Hepatic MicroRNA Expression by PGC-1α and PGC-1β in the Mouse
Abstract
1. Introduction
2. Results and Discussion
2.1. The Proliferator-Activated Receptor (PPAR)-γ Coactivator (PGC-1) Family of Transcriptional Coactivators
Structure and Regulation
2.2. MicroRNA
2.2.1. Regulation of PGC-1s by MicroRNAs
2.2.2. Regulation of MicroRNAs by PGC-1s
3. Materials and Methods
3.1. Animals
3.2. RNA Samples Preparation
3.3. Microarray Analysis of miRNA Expression Profiles
3.4. Reverse Transcription and Real-Time Quantitative Polymerase Chain Reaction (qPCR) for miRNA Expression
3.5. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Stanga, Z.; Brunner, A.; Leuenberger, M.; Grimble, R.F.; Shenkin, A.; Allison, S.P.; Lobo, D.N. Nutrition in clinical practice-the refeeding syndrome: Illustrative cases and guidelines for prevention and treatment. Eur. J. Clin. Nutr. 2008, 62, 687–694. [Google Scholar] [CrossRef] [PubMed]
- Petersen, M.C.; Vatner, D.F.; Shulman, G.I. Regulation of hepatic glucose metabolism in health and disease. Nat. Rev. Endocrinol. 2017, 13, 572–587. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Handschin, C.; Spiegelman, B.M. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab. 2005, 1, 361–370. [Google Scholar] [CrossRef] [PubMed]
- Maniyadath, B.; Chattopadhyay, T.; Verma, S.; Kumari, S.; Kulkarni, P.; Banerjee, K.; Lazarus, A.; Kokane, S.S.; Shetty, T.; Anamika, K.; et al. Loss of hepatic oscillatory fed microRNAs abrogates refed transition and causes liver dysfunctions. Cell Rep. 2019, 26, 2212–2226. [Google Scholar] [CrossRef]
- Szabo, G.; Bala, S. MicroRNAs in liver disease. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 542–552. [Google Scholar] [CrossRef]
- Puigserver, P.; Wu, Z.; Park, C.W.; Graves, R.; Wright, M.; Spiegelman, B.M. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 1998, 92, 829–839. [Google Scholar] [CrossRef]
- Lin, J.; Puigserver, P.; Donovan, J.; Tarr, P.; Spiegelman, B.M. Peroxisome proliferator-activated receptor gamma coactivator 1beta (PGC-1beta ), a novel PGC-1-related transcription coactivator associated with host cell factor. J. Biol. Chem. 2002, 277, 1645–1648. [Google Scholar] [CrossRef]
- Andersson, U.; Scarpulla, R.C. Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1-dependent transcription in mammalian cells. Mol. Cell Biol. 2001, 21, 3738–3749. [Google Scholar] [CrossRef]
- Meirhaeghe, A.; Crowley, V.; Lenaghan, C.; Lelliott, C.; Green, K.; Stewart, A.; Hart, K.; Schinner, S.; Sethi, J.K.; Yeo, G.; et al. Characterization of the human, mouse and rat PGC1 beta (peroxisome-proliferator-activated receptor-gamma co-activator 1 beta) gene in vitro and in vivo. Biochem. J. 2003, 373 Pt 1, 155–165. [Google Scholar] [CrossRef]
- Wu, Z.; Puigserver, P.; Andersson, U.; Zhang, C.; Adelmant, G.; Mootha, V.; Troy, A.; Cinti, S.; Lowell, B.; Scarpulla, R.C.; et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 1999, 98, 115–124. [Google Scholar] [CrossRef]
- Lin, J.; Wu, H.; Tarr, P.T.; Zhang, C.Y.; Wu, Z.; Boss, O.; Michael, L.F.; Puigserver, P.; Isotani, E.; Olson, E.N.; et al. Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature 2002, 418, 797–801. [Google Scholar] [CrossRef] [PubMed]
- Vercauteren, K.; Pasko, R.A.; Gleyzer, N.; Marino, V.M.; Scarpulla, R.C. PGC-1-related coactivator: Immediate early expression and characterization of a CREB/NRF-1 binding domain associated with cytochrome c promoter occupancy and respiratory growth. Mol. Cell. Biol. 2006, 26, 7409–7419. [Google Scholar] [CrossRef] [PubMed]
- Vercauteren, K.; Gleyzer, N.; Scarpulla, R.C. Short hairpin RNA-mediated silencing of PRC (PGC-1-related coactivator) results in a severe respiratory chain deficiency associated with the proliferation of aberrant mitochondria. J. Biol. Chem. 2009, 284, 2307–2319. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, S.N.; Emter, R.; Hock, M.B.; Knutti, D.; Cardenas, J.; Podvinec, M.; Oakeley, E.J.; Kralli, A. The estrogen-related receptor alpha (ERRalpha) functions in PPARgamma coactivator 1alpha (PGC-1alpha)-induced mitochondrial biogenesis. Proc. Natl. Acad. Sci. USA 2004, 101, 6472–6477. [Google Scholar] [CrossRef]
- Larsson, N.G.; Wang, J.; Wilhelmsson, H.; Oldfors, A.; Rustin, P.; Lewandoski, M.; Barsh, G.S.; Clayton, D.A. Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat. Genet. 1998, 18, 231–236. [Google Scholar] [CrossRef]
- Scarpulla, R.C. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim. Biophys. Acta 2002, 1576, 1–14. [Google Scholar] [CrossRef]
- Scarpulla, R.C. Transcriptional activators and coactivators in the nuclear control of mitochondrial function in mammalian cells. Gene 2002, 286, 81–89. [Google Scholar] [CrossRef]
- Piccinin, E.; Villani, G.; Moschetta, A. Metabolic aspects in NAFLD, NASH and hepatocellular carcinoma: The role of PGC1 coactivators. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 160–174. [Google Scholar] [CrossRef]
- Finck, B.N.; Kelly, D.P. PGC-1 coactivators: Inducible regulators of energy metabolism in health and disease. J. Clin. Invest. 2006, 116, 615–622. [Google Scholar] [CrossRef]
- Leone, T.C.; Lehman, J.J.; Finck, B.N.; Schaeffer, P.J.; Wende, A.R.; Boudina, S.; Courtois, M.; Wozniak, D.F.; Sambandam, N.; Bernal-Mizrachi, C.; et al. PGC-1alpha deficiency causes multi-system energy metabolic derangements: Muscle dysfunction, abnormal weight control and hepatic steatosis. PLoS Biol. 2005, 3, e101. [Google Scholar]
- Yoon, J.C.; Puigserver, P.; Chen, G.; Donovan, J.; Wu, Z.; Rhee, J.; Adelmant, G.; Stafford, J.; Kahn, C.R.; Granner, D.K.; et al. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 2001, 413, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Herzig, S.; Long, F.; Jhala, U.S.; Hedrick, S.; Quinn, R.; Bauer, A.; Rudolph, D.; Schutz, G.; Yoon, C.; Puigserver, P.; et al. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 2001, 413, 179–183. [Google Scholar] [CrossRef] [PubMed]
- Puigserver, P.; Rhee, J.; Donovan, J.; Walkey, C.J.; Yoon, J.C.; Oriente, F.; Kitamura, Y.; Altomonte, J.; Dong, H.; Accili, D.; et al. Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature 2003, 423, 550–555. [Google Scholar] [CrossRef] [PubMed]
- Rhee, J.; Inoue, Y.; Yoon, J.C.; Puigserver, P.; Fan, M.; Gonzalez, F.J.; Spiegelman, B.M. Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): Requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. USA 2003, 100, 4012–4017. [Google Scholar] [CrossRef]
- Lin, J.; Yang, R.; Tarr, P.T.; Wu, P.H.; Handschin, C.; Li, S.; Yang, W.; Pei, L.; Uldry, M.; Tontonoz, P.; et al. Hyperlipidemic effects of dietary saturated fats mediated through PGC-1beta coactivation of SREBP. Cell 2005, 120, 261–273. [Google Scholar] [CrossRef]
- Monsalve, M.; Wu, Z.; Adelmant, G.; Puigserver, P.; Fan, M.; Spiegelman, B.M. Direct coupling of transcription and mRNA processing through the thermogenic coactivator PGC-1. Mol. Cell 2000, 6, 307–316. [Google Scholar] [CrossRef]
- Puigserver, P.; Adelmant, G.; Wu, Z.; Fan, M.; Xu, J.; O’Malley, B.; Spiegelman, B.M. Activation of PPARgamma coactivator-1 through transcription factor docking. Science 1999, 286, 1368–1371. [Google Scholar] [CrossRef]
- Wallberg, A.E.; Yamamura, S.; Malik, S.; Spiegelman, B.M.; Roeder, R.G. Coordination of p300-mediated chromatin remodeling and TRAP/mediator function through coactivator PGC-1alpha. Mol. Cell 2003, 12, 1137–1149. [Google Scholar] [CrossRef]
- Li, S.; Liu, C.; Li, N.; Hao, T.; Han, T.; Hill, D.E.; Vidal, M.; Lin, J.D. Genome-wide coactivation analysis of PGC-1alpha identifies BAF60a as a regulator of hepatic lipid metabolism. Cell Metab. 2008, 8, 105–117. [Google Scholar] [CrossRef]
- Borgius, L.J.; Steffensen, K.R.; Gustafsson, J.A.; Treuter, E. Glucocorticoid signaling is perturbed by the atypical orphan receptor and corepressor SHP. J. Biol. Chem. 2002, 277, 49761–49766. [Google Scholar] [CrossRef]
- Kressler, D.; Schreiber, S.N.; Knutti, D.; Kralli, A. The PGC-1-related protein PERC is a selective coactivator of estrogen receptor alpha. J. Biol. Chem. 2002, 277, 13918–13925. [Google Scholar] [CrossRef]
- Lerin, C.; Rodgers, J.T.; Kalume, D.E.; Kim, S.H.; Pandey, A.; Puigserver, P. GCN5 acetyltransferase complex controls glucose metabolism through transcriptional repression of PGC-1alpha. Cell Metab. 2006, 3, 429–438. [Google Scholar] [CrossRef] [PubMed]
- Kelly, T.J.; Lerin, C.; Haas, W.; Gygi, S.P.; Puigserver, P. GCN5-mediated transcriptional control of the metabolic coactivator PGC-1beta through lysine acetylation. J. Biol. Chem. 2009, 284, 19945–19952. [Google Scholar] [CrossRef] [PubMed]
- Rodgers, J.T.; Lerin, C.; Haas, W.; Gygi, S.P.; Spiegelman, B.M.; Puigserver, P. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 2005, 434, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Marcos, P.J.; Auwerx, J. Regulation of PGC-1alpha, a nodal regulator of mitochondrial biogenesis. Am. J. Clin. Nutr. 2011, 93, S884–S890. [Google Scholar] [CrossRef] [PubMed]
- Irrcher, I.; Ljubicic, V.; Kirwan, A.F.; Hood, D.A. AMP-activated protein kinase-regulated activation of the PGC-1alpha promoter in skeletal muscle cells. PLoS ONE 2008, 3, e3614. [Google Scholar] [CrossRef]
- Puigserver, P.; Rhee, J.; Lin, J.; Wu, Z.; Yoon, J.C.; Zhang, C.Y.; Krauss, S.; Mootha, V.K.; Lowell, B.B.; Spiegelman, B.M. Cytokine stimulation of energy expenditure through p38 MAP kinase activation of PPARgamma coactivator-1. Mol. Cell 2001, 8, 971–982. [Google Scholar] [CrossRef]
- Jager, S.; Handschin, C.; St-Pierre, J.; Spiegelman, B.M. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc. Natl. Acad. Sci. USA 2007, 104, 12017–12022. [Google Scholar] [CrossRef]
- Canto, C.; Gerhart-Hines, Z.; Feige, J.N.; Lagouge, M.; Noriega, L.; Milne, J.C.; Elliott, P.J.; Puigserver, P.; Auwerx, J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 2009, 458, 1056–1060. [Google Scholar] [CrossRef]
- Li, X.; Monks, B.; Ge, Q.; Birnbaum, M.J. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1alpha transcription coactivator. Nature 2007, 447, 1012–1016. [Google Scholar] [CrossRef]
- Rodgers, J.T.; Haas, W.; Gygi, S.P.; Puigserver, P. Cdc2-like kinase 2 is an insulin-regulated suppressor of hepatic gluconeogenesis. Cell Metab 2010, 11, 23–34. [Google Scholar] [CrossRef] [PubMed]
- Anderson, R.M.; Barger, J.L.; Edwards, M.G.; Braun, K.H.; O’Connor, C.E.; Prolla, T.A.; Weindruch, R. Dynamic regulation of PGC-1alpha localization and turnover implicates mitochondrial adaptation in calorie restriction and the stress response. Aging Cell 2008, 7, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Teyssier, C.; Ma, H.; Emter, R.; Kralli, A.; Stallcup, M.R. Activation of nuclear receptor coactivator PGC-1alpha by arginine methylation. Genes Dev. 2005, 19, 1466–1473. [Google Scholar] [CrossRef] [PubMed]
- Fujita, H.; Yagishita, N.; Aratani, S.; Saito-Fujita, T.; Morota, S.; Yamano, Y.; Hansson, M.J.; Inazu, M.; Kokuba, H.; Sudo, K.; et al. The E3 ligase synoviolin controls body weight and mitochondrial biogenesis through negative regulation of PGC-1beta. EMBO J. 2015, 34, 1042–1055. [Google Scholar] [CrossRef]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 834–854. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Rottiers, V.; Naar, A.M. MicroRNAs in metabolism and metabolic disorders. Nat. Rev. Mol. Cell Biol. 2012, 13, 239–250. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef]
- Krol, J.; Loedige, I.; Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet. 2010, 11, 597–610. [Google Scholar] [CrossRef]
- Pauli, A.; Rinn, J.L.; Schier, A.F. Non-coding RNAs as regulators of embryogenesis. Nat. Rev. Genet. 2011, 12, 136–149. [Google Scholar] [CrossRef]
- Wang, X.W.; Heegaard, N.H.; Orum, H. MicroRNAs in liver disease. Gastroenterology 2012, 142, 1431–1443. [Google Scholar] [CrossRef] [PubMed]
- Krutzfeldt, J.; Rajewsky, N.; Braich, R.; Rajeev, K.G.; Tuschl, T.; Manoharan, M.; Stoffel, M. Silencing of microRNAs in vivo with ‘antagomirs’. Nature 2005, 438, 685–689. [Google Scholar] [CrossRef] [PubMed]
- Esau, C.; Davis, S.; Murray, S.F.; Yu, X.X.; Pandey, S.K.; Pear, M.; Watts, L.; Booten, S.L.; Graham, M.; McKay, R.; et al. miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab 2006, 3, 87–98. [Google Scholar] [CrossRef] [PubMed]
- Cheung, O.; Puri, P.; Eicken, C.; Contos, M.J.; Mirshahi, F.; Maher, J.W.; Kellum, J.M.; Min, H.; Luketic, V.A.; Sanyal, A.J. Nonalcoholic steatohepatitis is associated with altered hepatic MicroRNA expression. Hepatology 2008, 48, 1810–1820. [Google Scholar] [CrossRef] [PubMed]
- Hsu, S.H.; Wang, B.; Kota, J.; Yu, J.; Costinean, S.; Kutay, H.; Yu, L.; Bai, S.; La Perle, K.; Chivukula, R.R.; et al. Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver. J. Clin. Investig. 2012, 122, 2871–2883. [Google Scholar] [CrossRef] [PubMed]
- Tsai, W.C.; Hsu, S.D.; Hsu, C.S.; Lai, T.C.; Chen, S.J.; Shen, R.; Huang, Y.; Chen, H.C.; Lee, C.H.; Tsai, T.F.; et al. MicroRNA-122 plays a critical role in liver homeostasis and hepatocarcinogenesis. J. Clin. Investig. 2012, 122, 2884–2897. [Google Scholar] [CrossRef]
- Bala, S.; Petrasek, J.; Mundkur, S.; Catalano, D.; Levin, I.; Ward, J.; Alao, H.; Kodys, K.; Szabo, G. Circulating microRNAs in exosomes indicate hepatocyte injury and inflammation in alcoholic, drug-induced, and inflammatory liver diseases. Hepatology 2012, 56, 1946–1957. [Google Scholar] [CrossRef]
- Xue, Y.; Wei, Z.; Ding, H.; Wang, Q.; Zhou, Z.; Zheng, S.; Zhang, Y.; Hou, D.; Liu, Y.; Zen, K.; et al. MicroRNA-19b/221/222 induces endothelial cell dysfunction via suppression of PGC-1alpha in the progression of atherosclerosis. Atherosclerosis 2015, 241, 671–681. [Google Scholar] [CrossRef]
- Sun, L.Y.; Wang, N.; Ban, T.; Sun, Y.H.; Han, Y.; Sun, L.L.; Yan, Y.; Kang, X.H.; Chen, S.; Sun, L.H.; et al. MicroRNA-23a mediates mitochondrial compromise in estrogen deficiency-induced concentric remodeling via targeting PGC-1alpha. J. Mol. Cell. Cardiol. 2014, 75, 1–11. [Google Scholar] [CrossRef]
- Wang, B.; Hsu, S.H.; Frankel, W.; Ghoshal, K.; Jacob, S.T. Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. Hepatology 2012, 56, 186–197. [Google Scholar] [CrossRef]
- Liang, J.; Liu, C.; Qiao, A.; Cui, Y.; Zhang, H.; Cui, A.; Zhang, S.; Yang, Y.; Xiao, X.; Chen, Y.; et al. MicroRNA-29a-c decrease fasting blood glucose levels by negatively regulating hepatic gluconeogenesis. J. Hepatol. 2013, 58, 535–542. [Google Scholar] [CrossRef]
- Aoi, W.; Naito, Y.; Mizushima, K.; Takanami, Y.; Kawai, Y.; Ichikawa, H.; Yoshikawa, T. The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal muscle in response to physical activity. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E799–E806. [Google Scholar] [CrossRef]
- Fang, Z.; Li, P.; Jia, W.; Jiang, T.; Wang, Z.; Xiang, Y. miR-696 plays a role in hepatic gluconeogenesis in ob/ob mice by targeting PGC-1alpha. Int. J. Mol. Med. 2016, 38, 845–852. [Google Scholar] [CrossRef]
- Lee, J.; Padhye, A.; Sharma, A.; Song, G.; Miao, J.; Mo, Y.Y.; Wang, L.; Kemper, J.K. A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibition. J. Biol. Chem. 2010, 285, 12604–12611. [Google Scholar] [CrossRef]
- Fu, T.; Seok, S.; Choi, S.; Huang, Z.; Suino-Powell, K.; Xu, H.E.; Kemper, B.; Kemper, J.K. MicroRNA 34a inhibits beige and brown fat formation in obesity in part by suppressing adipocyte fibroblast growth factor 21 signaling and SIRT1 function. Mol. Cell. Biol. 2014, 34, 4130–4142. [Google Scholar] [CrossRef]
- Lavery, C.A.; Kurowska-Stolarska, M.; Holmes, W.M.; Donnelly, I.; Caslake, M.; Collier, A.; Baker, A.H.; Miller, A.M. miR-34a(-/-) mice are susceptible to diet-induced obesity. Obesity 2016, 24, 1741–1751. [Google Scholar] [CrossRef]
- Lin, J.; Wu, P.H.; Tarr, P.T.; Lindenberg, K.S.; St-Pierre, J.; Zhang, C.Y.; Mootha, V.K.; Jager, S.; Vianna, C.R.; Reznick, R.M.; et al. Defects in adaptive energy metabolism with CNS-linked hyperactivity in PGC-1alpha null mice. Cell 2004, 119, 121–135. [Google Scholar] [CrossRef]
- Chen, S.; Wen, X.; Zhang, W.; Wang, C.; Liu, J.; Liu, C. Hypolipidemic effect of oleanolic acid is mediated by the miR-98-5p/PGC-1beta axis in high-fat diet-induced hyperlipidemic mice. Faseb J: Off. Publ. Fed. Am. Soc. Exp. Biol. 2017, 31, 1085–1096. [Google Scholar] [CrossRef]
- Ma, L.; Qiu, H.; Chen, Z.; Li, L.; Zeng, Y.; Luo, J.; Gou, D. miR-25 modulates triacylglycerol and lipid accumulation in goat mammary epithelial cells by repressing PGC-1beta. J. Anim. Sci. Biotechnol. 2018, 9, 48. [Google Scholar] [CrossRef]
- Eichner, L.J.; Perry, M.C.; Dufour, C.R.; Bertos, N.; Park, M.; St-Pierre, J.; Giguere, V. miR-378( *) mediates metabolic shift in breast cancer cells via the PGC-1beta/ERRgamma transcriptional pathway. Cell Metab. 2010, 12, 352–361. [Google Scholar] [CrossRef]
- Carrer, M.; Liu, N.; Grueter, C.E.; Williams, A.H.; Frisard, M.I.; Hulver, M.W.; Bassel-Duby, R.; Olson, E.N. Control of mitochondrial metabolism and systemic energy homeostasis by microRNAs 378 and 378*. Proc. Natl. Acad. Sci. USA 2012, 109, 15330–15335. [Google Scholar] [CrossRef]
- Delic, D.; Dkhil, M.; Al-Quraishy, S.; Wunderlich, F. Hepatic miRNA expression reprogrammed by Plasmodium chabaudi malaria. Parasitol. Res. 2011, 108, 1111–1121. [Google Scholar] [CrossRef]
- Mou, T.; Xie, F.; Zhong, P.; Hua, H.; Lai, L.; Yang, Q.; Wang, J. MiR-345-5p functions as a tumor suppressor in pancreatic cancer by directly targeting CCL8. Biomed. Pharmacother. Biomed. Pharmacother. 2019, 111, 891–900. [Google Scholar] [CrossRef]
- Ying, X.; Zhang, W.; Fang, M.; Zhang, W.; Wang, C.; Han, L. miR-345-5p regulates proliferation, cell cycle, and apoptosis of acute myeloid leukemia cells by targeting AKT2. J. Cell. Biochem. 2018. [Google Scholar] [CrossRef]
- Tinay, I.; Tan, M.; Gui, B.; Werner, L.; Kibel, A.S.; Jia, L. Functional roles and potential clinical application of miRNA-345-5p in prostate cancer. Prostate 2018, 78, 927–937. [Google Scholar] [CrossRef]
- Yu, J.; Zhang, B.; Zhang, H.; Qi, Y.; Wang, Y.; Wang, W.; Wang, Y.; Wang, Y. E2F1-induced upregulation of long non-coding RNA LMCD1-AS1 facilitates cholangiocarcinoma cell progression by regulating miR-345-5p/COL6A3 pathway. Biochem. Biophys. Res. Commun. 2019, 512, 150–155. [Google Scholar] [CrossRef]
- Chen, W.; Zhao, W.; Yang, A.; Xu, A.; Wang, H.; Cong, M.; Liu, T.; Wang, P.; You, H. Integrated analysis of microRNA and gene expression profiles reveals a functional regulatory module associated with liver fibrosis. Gene 2017, 636, 87–95. [Google Scholar] [CrossRef]
- Erener, S.; Marwaha, A.; Tan, R.; Panagiotopoulos, C.; Kieffer, T.J. Profiling of circulating microRNAs in children with recent onset of type 1 diabetes. JCI Insight 2017, 2, e89656. [Google Scholar] [CrossRef]
- Kirchmeyer, M.; Servais, F.A.; Hamdorf, M.; Nazarov, P.V.; Ginolhac, A.; Halder, R.; Vallar, L.; Glanemann, M.; Rubie, C.; Lammert, F.; et al. Cytokine-mediated modulation of the hepatic miRNome: miR-146b-5p is an IL-6-inducible miRNA with multiple targets. J. Leukoc. Biol. 2018, 104, 987–1002. [Google Scholar] [CrossRef]
- Jiang, W.; Ni, Q.; Tan, L.; Kong, L.; Lu, Y.; Xu, X.; Kong, L. The microRNA-146a/b attenuates acute small-for-size liver graft injury in rats. Liver Int. Off. J. Int. Assoc. Study Liver 2015, 35, 914–924. [Google Scholar] [CrossRef]
- Jiang, W.; Liu, J.; Dai, Y.; Zhou, N.; Ji, C.; Li, X. MiR-146b attenuates high-fat diet-induced non-alcoholic steatohepatitis in mice. J. Gastroenterol. Hepatol. 2015, 30, 933–943. [Google Scholar] [CrossRef]
- He, S.; Guo, W.; Deng, F.; Chen, K.; Jiang, Y.; Dong, M.; Peng, L.; Chen, X. Targeted delivery of microRNA 146b mimic to hepatocytes by lactosylated PDMAEMA nanoparticles for the treatment of NAFLD. Artif. CellsNanomed. Biotechnol. 2018, 46 (Suppl. S2), 217–228. [Google Scholar] [CrossRef]
- Celikbilek, M.; Baskol, M.; Taheri, S.; Deniz, K.; Dogan, S.; Zararsiz, G.; Gursoy, S.; Guven, K.; Ozbakir, O.; Dundar, M.; et al. Circulating microRNAs in patients with non-alcoholic fatty liver disease. World J. Hepatol. 2014, 6, 613–620. [Google Scholar] [CrossRef]
- Feng, Y.Y.; Xu, X.Q.; Ji, C.B.; Shi, C.M.; Guo, X.R.; Fu, J.F. Aberrant hepatic microRNA expression in nonalcoholic fatty liver disease. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2014, 34, 1983–1997. [Google Scholar] [CrossRef]
- Xia, S.F.; Duan, X.M.; Cheng, X.R.; Chen, L.M.; Kang, Y.J.; Wang, P.; Tang, X.; Shi, Y.H.; Le, G.W. Role of miR-383 and miR-146b in different propensities to obesity in male mice. J. Endocrinol. 2017, 234, 201–216. [Google Scholar] [CrossRef]
- Latorre, J.; Moreno-Navarrete, J.M.; Mercader, J.M.; Sabater, M.; Rovira, O.; Girones, J.; Ricart, W.; Fernandez-Real, J.M.; Ortega, F.J. Decreased lipid metabolism but increased FA biosynthesis are coupled with changes in liver microRNAs in obese subjects with NAFLD. Int. J. Obes. 2017, 41, 620–630. [Google Scholar] [CrossRef]
- Li, C.; Miao, R.; Liu, S.; Wan, Y.; Zhang, S.; Deng, Y.; Bi, J.; Qu, K.; Zhang, J.; Liu, C. Down-regulation of miR-146b-5p by long noncoding RNA MALAT1 in hepatocellular carcinoma promotes cancer growth and metastasis. Oncotarget 2017, 8, 28683–28695. [Google Scholar] [CrossRef]
- Han, H.S.; Choi, B.H.; Kim, J.S.; Kang, G.; Koo, S.H. Hepatic Crtc2 controls whole body energy metabolism via a miR-34a-Fgf21 axis. Nat. Commun. 2017, 8, 1878. [Google Scholar] [CrossRef]
- Le Lay, J.; Tuteja, G.; White, P.; Dhir, R.; Ahima, R.; Kaestner, K.H. CRTC2 (TORC2) contributes to the transcriptional response to fasting in the liver but is not required for the maintenance of glucose homeostasis. Cell Metab 2009, 10, 55–62. [Google Scholar] [CrossRef]
- Tian, X.F.; Ji, F.J.; Zang, H.L.; Cao, H. Activation of the miR-34a/SIRT1/p53 Signaling Pathway Contributes to the Progress of Liver Fibrosis via Inducing Apoptosis in Hepatocytes but Not in HSCs. PLoS ONE 2016, 11, e0158657. [Google Scholar] [CrossRef]
- Castro, R.E.; Ferreira, D.M.; Afonso, M.B.; Borralho, P.M.; Machado, M.V.; Cortez-Pinto, H.; Rodrigues, C.M. miR-34a/SIRT1/p53 is suppressed by ursodeoxycholic acid in the rat liver and activated by disease severity in human non-alcoholic fatty liver disease. J. Hepatol. 2013, 58, 119–125. [Google Scholar] [CrossRef]
- Min, H.K.; Kapoor, A.; Fuchs, M.; Mirshahi, F.; Zhou, H.; Maher, J.; Kellum, J.; Warnick, R.; Contos, M.J.; Sanyal, A.J. Increased hepatic synthesis and dysregulation of cholesterol metabolism is associated with the severity of nonalcoholic fatty liver disease. Cell Metab. 2012, 15, 665–674. [Google Scholar] [CrossRef]
- Xu, X.; Chen, W.; Miao, R.; Zhou, Y.; Wang, Z.; Zhang, L.; Wan, Y.; Dong, Y.; Qu, K.; Liu, C. miR-34a induces cellular senescence via modulation of telomerase activity in human hepatocellular carcinoma by targeting FoxM1/c-Myc pathway. Oncotarget 2015, 6, 3988–4004. [Google Scholar] [CrossRef]
- Ding, J.; Li, M.; Wan, X.; Jin, X.; Chen, S.; Yu, C.; Li, Y. Effect of miR-34a in regulating steatosis by targeting PPARalpha expression in nonalcoholic fatty liver disease. Sci. Rep. 2015, 5, 13729. [Google Scholar] [CrossRef]
- Wen, F.; An, C.; Wu, X.; Yang, Y.; Xu, J.; Liu, Y.; Wang, C.; Nie, L.; Fang, H.; Yang, Z. MiR-34a regulates mitochondrial content and fat ectopic deposition induced by resistin through the AMPK/PPARalpha pathway in HepG2 cells. Int. J. Biochem. Cell Biol. 2018, 94, 133–145. [Google Scholar] [CrossRef]
- Wan, Y.; McDaniel, K.; Wu, N.; Ramos-Lorenzo, S.; Glaser, T.; Venter, J.; Francis, H.; Kennedy, L.; Sato, K.; Zhou, T.; et al. Regulation of cellular senescence by miR-34a in alcoholic liver injury. Am. J. Pathol. 2017, 187, 2788–2798. [Google Scholar] [CrossRef]
- Iwagami, Y.; Zou, J.; Zhang, H.; Cao, K.; Ji, C.; Kim, M.; Huang, C.K. Alcohol-mediated miR-34a modulates hepatocyte growth and apoptosis. J. Cell. Mol. Med. 2018. [Google Scholar] [CrossRef]
- Woollett, L.A.; Buckley, D.D.; Yao, L.; Jones, P.J.; Granholm, N.A.; Tolley, E.A.; Heubi, J.E. Effect of ursodeoxycholic acid on cholesterol absorption and metabolism in humans. J. Lipid Res. 2003, 44, 935–942. [Google Scholar] [CrossRef]
- Fu, T.; Choi, S.E.; Kim, D.H.; Seok, S.; Suino-Powell, K.M.; Xu, H.E.; Kemper, J.K. Aberrantly elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor beta-Klotho. Proc. Natl. Acad. Sci. USA 2012, 109, 16137–16142. [Google Scholar] [CrossRef]
- Shin, D.J.; Campos, J.A.; Gil, G.; Osborne, T.F. PGC-1alpha activates CYP7A1 and bile acid biosynthesis. J. Biol. Chem. 2003, 278, 50047–50052. [Google Scholar] [CrossRef]
- Wei, W.; Tang, H.; Tang, L. MicroRNA-34a inhibits metastasis in liver cancer cells. Oncol. Lett. 2018, 16, 6960–6965. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Zhang, D.; Wu, W.; Wu, S.; Qian, J.; Hao, Y.; Yan, F.; Zhu, P.; Wu, J.; Huang, G.; et al. Mesenchymal Stem Cells Promote Hepatocarcinogenesis via lncRNA-MUF Interaction with ANXA2 and miR-34a. Cancer Res. 2017, 77, 6704–6716. [Google Scholar] [CrossRef]
- Bellafante, E.; Murzilli, S.; Salvatore, L.; Latorre, D.; Villani, G.; Moschetta, A. Hepatic-specific activation of peroxisome proliferator-activated receptor gamma coactivator-1beta protects against steatohepatitis. Hepatology 2013, 57, 1343–1356. [Google Scholar] [CrossRef] [PubMed]
- Piccinin, E.; Peres, C.; Bellafante, E.; Ducheix, S.; Pinto, C.; Villani, G.; Moschetta, A. Hepatic peroxisome proliferator-activated receptor gamma coactivator 1beta drives mitochondrial and anabolic signatures that contribute to hepatocellular carcinoma progression in mice. Hepatology 2018, 67, 884–898. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Song, C.; Zhou, X.; Han, X.; Li, J.; Wang, Z.; Shang, H.; Liu, Y.; Cao, H. Mitochondria Associated MicroRNA Expression Profiling of Heart Failure. Biomed. Res. Int. 2017, 2017, 4042509. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Kang, Y.; Ning, L.; Tan, J.; Wang, H.; Ying, Y. Identification of microRNAs involved in gefitinib resistance of non-small-cell lung cancer through the insulin-like growth factor receptor 1 signaling pathway. Exp. Ther. Med. 2017, 14, 2853–2862. [Google Scholar] [CrossRef]
- Chen, W.; Han, C.; Zhang, J.; Song, K.; Wang, Y.; Wu, T. miR-150 Deficiency Protects against FAS-Induced Acute Liver Injury in Mice through Regulation of AKT. PLoS ONE 2015, 10, e0132734. [Google Scholar] [CrossRef]
- Zhuge, B.; Li, G. MiR-150 deficiency ameliorated hepatosteatosis and insulin resistance in nonalcoholic fatty liver disease via targeting CASP8 and FADD-like apoptosis regulator. Biochem. Biophys. Res. Commun. 2017, 494, 687–692. [Google Scholar] [CrossRef]
- Heindryckx, F.; Binet, F.; Ponticos, M.; Rombouts, K.; Lau, J.; Kreuger, J.; Gerwins, P. Endoplasmic reticulum stress enhances fibrosis through IRE1alpha-mediated degradation of miR-150 and XBP-1 splicing. EMBO Mol. Med. 2016, 8, 729–744. [Google Scholar] [CrossRef]
- Zheng, J.; Lin, Z.; Dong, P.; Lu, Z.; Gao, S.; Chen, X.; Wu, C.; Yu, F. Activation of hepatic stellate cells is suppressed by microRNA-150. Int. J. Mol. Med. 2013, 32, 17–24. [Google Scholar] [CrossRef]
- Li, T.; Xie, J.; Shen, C.; Cheng, D.; Shi, Y.; Wu, Z.; Zhan, Q.; Deng, X.; Chen, H.; Shen, B.; et al. miR-150-5p inhibits hepatoma cell migration and invasion by targeting MMP14. PLoS ONE 2014, 9, e115577. [Google Scholar] [CrossRef]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. Elife 2015, 4. [Google Scholar] [CrossRef]
- Chen, E.Y.; Tan, C.M.; Kou, Y.; Duan, Q.; Wang, Z.; Meirelles, G.V.; Clark, N.R.; Ma’ayan, A. Enrichr: Interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinform. 2013, 14, 128. [Google Scholar] [CrossRef]
- Kuleshov, M.V.; Jones, M.R.; Rouillard, A.D.; Fernandez, N.F.; Duan, Q.; Wang, Z.; Koplev, S.; Jenkins, S.L.; Jagodnik, K.M.; Lachmann, A.; et al. Enrichr: A comprehensive gene set enrichment analysis web server 2016 update. Nucleic. Acids Res. 2016, 44, W90–W97. [Google Scholar] [CrossRef]




| miRNA | Sequence | Location | Proximal Gene | Association with Pgc-1 |
|---|---|---|---|---|
| mmu-miR-30c-1 | cugggagaggguuguuuacucc | chr4: 120769534-120769622 | Inside Nfyc gene | Nfyc is a Pgc-1α target in striatal |
| mmu-miR-677 | uucagugaugauuagcuucuga | chr10: 128085286-128085363 | Inside Atp5b | Atp5p is a Pgc-1s target |
| mmu-miR-345-5p | gcugaccccuaguccagugcuu | chr12: 108836973-108837068 | Downstream to Yy1 | Yy1 is regulated by and regulates Pgc-1s |
| mmu-miR-345-3p | ccugaacuaggggucuggagac | chr12: 108836973-108837068 | Downstream to Yy1 | Yy1 is regulated by and regulates Pgc-1s |
| mmu-miR-146b | ugagaacugaauuccauaggcu | chr19: 46342762-46342870 | Downstream to Elovl3 and Nfkb2 | Elovl3 is a PPARα target |
| mmu-miR-34a | uggcagugucuuagcugguugu | chr4: 150068454-150068555 | Downstream to Gm13067 | No information available |
| mmu-miR-150 | ucucccaacccuuguaccagug | chr7: 45121757-45121821 | Downstream to Nosip and Prmt1 | Pgc-1s promote eNos expression, which in turn interact with Nosip. Prmt1 regulates Pgc-1s. |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Piccinin, E.; Arconzo, M.; Graziano, G.; Vacca, M.; Peres, C.; Bellafante, E.; Villani, G.; Moschetta, A. Hepatic MicroRNA Expression by PGC-1α and PGC-1β in the Mouse. Int. J. Mol. Sci. 2019, 20, 5735. https://doi.org/10.3390/ijms20225735
Piccinin E, Arconzo M, Graziano G, Vacca M, Peres C, Bellafante E, Villani G, Moschetta A. Hepatic MicroRNA Expression by PGC-1α and PGC-1β in the Mouse. International Journal of Molecular Sciences. 2019; 20(22):5735. https://doi.org/10.3390/ijms20225735
Chicago/Turabian StylePiccinin, Elena, Maria Arconzo, Giusi Graziano, Michele Vacca, Claudia Peres, Elena Bellafante, Gaetano Villani, and Antonio Moschetta. 2019. "Hepatic MicroRNA Expression by PGC-1α and PGC-1β in the Mouse" International Journal of Molecular Sciences 20, no. 22: 5735. https://doi.org/10.3390/ijms20225735
APA StylePiccinin, E., Arconzo, M., Graziano, G., Vacca, M., Peres, C., Bellafante, E., Villani, G., & Moschetta, A. (2019). Hepatic MicroRNA Expression by PGC-1α and PGC-1β in the Mouse. International Journal of Molecular Sciences, 20(22), 5735. https://doi.org/10.3390/ijms20225735

