High Mobility Group Box 1 and TLR4 Signaling Pathway in Gnotobiotic Piglets Colonized/Infected with L. amylovorus, L. mucosae, E. coli Nissle 1917 and S. Typhimurium
Abstract
1. Introduction
2. Results
2.1. mRNA Relative Expressions of TLR4 and Its Related Molecules, TLR2, TLR9, and RAGE, in the Ileum
2.2. mRNA Relative Expressions of TLR4 and Its Related Molecules, TLR2, TLR9, and RAGE, in the Colon
2.3. mRNA Relative Expressions of TLR4 and Its Related Molecules, TLR2, TLR9, and RAGE in Mesenteric Lymph Nodes
2.4. mRNA Relative Expressions of TLR4 and Its Related Molecules, TLR2, TLR9, and RAGE, in the Ileum, Colon, and MLN
2.5. mRNA Relative Expressions of HMGB1 in the Ileum, Colon, and MLN
2.6. Cellular HMGB1 Protein in MLN
2.7. Local and Systemic Levels of HMGB1
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Bacterial Suspensions
4.3. Gnotobiotic Piglets
4.4. Total RNA Isolation, Reverse Transcription
4.5. Real-Time PCR
4.6. Immunofluorescent Detection of HMGB1 in Mesenteric Lymph Nodes
4.7. Local and Systemic HMGB1 Levels
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
2−ΔCT | Comparative CT method |
BACT | β-actin |
Cq | Cycle of quantification |
CT | Treshold cycle |
CYPA | Cyclophylin A |
DAMPs | Damage-Associated Molecular Patterns |
DAPI | 4′,6-diamidino-2-phenylindole |
EcN | Escherichia coli Nissle 1917 |
ELISA | Enzyme Linked Immuno Sorbent Assay |
GF | Germ-free |
GIT | Gastrointestinal tract |
HMGB1 | High mobility group box 1 |
IFN | Interferon |
IL | Interleukin |
LA | Lactobacillus amylovorus |
LBP | Lipopolysaccharide binding protein |
LM | Lactobacillus mucosae |
LNA | Locked nucleic acid |
LT2 | Salmonella Typhimurium strain LT2 |
MD-2 | Myeloid differentiation factor 2 |
MRS | De Man, Rogosa, and Sharpe |
MyD88 | Myeloid differentiation primary response 88 |
NEC | Necrotizing enterocolitis |
NF-κB | Nuclear factor kappa B |
NTS | Non-typhoidal Salmonellae |
PAMPs | Pathogen-Associated Molecular Patterns |
PRRs | Pathogen Recognition Receptors |
RAGE | Receptor for Advanced Glycation End |
RT-qPCR | Real-Time quantitative Polymerase Chain Reaction |
ST | Salmonella Typhimurium |
TLR | Toll-like Receptor |
TNF | Tumor Necrosis Factor |
TRIF | TIR domain-containing adaptor inducing IFN-β |
References
- Dumitriu, I.E.; Baruah, P.; Manfredi, A.A.; Bianchi, M.E.; Rovere-Querini, P. HMGB1: Guiding immunity from within. Trends Immunol. 2005, 26, 381–387. [Google Scholar] [CrossRef] [PubMed]
- Griess, E.A.; Rensing, S.A.; Grasser, K.D.; Maier, U.G.; Feix, G. Phylogenetic relationships of HMG box DNA-binding domains. J. Mol. Evol. 1993, 37, 204–210. [Google Scholar] [CrossRef] [PubMed]
- Bianchi, M.E.; Crippa, M.P.; Manfredi, A.A.; Mezzapelle, R.; Rovere, Q.P.; Venereau, E. High-mobility group box 1 protein orchestrates responses to tissue damage via inflammation, innate and adaptive immunity, and tissue repair. Immunol. Rev. 2017, 280, 74–82. [Google Scholar] [CrossRef] [PubMed]
- Calogero, S.; Grassi, F.; Aguzzi, A.; Voigtlander, T.; Ferrier, P.; Ferrari, S.; Bianchi, M.E. The lack of chromosomal protein Hmg1 does not disrupt cell growth but causes lethal hypoglycaemia in newborn mice. Nat. Genet. 1999, 22, 276–280. [Google Scholar] [CrossRef]
- Chen, G.Y.; Nunez, G. Sterile inflammation: Sensing and reacting to damage. Nat. Rev. Immunol. 2010, 10, 826–837. [Google Scholar] [CrossRef]
- Rider, P.; Voronov, E.; Dinarello, C.A.; Apte, R.N.; Cohen, I. Alarmins: Feel the stress. J. Immunol. 2017, 198, 1395–1402. [Google Scholar] [CrossRef]
- Deng, M.; Scott, M.J.; Fan, J.; Billiar, T.R. Location is the key to function: HMGB1 in sepsis and trauma-induced inflammation. J. Leukoc. Biol. 2019. [Google Scholar] [CrossRef]
- Bertheloot, D.; Latz, E. HMGB1, IL-1alpha, IL-33 and S100 proteins: Dual-function alarmins. Cell Mol. Immunol. 2017, 14, 43–64. [Google Scholar] [CrossRef]
- Dogi, C.A.; Galdeano, C.M.; Perdigon, G. Gut immune stimulation by non pathogenic Gram(+) and Gram(-) bacteria. Comparison with a probiotic strain. Cytokine 2008, 41, 223–231. [Google Scholar] [CrossRef]
- Surbatovic, M.; Popovic, N.; Vojvodic, D.; Milosevic, I.; Acimovic, G.; Stojicic, M.; Veljovic, M.; Jevdjic, J.; Djordjevic, D.; Radakovic, S. Cytokine profile in severe Gram-positive and Gram-negative abdominal sepsis. Sci Rep. 2015, 5, 11355. [Google Scholar] [CrossRef]
- Cinel, I.; Opal, S.M. Molecular biology of inflammation and sepsis: A primer. Crit. Care Med. 2009, 37, 291–304. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Qi, Z.; Zhao, L.; Shao, R.; Fang, Y.; Li, C. Prognostic value of dynamic monitoring of cellular immunity and HMGB1 in severe sepsis: Delayed chronic inflammation may be the leading cause of death in late severe sepsis. Clin. Lab. 2016, 62, 2379–2385. [Google Scholar] [CrossRef] [PubMed]
- Bonaldi, T.; Talamo, F.; Scaffidi, P.; Ferrera, D.; Porto, A.; Bachi, A.; Rubartelli, A.; Agresti, A.; Bianchi, M.E. Monocytic cells hyperacetylate chromatin protein HMGB1 to redirect it towards secretion. EMBO J. 2003, 22, 5551–5560. [Google Scholar] [CrossRef] [PubMed]
- Ito, I.; Fukazawa, J.; Yoshida, M. Post-translational methylation of high mobility group box 1 (HMGB1) causes its cytoplasmic localization in neutrophils. J. Biol. Chem. 2007, 282, 16336–16344. [Google Scholar] [CrossRef] [PubMed]
- Youn, J.H.; Shin, J.S. Nucleocytoplasmic shuttling of HMGB1 is regulated by phosphorylation that redirects it toward secretion. J. Immunol. 2006, 177, 7889–7897. [Google Scholar] [CrossRef]
- Scaffidi, P.; Misteli, T.; Bianchi, M.E. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature 2002, 418, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Ma, S. The cytokine storm and factors determining the sequence and severity of organ dysfunction in multiple organ dysfunction syndrome. Am. J. Emerg. Med. 2008, 26, 711–715. [Google Scholar] [CrossRef]
- Janeway, C.A., Jr. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 1989, 54, 1–13. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef]
- Cao, X. Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease. Nat. Rev. Immunol. 2016, 16, 35–50. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed]
- Vourc’h, M.; Roquilly, A.; Asehnoune, K. Trauma-Induced Damage-Associated Molecular Patterns-Mediated Remote Organ Injury and Immunosuppression in the Acutely Ill Patient. Front. Immunol. 2018, 9, 1330. [Google Scholar] [CrossRef] [PubMed]
- Deutschman, C.S.; Tracey, K.J. Sepsis: Current dogma and new perspectives. Immunity 2014, 40, 463–475. [Google Scholar] [CrossRef] [PubMed]
- Bone, R.C.; Balk, R.A.; Cerra, F.B.; Dellinger, R.P.; Fein, A.M.; Knaus, W.A.; Schein, R.M.; Sibbald, W.J. Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest 1992, 101, 1644–1655. [Google Scholar] [CrossRef] [PubMed]
- Singer, M.; Deutschman, C.S.; Seymour, C.W.; Shankar-Hari, M.; Annane, D.; Bauer, M.; Bellomo, R.; Bernard, G.R.; Chiche, J.D.; Coopersmith, C.M.; et al. The Third international consensus definitions for sepsis and septic shock (sepsis-3). JAMA 2016, 315, 801–810. [Google Scholar] [CrossRef] [PubMed]
- Lunney, J.K. Advances in swine biomedical model genomics. Int. J. Biol. Sci. 2007, 3, 179–184. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; Estelle, J.; Kiilerich, P.; Ramayo-Caldas, Y.; Xia, Z.; Feng, Q.; Liang, S.; Pedersen, A.O.; Kjeldsen, N.J.; Liu, C.; et al. A reference gene catalogue of the pig gut microbiome. Nat. Microbiol. 2016, 1, 16161. [Google Scholar] [CrossRef]
- Meurens, F.; Summerfield, A.; Nauwynck, H.; Saif, L.; Gerdts, V. The pig: A model for human infectious diseases. Trends Microbiol. 2012, 20, 50–57. [Google Scholar] [CrossRef]
- Zhang, Q.; Widmer, G.; Tzipori, S. A pig model of the human gastrointestinal tract. Gut Microbes 2013, 4, 193–200. [Google Scholar] [CrossRef]
- Kaiser, P.; Hardt, W.D. Salmonella typhimurium diarrhea: Switching the mucosal epithelium from homeostasis to defense. Curr. Opin. Immunol. 2011, 23, 456–463. [Google Scholar] [CrossRef]
- Barthel, M.; Hapfelmeier, S.; Quintanilla-Martinez, L.; Kremer, M.; Rohde, M.; Hogardt, M.; Pfeffer, K.; Russmann, H.; Hardt, W.D. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both pathogen and host. Infect. Immun. 2003, 71, 2839–2858. [Google Scholar] [CrossRef] [PubMed]
- Wen, S.C.; Best, E.; Nourse, C. Non-typhoidal Salmonella infections in children: Review of literature and recommendations for management. J. Paediatr. Child Health 2017, 53, 936–941. [Google Scholar] [CrossRef] [PubMed]
- Crump, J.A.; Sjolund-Karlsson, M.; Gordon, M.A.; Parry, C.M. Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clin. Microbiol. Rev. 2015, 28, 901–937. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority and European Centre for Disease Prevention and Control The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2017. EPSA J. 2019, 17, 5598. [CrossRef]
- Wang, X.; Biswas, S.; Paudyal, N.; Pan, H.; Li, X.; Fang, W.; Yue, M. Antibiotic resistance in Salmonella Typhimurium isolates recovered from the food chain through National Antimicrobial Resistance Monitoring System between 1996 and 2016. Front. Microbiol. 2019, 10, 985. [Google Scholar] [CrossRef]
- Liu, Y.; Espinosa, C.D.; Abelilla, J.J.; Casas, G.A.; Lagos, L.V.; Lee, S.A.; Kwon, W.B.; Mathai, J.K.; Navarro, D.M.D.L.; Jaworski, N.W.; et al. Non-antibiotic feed additives in diets for pigs: A review. Anim. Nutr. 2018, 4, 113–125. [Google Scholar] [CrossRef]
- Gajdacs, M. The Concept of an ideal antibiotic: Implications for drug design. Molecules 2019, 24, 892. [Google Scholar] [CrossRef]
- Yang, J.; Qian, K.; Wang, C.; Wu, Y. Roles of probiotic Lactobacilli inclusion in helping piglets establish healthy intestinal inter-environment for pathogen defense. Probiotics Antimicrob. Proteins 2018, 10, 243–250. [Google Scholar] [CrossRef]
- Crespo-Piazuelo, D.; Estelle, J.; Revilla, M.; Criado-Mesas, L.; Ramayo-Caldas, Y.; Ovilo, C.; Fernandez, A.I.; Ballester, M.; Folch, J.M. Characterization of bacterial microbiota compositions along the intestinal tract in pigs and their interactions and functions. Sci. Rep. 2018, 8, 12727. [Google Scholar] [CrossRef]
- Backhed, F.; Roswall, J.; Peng, Y.; Feng, Q.; Jia, H.; Kovatcheva-Datchary, P.; Li, Y.; Xia, Y.; Xie, H.; Zhong, H.; et al. Dynamics and stabilization of the human gut microbiome during the first year of life. Cell Host Microbe 2015, 17, 690–703. [Google Scholar] [CrossRef]
- van Baarlen, P.; Wells, J.M.; Kleerebezem, M. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli. Trends Immunol. 2013, 34, 208–215. [Google Scholar] [CrossRef] [PubMed]
- Aroutcheva, A.; Gariti, D.; Simon, M.; Shott, S.; Faro, J.; Simoes, J.A.; Gurguis, A.; Faro, S. Defense factors of vaginal lactobacilli. Am. J. Obstet. Gynecol. 2001, 185, 375–379. [Google Scholar] [CrossRef] [PubMed]
- Castro-Gonzalez, J.M.; Castro, P.; Sandoval, H.; Castro-Sandoval, D. Probiotic lactobacilli precautions. Front. Microbiol. 2019, 10, 375. [Google Scholar] [CrossRef] [PubMed]
- Gajdacs, M.; Spengler, G.; Urban, E. Identification and antimicrobial susceptibility testing of anaerobic bacteria: Rubik’s cube of clinical microbiology? Antibiotics 2017, 6, 25. [Google Scholar] [CrossRef] [PubMed]
- Lievin-Le Moal, V.; Servin, A.L. Anti-infective activities of lactobacillus strains in the human intestinal microbiota: From probiotics to gastrointestinal anti-infectious biotherapeutic agents. Clin. Microbiol. Rev. 2014, 27, 167–199. [Google Scholar] [CrossRef] [PubMed]
- Halder, D.; Mandal, M.; Chatterjee, S.S.; Pal, N.K.; Mandal, S. Indigenous probiotic lactobacillus isolates presenting antibiotic like activity against human pathogenic bacteria. Biomedicines 2017, 5, 31. [Google Scholar] [CrossRef] [PubMed]
- Splichal, I.; Donovan, S.M.; Splichalova, Z.; Neuzil Bunesova, V.; Vlkova, E.; Jenistova, V.; Killer, J.; Svejstil, R.; Skrivanova, E.; Splichalova, A. Colonization of germ-free piglets with commensal Lactobacillus amylovorus, Lactobacillus mucosae, and probiotic E. coli Nissle 1917 and their interference with Salmonella Typhimurium. Microorganisms 2019, 7, 273. [Google Scholar] [CrossRef]
- Robins-Browne, R.M.; Holt, K.E.; Ingle, D.J.; Hocking, D.M.; Yang, J.; Tauschek, M. Are Escherichia coli pathotypes still relevant in the era of whole-genome sequencing? Front. Cell Infect. Microbiol. 2016, 6, 141. [Google Scholar] [CrossRef]
- Wassenaar, T.M. Insights from 100 years of research with probiotic E. coli. Eur. J. Microbiol. Immunol. 2016, 6, 147–161. [Google Scholar] [CrossRef]
- Henker, J.; Laass, M.; Blokhin, B.M.; Bolbot, Y.K.; Maydannik, V.G.; Elze, M.; Wolff, C.; Schulze, J. The probiotic Escherichia coli strain Nissle 1917 (EcN) stops acute diarrhoea in infants and toddlers. Eur. J. Pediatr. 2007, 166, 311–318. [Google Scholar] [CrossRef]
- Schroeder, B.; Duncker, S.; Barth, S.; Bauerfeind, R.; Gruber, A.D.; Deppenmeier, S.; Breves, G. Preventive effects of the probiotic Escherichia coli strain Nissle 1917 on acute secretory diarrhea in a pig model of intestinal infection. Dig. Dis. Sci. 2006, 51, 724–731. [Google Scholar] [CrossRef] [PubMed]
- Trebichavsky, I.; Splichal, I.; Rada, V.; Splichalova, A. Modulation of natural immunity in the gut by Escherichia coli strain Nissle 1917. Nutr. Rev. 2010, 68, 459–464. [Google Scholar] [CrossRef] [PubMed]
- Mooser, C.; Gomez de, A.M.; Ganal-Vonarburg, S.C. Standardization in host-microbiota interaction studies: Challenges, gnotobiology as a tool, and perspective. Curr. Opin. Microbiol. 2018, 44, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Stecher, B.; Hardt, W.D. Mechanisms controlling pathogen colonization of the gut. Curr. Opin. Microbiol. 2011, 14, 82–91. [Google Scholar] [CrossRef] [PubMed]
- Tremaroli, V.; Backhed, F. Functional interactions between the gut microbiota and host metabolism. Nature 2012, 489, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Salmon, H.; Berri, M.; Gerdts, V.; Meurens, F. Humoral and cellular factors of maternal immunity in swine. Dev. Comp. Immunol. 2009, 33, 384–393. [Google Scholar] [CrossRef] [PubMed]
- Splichalova, A.; Slavikova, V.; Splichalova, Z.; Splichal, I. Preterm life in sterile conditions: A study on preterm, germ-free piglets. Front. Immunol. 2018, 9, 220. [Google Scholar] [CrossRef]
- McClelland, M.; Sanderson, K.E.; Spieth, J.; Clifton, S.W.; Latreille, P.; Courtney, L.; Porwollik, S.; Ali, J.; Dante, M.; Du, F.; et al. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 2001, 413, 852–856. [Google Scholar] [CrossRef]
- Clarke, R.C.; Gyles, C.L. Virulence of wild and mutant strains of Salmonella typhimurium in ligated intestinal segments of calves, pigs, and rabbits. Am. J. Vet. Res. 1987, 48, 504–510. [Google Scholar]
- Splichalova, A.; Jenistova, V.; Splichalova, Z.; Splichal, I. Colonization of preterm gnotobiotic piglets with probiotic Lactobacillus rhamnosus GG and its interference with Salmonella Typhimurium. Clin. Exp. Immunol. 2019, 195, 381–394. [Google Scholar] [CrossRef]
- Morris, M.C.; Gilliam, E.A.; Li, L. Innate immune programing by endotoxin and its pathological consequences. Front. Immunol. 2014, 5, 680. [Google Scholar] [CrossRef] [PubMed]
- Munford, R.S. Sensing gram-negative bacterial lipopolysaccharides: A human disease determinant? Infect. Immun. 2008, 76, 454–465. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Bloom, O.; Zhang, M.; Vishnubhakat, J.M.; Ombrellino, M.; Che, J.; Frazier, A.; Yang, H.; Ivanova, S.; Borovikova, L.; et al. HMG-1 as a late mediator of endotoxin lethality in mice. Science 1999, 285, 248–251. [Google Scholar] [CrossRef] [PubMed]
- Qin, Y.H.; Dai, S.M.; Tang, G.S.; Zhang, J.; Ren, D.; Wang, Z.W.; Shen, Q. HMGB1 enhances the proinflammatory activity of lipopolysaccharide by promoting the phosphorylation of MAPK p38 through receptor for advanced glycation end products. J. Immunol. 2009, 183, 6244–6250. [Google Scholar] [CrossRef]
- Kuzmich, N.N.; Sivak, K.V.; Chubarev, V.N.; Porozov, Y.B.; Savateeva-Lyubimova, T.N.; Peri, F. TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis. Vaccines 2017, 5, 34. [Google Scholar] [CrossRef]
- Lau, C.; Gunnarsen, K.S.; Hoydahl, L.S.; Andersen, J.T.; Berntzen, G.; Pharo, A.; Lindstad, J.K.; Ludviksen, J.K.; Brekke, O.L.; Barratt-Due, A.; et al. Chimeric anti-CD14 IGG2/4 Hybrid antibodies for therapeutic intervention in pig and human models of inflammation. J. Immunol. 2013, 191, 4769–4777. [Google Scholar] [CrossRef]
- Skjeflo, E.W.; Sagatun, C.; Dybwik, K.; Aam, S.; Urving, S.H.; Nunn, M.A.; Fure, H.; Lau, C.; Brekke, O.L.; Huber-Lang, M.; et al. Combined inhibition of complement and CD14 improved outcome in porcine polymicrobial sepsis. Crit. Care 2015, 19, 415. [Google Scholar] [CrossRef]
- Thorgersen, E.B.; Pischke, S.E.; Barratt-Due, A.; Fure, H.; Lindstad, J.K.; Pharo, A.; Hellerud, B.C.; Mollnes, T.E. Systemic CD14 inhibition attenuates organ inflammation in porcine Escherichia coli sepsis. Infect. Immun. 2013, 81, 3173–3181. [Google Scholar] [CrossRef]
- Mussap, M.; Puxeddu, E.; Puddu, M.; Ottonello, G.; Coghe, F.; Comite, P.; Cibecchini, F.; Fanos, V. Soluble CD14 subtype (sCD14-ST) presepsin in premature and full term critically ill newborns with sepsis and SIRS. Clin. Chim. Acta 2015, 451, 65–70. [Google Scholar] [CrossRef]
- Chen, L.; Yu, J. Modulation of Toll-like receptor signaling in innate immunity by natural products. Int. Immunopharmacol. 2016, 37, 65–70. [Google Scholar] [CrossRef]
- Kanmani, P.; Ansari, A.; Villena, J.; Kim, H. Immunobiotics beneficially modulate TLR4 signaling triggered by lipopolysaccharide and reduce hepatic steatosis in vitro. J. Immunol. Res. 2019, 2019, 3876896. [Google Scholar] [CrossRef] [PubMed]
- Finamore, A.; Roselli, M.; Imbinto, A.; Seeboth, J.; Oswald, I.P.; Mengheri, E. Lactobacillus amylovorus inhibits the TLR4 inflammatory signaling triggered by enterotoxigenic Escherichia coli via modulation of the negative regulators and involvement of TLR2 in intestinal Caco-2 cells and pig explants. PLoS ONE 2014, 9, e94891. [Google Scholar] [CrossRef] [PubMed]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [PubMed]
- Beveridge, T.J. Structures of gram-negative cell walls and their derived membrane vesicles. J. Bacteriol. 1999, 181, 4725–4733. [Google Scholar] [PubMed]
- Kaparakis-Liaskos, M.; Ferrero, R.L. Immune modulation by bacterial outer membrane vesicles. Nat. Rev. Immunol. 2015, 15, 375–387. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Huang, S.; Jiang, L.; Dai, Z.; Li, T.; Han, D.; Wang, J. Characterization of the early life microbiota development and predominant Lactobacillus species at distinct gut segments of low- and normal-birth-weight piglets. Front. Microbiol. 2019, 10, 797. [Google Scholar] [CrossRef] [PubMed]
- Kanmani, P.; Kim, H. Functional capabilities of probiotic strains on attenuation of intestinal epithelial cell inflammatory response induced by TLR4 stimuli. Biofactors 2019, 45, 223–235. [Google Scholar] [CrossRef]
- Yi, H.; Wang, L.; Xiong, Y.; Wen, X.; Wang, Z.; Yang, X.; Gao, K.; Jiang, Z. Effects of Lactobacillus reuteri LR1 on the growth performance, intestinal morphology, and intestinal barrier function in weaned pigs. J. Anim. Sci. 2018, 96, 2342–2351. [Google Scholar] [CrossRef]
- Roselli, M.; Finamore, A.; Britti, M.S.; Konstantinov, S.R.; Smidt, H.; de Vos, W.M.; Mengheri, E. The novel porcine Lactobacillus sobrius strain protects intestinal cells from enterotoxigenic Escherichia coli K88 infection and prevents membrane barrier damage. J. Nutr. 2007, 137, 2709–2716. [Google Scholar] [CrossRef]
- Roos, S.; Karner, F.; Axelsson, L.; Jonsson, H. Lactobacillus mucosae sp. nov., a new species with in vitro mucus-binding activity isolated from pig intestine. Int. J. Syst. Evol. Microbiol. 2000, 50, 251–258. [Google Scholar] [CrossRef]
- Grozdanov, L.; Zahringer, U.; Blum-Oehler, G.; Brade, L.; Henne, A.; Knirel, Y.A.; Schombel, U.; Schulze, J.; Sonnenborn, U.; Gottschalk, G.; et al. A single nucleotide exchange in the wzy gene is responsible for the semirough O6 lipopolysaccharide phenotype and serum sensitivity of Escherichia coli strain Nissle 1917. J. Bacteriol. 2002, 184, 5912–5925. [Google Scholar] [CrossRef]
- Secher, T.; Brehin, C.; Oswald, E. Early settlers: Which E. coli strains do you not want at birth? Am J Physiol Gastrointest. Liver Physiol. 2016, 311, G123–G129. [Google Scholar] [CrossRef]
- Foster, N.; Lovell, M.A.; Marston, K.L.; Hulme, S.D.; Frost, A.J.; Bland, P.; Barrow, P.A. Rapid protection of gnotobiotic pigs against experimental salmonellosis following induction of polymorphonuclear leukocytes by avirulent Salmonella enterica. Infect. Immun. 2003, 71, 2182–2191. [Google Scholar] [CrossRef]
- Splichal, I.; Trebichavsky, I.; Splichalova, A.; Barrow, P.A. Protection of gnotobiotic pigs against Salmonella enterica serotype Typhimurium by rough mutant of the same serotype is accompanied by the change of local and systemic cytokine response. Vet. Immunol. Immunopathol. 2005, 103, 155–161. [Google Scholar] [CrossRef]
- Zughaier, S.M.; Zimmer, S.M.; Datta, A.; Carlson, R.W.; Stephens, D.S. Differential induction of the toll-like receptor 4-MyD88-dependent and -independent signaling pathways by endotoxins. Infect. Immun. 2005, 73, 2940–2950. [Google Scholar] [CrossRef]
- Raby, A.C.; Holst, B.; Le, B.E.; Diaz, C.; Ferran, E.; Conraux, L.; Guillemot, J.C.; Coles, B.; Kift-Morgan, A.; Colmont, C.S.; et al. Targeting the TLR co-receptor CD14 with TLR2-derived peptides modulates immune responses to pathogens. Sci. Transl. Med. 2013, 5, 185ra64. [Google Scholar] [CrossRef]
- Baumann, C.L.; Aspalter, I.M.; Sharif, O.; Pichlmair, A.; Bluml, S.; Grebien, F.; Bruckner, M.; Pasierbek, P.; Aumayr, K.; Planyavsky, M.; et al. CD14 is a coreceptor of Toll-like receptors 7 and 9. J. Exp. Med. 2010, 207, 2689–2701. [Google Scholar] [CrossRef]
- Thorgersen, E.B.; Hellerud, B.C.; Nielsen, E.W.; Barratt-Due, A.; Fure, H.; Lindstad, J.K.; Pharo, A.; Fosse, E.; Tonnessen, T.I.; Johansen, H.T.; et al. CD14 inhibition efficiently attenuates early inflammatory and hemostatic responses in Escherichia coli sepsis in pigs. FASEB J. 2010, 24, 712–722. [Google Scholar] [CrossRef]
- Zhan, R.; Han, Q.; Zhang, C.; Tian, Z.; Zhang, J. Toll-Like receptor 2 (TLR2) and TLR9 play opposing roles in host innate immunity against Salmonella enterica serovar Typhimurium infection. Infect. Immun. 2015, 83, 1641–1649. [Google Scholar] [CrossRef]
- Grabig, A.; Paclik, D.; Guzy, C.; Dankof, A.; Baumgart, D.C.; Erckenbrecht, J.; Raupach, B.; Sonnenborn, U.; Eckert, J.; Schumann, R.R.; et al. Escherichia coli strain Nissle 1917 ameliorates experimental colitis via toll-like receptor 2- and toll-like receptor 4-dependent pathways. Infect. Immun. 2006, 74, 4075–4082. [Google Scholar] [CrossRef]
- Uribe, J.H.; Collado-Romero, M.; Zaldivar-Lopez, S.; Arce, C.; Bautista, R.; Carvajal, A.; Cirera, S.; Claros, M.G.; Garrido, J.J. Transcriptional analysis of porcine intestinal mucosa infected with Salmonella Typhimurium revealed a massive inflammatory response and disruption of bile acid absorption in ileum. Vet. Res. 2016, 47, 11. [Google Scholar] [CrossRef]
- Sheikh, I.A.; Ammoury, R.; Ghishan, F.K. Chapter 68—Pathophysiology of Diarrhea and Its Clinical Implications. In Physiology of the Gastrointestinal Tract, 6th ed.; Said, H.M., Ed.; Academic Press—Elsevier Inc.: Amsterdam, The Netherlands, 2018; pp. 1669–1687. [Google Scholar]
- Pieper, R.; Janczyk, P.; Zeyner, A.; Smidt, H.; Guiard, V.; Souffrant, W.B. Ecophysiology of the developing total bacterial and lactobacillus communities in the terminal small intestine of weaning piglets. Microb. Ecol. 2008, 56, 474–483. [Google Scholar] [CrossRef]
- Collado-Romero, M.; Arce, C.; Ramirez-Boo, M.; Carvajal, A.; Garrido, J.J. Quantitative analysis of the immune response upon Salmonella typhimurium infection along the porcine intestinal gut. Vet. Res. 2010, 41, 23. [Google Scholar] [CrossRef]
- Bravo-Blas, A.; Utriainen, L.; Clay, S.L.; Kastele, V.; Cerovic, V.; Cunningham, A.F.; Henderson, I.R.; Wall, D.M.; Milling, S.W.F. Salmonella enterica serovar Typhimurium travels to mesenteric lymph nodes both with host cells and autonomously. J. Immunol. 2019, 202, 260–267. [Google Scholar] [CrossRef]
- Neutra, M.R.; Mantis, N.J.; Kraehenbuhl, J.P. Collaboration of epithelial cells with organized mucosal lymphoid tissues. Nat. Immunol. 2001, 2, 1004–1009. [Google Scholar] [CrossRef]
- Voedisch, S.; Koenecke, C.; David, S.; Herbrand, H.; Forster, R.; Rhen, M.; Pabst, O. Mesenteric lymph nodes confine dendritic cell-mediated dissemination of Salmonella enterica serovar Typhimurium and limit systemic disease in mice. Infect. Immun. 2009, 77, 3170–3180. [Google Scholar] [CrossRef]
- Delves, P.J.; Roitt, I.M. The immune system. First of two parts. N. Engl. J. Med. 2000, 343, 37–49. [Google Scholar] [CrossRef]
- Tohno, M.; Shimosato, T.; Moue, M.; Aso, H.; Watanabe, K.; Kawai, Y.; Yamaguchi, T.; Saito, T.; Kitazawa, H. Toll-like receptor 2 and 9 are expressed and functional in gut-associated lymphoid tissues of presuckling newborn swine. Vet. Res. 2006, 37, 791–812. [Google Scholar] [CrossRef]
- Dziarski, R.; Wang, Q.; Miyake, K.; Kirschning, C.J.; Gupta, D. MD-2 enables Toll-like receptor 2 (TLR2)-mediated responses to lipopolysaccharide and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components. J. Immunol. 2001, 166, 1938–1944. [Google Scholar] [CrossRef]
- Martins, R.P.; Collado-Romero, M.; Arce, C.; Lucena, C.; Carvajal, A.; Garrido, J.J. Exploring the immune response of porcine mesenteric lymph nodes to Salmonella enterica serovar Typhimurium: An analysis of transcriptional changes, morphological alterations and pathogen burden. Comp. Immunol. Microbiol. Infect. Dis. 2013, 36, 149–160. [Google Scholar] [CrossRef]
- Bucciarelli, L.G.; Wendt, T.; Rong, L.; Lalla, E.; Hofmann, M.A.; Goova, M.T.; Taguchi, A.; Yan, S.F.; Yan, S.D.; Stern, D.M.; et al. RAGE is a multiligand receptor of the immunoglobulin superfamily: Implications for homeostasis and chronic disease. Cell Mol. Life Sci. 2002, 59, 1117–1128. [Google Scholar] [CrossRef]
- Splichalova, A.; Splichal, I.; Chmelarova, P.; Trebichavsky, I. Alarmin HMGB1 is released in the small intestine of gnotobiotic piglets infected with enteric pathogens and its level in plasma reflects severity of sepsis. J. Clin. Immunol. 2011, 31, 488–497. [Google Scholar] [CrossRef]
- Vitali, R.; Stronati, L.; Negroni, A.; Di Nardo, G.; Pierdomenico, M.; Del Giudice, E.; Rossi, P.; Cucchiara, S. Fecal HMGB1 is a novel marker of intestinal mucosal inflammation in pediatric inflammatory bowel disease. Am. J. Gastroenterol. 2011, 106, 2029–2040. [Google Scholar] [CrossRef]
- Mihi, B.; Good, M. Impact of Toll-Like Receptor 4 Signaling in Necrotizing Enterocolitis: The State of the Science. Clin. Perinatol. 2019, 46, 145–157. [Google Scholar] [CrossRef]
- Hong, C.R.; Han, S.M.; Jaksic, T. Surgical considerations for neonates with necrotizing enterocolitis. Semin. Fetal Neonatal. Med. 2018, 23, 420–425. [Google Scholar] [CrossRef]
- Zhang, S.; Kingsley, R.A.; Santos, R.L.; Andrews-Polymenis, H.; Raffatellu, M.; Figueiredo, J.; Nunes, J.; Tsolis, R.M.; Adams, L.G.; Baumler, A.J. Molecular pathogenesis of Salmonella enterica serotype Typhimurium-induced diarrhea. Infect. Immun. 2003, 71, 1–12. [Google Scholar] [CrossRef]
- Yu, R.; Jiang, S.; Tao, Y.; Li, P.; Yin, J.; Zhou, Q. Inhibition of HMGB1 improves necrotizing enterocolitis by inhibiting NLRP3 via TLR4 and NF-kappaB signaling pathways. J. Cell Physiol. 2019, 234, 13431–13438. [Google Scholar] [CrossRef]
- Splichalova, A.; Splichal, I. Local and systemic occurrences of HMGB1 in gnotobiotic piglets infected with E. coli O55 are related to bacterial translocation and inflammatory cytokines. Cytokine 2012, 60, 597–600. [Google Scholar] [CrossRef]
- Shi, H.; Huang, X.; Yan, Z.; Yang, Q.; Wang, P.; Li, S.; Sun, W.; Gun, S. Effect of Clostridium perfringens type C on TLR4/MyD88/NF-kappaB signaling pathway in piglet small intestines. Microb. Pathog. 2019, 135, 103567. [Google Scholar] [CrossRef]
- Gardella, S.; Andrei, C.; Ferrera, D.; Lotti, L.V.; Torrisi, M.R.; Bianchi, M.E.; Rubartelli, A. The nuclear protein HMGB1 is secreted by monocytes via a non-classical, vesicle-mediated secretory pathway. EMBO Rep. 2002, 3, 995–1001. [Google Scholar] [CrossRef]
- Youn, J.H.; Oh, Y.J.; Kim, E.S.; Choi, J.E.; Shin, J.S. High mobility group box 1 protein binding to lipopolysaccharide facilitates transfer of lipopolysaccharide to CD14 and enhances lipopolysaccharide-mediated TNF-alpha production in human monocytes. J. Immunol. 2008, 180, 5067–5074. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
Gene | 5′-Forward primer-3′ | 5′-Reverse primer-3′ | #LNA Probe |
---|---|---|---|
BACT 1 | TCCCTGGAGAAGAGCTACGA | AAGAGCGCCTCTGGACAC | 9 |
CYPA 2 | CCTGAAGCATACGGGTCCT | AAAGACCACATGTTTGCCATC | 48 |
HMGB1 | AGGAGAGCATCCTGGCCTA | ATCTGCAGCGGTGTTATTCC | 9 |
TLR4 3 | CCATGGCCTTTCTCTCCTG | TCAGCTCCATGCATTGGTAA | 33 |
MD-2 4 | GCTCTGAAGGGAGAGACTGTG | TTGTCCCGGAGAAAATCGTA | 12 |
CD14 5 | TCTCACCACCCTGGACCTAT | AACTTGCGCGGACAGAGA | 23 |
LBP 6 | ACTAGACGGCTCCTTTGACG | GCCCAGGAGAAGATTGACTG | 9 |
TLR2 3 | CTGCTCCTGTGACTTCCTGTC | AGGTAGTTCTCCGGCCAGTC | 40 |
TLR9 3 | CAATGACATCCATAGCCGAGT | CGTTGCCGCTAAAGTCCA | 3 |
MyD88 7 | GCAGCTGGAACAGACCAACT | GTGCCAGGCAGGACATCT | 41 |
TRIF 8 | ATCTCCCTGGAGGCACTGA | GCTGTCTACACCAGCCCACT | 9 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Splichal, I.; Donovan, S.M.; Jenistova, V.; Splichalova, I.; Salmonova, H.; Vlkova, E.; Neuzil Bunesova, V.; Sinkora, M.; Killer, J.; Skrivanova, E.; et al. High Mobility Group Box 1 and TLR4 Signaling Pathway in Gnotobiotic Piglets Colonized/Infected with L. amylovorus, L. mucosae, E. coli Nissle 1917 and S. Typhimurium. Int. J. Mol. Sci. 2019, 20, 6294. https://doi.org/10.3390/ijms20246294
Splichal I, Donovan SM, Jenistova V, Splichalova I, Salmonova H, Vlkova E, Neuzil Bunesova V, Sinkora M, Killer J, Skrivanova E, et al. High Mobility Group Box 1 and TLR4 Signaling Pathway in Gnotobiotic Piglets Colonized/Infected with L. amylovorus, L. mucosae, E. coli Nissle 1917 and S. Typhimurium. International Journal of Molecular Sciences. 2019; 20(24):6294. https://doi.org/10.3390/ijms20246294
Chicago/Turabian StyleSplichal, Igor, Sharon M. Donovan, Vera Jenistova, Iva Splichalova, Hana Salmonova, Eva Vlkova, Vera Neuzil Bunesova, Marek Sinkora, Jiri Killer, Eva Skrivanova, and et al. 2019. "High Mobility Group Box 1 and TLR4 Signaling Pathway in Gnotobiotic Piglets Colonized/Infected with L. amylovorus, L. mucosae, E. coli Nissle 1917 and S. Typhimurium" International Journal of Molecular Sciences 20, no. 24: 6294. https://doi.org/10.3390/ijms20246294
APA StyleSplichal, I., Donovan, S. M., Jenistova, V., Splichalova, I., Salmonova, H., Vlkova, E., Neuzil Bunesova, V., Sinkora, M., Killer, J., Skrivanova, E., & Splichalova, A. (2019). High Mobility Group Box 1 and TLR4 Signaling Pathway in Gnotobiotic Piglets Colonized/Infected with L. amylovorus, L. mucosae, E. coli Nissle 1917 and S. Typhimurium. International Journal of Molecular Sciences, 20(24), 6294. https://doi.org/10.3390/ijms20246294