.; Dominguez, V.; Anthouard, V.; Bally, P.; Bourras, S.; et al. Effector diversification within compartments of the Leptosphaeria maculans genome affected by repeat-induced point mutations. Nat. Commun. 2011, 2, 202. [Google Scholar] [CrossRef]
  22. Balesdent, M.; Barbetti, M.; Li, H.; Sivasithamparam, K.; Gout, L.; Rouxel, T. Analysis of Leptosphaeria maculans race structure in a worldwide collection of isolates. Phytopathology 2005, 95, 1061–1071. [Google Scholar] [CrossRef]
  23. Van de Wouw, A.P.; Elliott, V.L.; Ware, A.; Lindbeck, K.; Howlett, B.J.; Marcroft, S.J. Infection of canola pods by Leptosphaeria maculans and subsequent seed contamination. Eur. J. Plant Pathol. 2016, 145, 687–695. [Google Scholar] [CrossRef]
  24. Zhang, X.; Peng, G.; Kutcher, H.R.; Balesdent, M.H.; Delourme, R.; Fernando, W.G.D. Breakdown of Rlm3 resistance in the Brassica napus–Leptosphaeria maculans pathosystem in western Canada. Eur. J. Plant Pathol. 2016, 1–16. [Google Scholar] [CrossRef]
  25. Williams, P.H.; Delwiche, P.A. Screening for resistance to blackleg of crucifers in the seedling stage. In Eucarpia Conf. Breed. Cruciferous Crops 1979; Foundation for Agricultural Plant Breeding: Wageningen, The Netherlands, 1980; pp. 164–170. [Google Scholar]
  26. Calderon, C.; Ward, E.; Freeman, J.; Foster, S.J.; McCartney, H.A. Detection of airborne inoculum of Leptosphaeria maculans and Pyrenopeziza brassicae in oilseed rape crops by polymerase chain reaction (PCR) assays. Plant Pathol. 2002, 51, 303–310. [Google Scholar] [CrossRef]
  27. Cozijnsen, A.J.; Howlett, B.J. Characterisation of the mating-type locus of the plant pathogenic ascomycete Leptosphaeria maculans. Curr. Genet. 2003, 43, 351–357. [Google Scholar] [CrossRef] [PubMed]
  28. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic. Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [PubMed]
  29. Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef]
  30. Nicholas, K.B.; Nicholas, H.B.J.; Deerfield, D.W. GeneDoc: Analysis and visualization of genetic variation. Embnew 1997, 4, 14. [Google Scholar]
  31. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
Figure 1. Disease symptoms expressed 14 days’ post-inoculation (dpi) of cotyledons of Brassica napus differential cultivars/lines 02-22-2-1, Westar, 1065, 1135, 01-23-2-1, Goéland, Glacier, Quinta, Surpass 400, and Jet Neuf; two B. juncea lines, a common brown mustard (CBM) and Forge; and one B. rapa line, UM1161 (see Table S2 for details of cultivars/lines), with isolate Phl004 of Leptosphaeria biglobosa obtained from the Willamette Valley of Oregon (see Table S1 for details of isolates). Seedlings of the B. napus cv., Westar, inoculated with water were used for the negative treatment. Small, dark brown, necrotic lesions without pycnidia were observed on cotyledons of the B. napus differential cultivars/lines.
Figure 1. Disease symptoms expressed 14 days’ post-inoculation (dpi) of cotyledons of Brassica napus differential cultivars/lines 02-22-2-1, Westar, 1065, 1135, 01-23-2-1, Goéland, Glacier, Quinta, Surpass 400, and Jet Neuf; two B. juncea lines, a common brown mustard (CBM) and Forge; and one B. rapa line, UM1161 (see Table S2 for details of cultivars/lines), with isolate Phl004 of Leptosphaeria biglobosa obtained from the Willamette Valley of Oregon (see Table S1 for details of isolates). Seedlings of the B. napus cv., Westar, inoculated with water were used for the negative treatment. Small, dark brown, necrotic lesions without pycnidia were observed on cotyledons of the B. napus differential cultivars/lines.
Ijms 20 01668 g001
Figure 2. PCR identification of a Leptosphaeria complex with the primers, PN3 and PN10, using genomic DNA of isolates Phl002 to Phl007 obtained from an organic vegetable Brassica rapa seed crop of the cv., Mizspoona, grown in the Willamette Valley of Oregon. Lb. and Lm. were reference isolates for the 555 to 560 bp and 580 to 585 bp amplified bands of L. biglobosa and L. maculans isolates, respectively. M, 100 bp DNA ladder.
Figure 2. PCR identification of a Leptosphaeria complex with the primers, PN3 and PN10, using genomic DNA of isolates Phl002 to Phl007 obtained from an organic vegetable Brassica rapa seed crop of the cv., Mizspoona, grown in the Willamette Valley of Oregon. Lb. and Lm. were reference isolates for the 555 to 560 bp and 580 to 585 bp amplified bands of L. biglobosa and L. maculans isolates, respectively. M, 100 bp DNA ladder.
Ijms 20 01668 g002
Figure 3. Phylogenetic analysis of the Leptosphaeria maculansL. biglobosa species complex based on maximum parsimony analysis of the concatenated sequences of the internal transcribed spacer (ITS) region of ribosomal DNA, actin, and β-tubulin (one of two parsimony trees). Bootstrap values (1000 replications) are indicated as a percentage above the node. The length of the tree is 449 steps (CI = 0.84, RI = 0.91). The tree was similar to trees constructed by neighbor-joining (NJ) or maximum likelihood (ML) analyses. Three L. maculans isolates were included as outgroup control isolates.
Figure 3. Phylogenetic analysis of the Leptosphaeria maculansL. biglobosa species complex based on maximum parsimony analysis of the concatenated sequences of the internal transcribed spacer (ITS) region of ribosomal DNA, actin, and β-tubulin (one of two parsimony trees). Bootstrap values (1000 replications) are indicated as a percentage above the node. The length of the tree is 449 steps (CI = 0.84, RI = 0.91). The tree was similar to trees constructed by neighbor-joining (NJ) or maximum likelihood (ML) analyses. Three L. maculans isolates were included as outgroup control isolates.
Ijms 20 01668 g003
Figure 4. Disease symptoms on cotyledons of Brassica napus cvs Westar (a) and Jet Neuf (b) 14 days’ post inoculation (dpi) with isolates of L. maculans (06LM), Leptosphaeria biglobosa ‘americensis’ (isolate Phl004), L. biglobosa ‘brassicae’ (LL1-PG1), L. biglobosa ‘canadensis’ (06J37), L. biglobosa ‘occiaustralensis’ (14P207), and water. (c) Disease symptoms on cotyledons of Brassica juncea cultivar. Common brown mustard (CBM), B. juncea cv. Forge, and B. rapa line UM1161 14 dpi with L. biglobosa ‘americensis’ (Phl004).
Figure 4. Disease symptoms on cotyledons of Brassica napus cvs Westar (a) and Jet Neuf (b) 14 days’ post inoculation (dpi) with isolates of L. maculans (06LM), Leptosphaeria biglobosa ‘americensis’ (isolate Phl004), L. biglobosa ‘brassicae’ (LL1-PG1), L. biglobosa ‘canadensis’ (06J37), L. biglobosa ‘occiaustralensis’ (14P207), and water. (c) Disease symptoms on cotyledons of Brassica juncea cultivar. Common brown mustard (CBM), B. juncea cv. Forge, and B. rapa line UM1161 14 dpi with L. biglobosa ‘americensis’ (Phl004).
Ijms 20 01668 g004
Figure 5. Pathogenicity assessment of 14 Leptosphaeria isolates belonging to four subclades of L. biglobosa and one isolate of L. maculans as a control treatment: L. biglobosa ‘americensis’ isolates (Phl002 to Phl007); L. biglobosa ‘canadensis’ isolates (06J37, 06J154, 06J167); L. biglobosa ‘occiaustralensis’ isolates (14P207, 14P205, 14P206); L. biglobosa ‘brassicae’ isolate (LL1-PG1); and L. maculans isolate (06LM). Each isolate was inoculated onto seedlings of each of two Brassica napus cvs, Westar and Jet Neuf (a); two B. juncea cvs., Forge and common brown mustard (CBM) (b); B. rapa turnip cv., Mizspoona, from the Willamette Valley of Oregon; and B. oleracea cabbage cv., Copenhagen Market (c). The lesion sizes were quantified 14 days’ post-inoculation (dpi) using Assess 2.0 (American Phytopathological Society, St Paul, MN) for each test, isolate, and Brassica cultivar as described in the main text, and statistical analyses performed using SAS Version 9.4 (SAS Institute, Inc., Cary, NC) for analysis of variance (ANOVA) and means comparison with Tukey’s Honestly Significant Difference Studentized range test at p ≤ 0.05. Each bar represents the mean and standard deviation of the lesion size for a particular Brassica species. Different letters (from ‘a’ to ‘f’) over the bars indicate the significant differences (p < 0.05).
Figure 5. Pathogenicity assessment of 14 Leptosphaeria isolates belonging to four subclades of L. biglobosa and one isolate of L. maculans as a control treatment: L. biglobosa ‘americensis’ isolates (Phl002 to Phl007); L. biglobosa ‘canadensis’ isolates (06J37, 06J154, 06J167); L. biglobosa ‘occiaustralensis’ isolates (14P207, 14P205, 14P206); L. biglobosa ‘brassicae’ isolate (LL1-PG1); and L. maculans isolate (06LM). Each isolate was inoculated onto seedlings of each of two Brassica napus cvs, Westar and Jet Neuf (a); two B. juncea cvs., Forge and common brown mustard (CBM) (b); B. rapa turnip cv., Mizspoona, from the Willamette Valley of Oregon; and B. oleracea cabbage cv., Copenhagen Market (c). The lesion sizes were quantified 14 days’ post-inoculation (dpi) using Assess 2.0 (American Phytopathological Society, St Paul, MN) for each test, isolate, and Brassica cultivar as described in the main text, and statistical analyses performed using SAS Version 9.4 (SAS Institute, Inc., Cary, NC) for analysis of variance (ANOVA) and means comparison with Tukey’s Honestly Significant Difference Studentized range test at p ≤ 0.05. Each bar represents the mean and standard deviation of the lesion size for a particular Brassica species. Different letters (from ‘a’ to ‘f’) over the bars indicate the significant differences (p < 0.05).
Ijms 20 01668 g005
Table 1. Mean pathogenicity scores and their inferred disease resistance for seedlings of the Brassica species in response to inoculation with the Brassica rapa derived isolates from Willamette Valley, Oregon, USA.
Table 1. Mean pathogenicity scores and their inferred disease resistance for seedlings of the Brassica species in response to inoculation with the Brassica rapa derived isolates from Willamette Valley, Oregon, USA.
Cultivar/LineBrassica SpeciesB. rapa-Derived IsolatesInferred Phenotype
Phl002Phl003Phl004Phl005Phl006Phl007
WestarBrassica napus4.50 a,b4.404.575.294.834.29IR c
Jet NeufBrassica napus3.004.334.864.863.294.14R
Surpass 400Brassica napus3.713.572.692.432.712.71R
01-23-2-1Brassica napus5.334.863.833.432.832.57R
QuintaBrassica napus3.675.003.002.602.332.79R
1065Brassica napus4.506.335.334.574.004.67IR
GlacierBrassica napus3.003.803.602.252.603.20R
1135Brassica napus2.142.291.571.572.141.57R
GoélandBrassica napus1.502.672.401.711.101.50R
02-22-2-1Brassica napus4.174.294.434.434.864.71R
VaroxBrassica juncea3.002.673.003.832.673.00R
EstilinBrassica juncea2.673.833.833.832.171.83R
UM3309Brassica juncea3.002.331.672.671.832.67R
ForgeBrassica juncea5.176.176.177.336.176.50S
Vox-0Brassica juncea4.572.673.003.832.673.00R
DohirdaBrassica juncea3.833.002.331.832.672.67R
CBMBrassica juncea6.177.006.176.176.836.67S
UM1112Brassica rapa6.676.346.346.676.836.17S
UM1161Brassica rapa7.336.176.176.506.346.67S
UM1402Brassica rapa2.673.832.333.002.672.67R
UM1113Brassica rapa6.176.346.677.336.005.67S
UM1147Brassica rapa2.673.001.832.332.332.67R
UM1154Brassica rapa3.003.002.671.832.672.33R
a Score averaged for six plants. b Pathogenicity assessments completed 11 days’ post-inoculation(dpi). c R, IR, S = Brassica spp. or cultivars that displayed resistance, intermediate resistance, and susceptibility, respectively, to B. rapa-derived Leptosphaeria isolates from Oregon, USA.
Table 2. Sequences of primer pairs used in PCR assays to confirm the identity of Leptosphaeria biglobosa and L. maculans isolates in this study.
Table 2. Sequences of primer pairs used in PCR assays to confirm the identity of Leptosphaeria biglobosa and L. maculans isolates in this study.
Primer Name aSequence (5′–3′)Annealing Temperature (°C)Reference
ITS F (PN3)CCGTTGGTGAACCAGCGGAGGGATC58Mendes-Pereira et al. (2003) [6]
ITS R (PN10)TCCGCTTATTGATATGCTTAAG
Actin FGAGCAGGAGATCCAGACTGC56Van de Wouw et al. (2008) [10]
Actin RTTCGAGATCCACATCTGCTG
β-tubulin FGTCGAGAACTCCGACGAGAC55Van de Wouw et al. (2008) [10]
β-tubulin RATCTGGTCCTCGACCTCCTT
MAT1.1-FCTCGATGCAATGTACTTGG56Cozijinsen and Howlett (2003) [27]
MAT1.2-FAGCCGGAGGTGAAGTTGAAGCCG
MAT-RTGGCGAATTAAGGGATTGCTG
Back to TopTop