Hydrogen Sulfide Attenuates Hydrogen Peroxide-Induced Injury in Human Lung Epithelial A549 Cells

Abstract

Lung tissues are frequently exposed to a hyperoxia environment, which leads to oxidative stress injuries. Hydrogen sulfide (H₂S) is widely implicated in physiological and pathological processes and its antioxidant effect has attracted much attention. Therefore, in this study, we used hydrogen peroxide (H₂O₂) as an oxidative damage model to investigate the protective mechanism of H₂S in lung injury. Cell death induced by H₂O₂ treatment could be significantly attenuated by the pre-treatment of H₂S, resulting in a decrease in the Bax/Bcl-2 ratio and the inhibition of caspase-3 activity in human lung epithelial cell line A549 cells. Additionally, the results showed that H₂S decreased reactive oxygen species (ROS), as well as neutralized the damaging effects of H₂O₂ in mitochondria energy-producing and cell metabolism. Pre-treatment of H₂S also decreased H₂O₂-induced suppression of endogenous H₂S production enzymes, cystathionine-beta-synthase (CBS), cystathionine-gamma-lyase (CSE), and 3-mercapto-pyruvate sulfurtransferase (MPST). Furthermore, the administration of H₂S attenuated [Ca²⁺] overload and endoplasmic reticulum (ER) stress through the mitogen-activated protein kinase (MAPK) signaling pathway. Therefore, H₂S might be a potential therapeutic agent for reducing ROS and ER stress-associated apoptosis against H₂O₂-induced lung injury.

1. Introduction

Hydrogen sulfide (H₂S) is a poisonous, flammable gas, with the smell of rotten eggs, and is simply regarded as an environmental pollutant [1]. Recently, H₂S has been considered the third signaling gasotransmitter, accompanying nitric oxide and carbon monoxide, due to its multiple functions in physiological and pathological processes [2,3]. Studies have shown that H₂S participates in cardiovascular remodeling, cell proliferation, migration and invasion, oxidative stress, and inflammation [4,5,6]. Endogenous H₂S is mainly produced from L-cysteine via reactions catalyzed by three enzymes: cystathionine-beta-synthase (CBS), cystathionine-gamma-lyase (CSE), and 3-mercapto-pyruvate sulfurtransferase (MPST) [7,8]. Recent reports have shown that a multitude of H₂S-releasing small-molecule drugs, such as H₂S-hybrid nonsteroidal anti-inflammatory drugs (HS-NSAIDS), showed a significant reduction of gastrointestinal damage compared to the parent NSAIDS [9,10].

The lung is the most important respiratory organ involved in gas exchange that is frequently in contact with the ambient air, including nitrogen dioxide, sulfur dioxide, ozone, cigarette smoke, and diesel exhaust [11,12]. Exposure to a hyperoxia environment increases the intracellular production of reactive oxygen species (ROS) [13]. Meanwhile, a large amount of superoxide anions caused by viral infection, drugs, or surgery also results in oxidative stress injuries [14,15,16]. ROS induces structural and functional abnormalities in the mitochondrial electron transport chain, and the imbalance between antioxidants and oxidants can cause cell injury and even death [17,18]. Therefore, ROS is the basis of many lung diseases.

The endoplasmic reticulum (ER) is an organelle responsible for the synthesis, folding, assembly, and modification of proteins [19]. In pathological conditions, ER dysfunction and calcium dyshomeostasis lead to an excessive accumulation of unfolded or misfolded proteins, which induces ER stress [20]. A growing number of studies have suggested that ER stress plays critical roles in many physiological and pathological processes, including allergy and inflammation, Alzheimer’s disease, cardiovascular disease, and obesity [21,22,23,24]. ER stress is also a common cause of lung diseases, indicating that a misfolded protein may be an important unifying mechanism in pulmonary fibrosis and even lung cancer [25].

Our previous study found that sodium hydrosulfide (NaHS), as the exogenous H₂S donor, regulated the cell proliferation and angiogenesis of A549 cells. Despite its function in tumor growth, the effects of H₂S on ER stress in the human lung epithelial cell line A549 remain to be elucidated. In the present study, hydrogen peroxide (H₂O₂) was chosen as the model of lung injury in vitro. We investigated whether H₂S protected A549 cells against oxidation-induced ER stress. In this paper, we present evidence that ER stress contributed to H₂O₂-induced apoptosis in human lung epithelial cells via the MAPK signaling pathway. Our research provides a novel treatment of oxidative-related diseases with H₂S.

2. Results

2.1. Protective Effect of H₂S on Human Lung Epithelial Cells against H₂O₂-Induced Apoptosis

As shown in Figure 1A, different concentrations of NaHS were added to the culture medium of human lung epithelial cells for 12 h. Cell activities increased most obviously in 50 μM NaHS treatment. A549 cells were then incubated with different concentrations of H₂O₂ for 12 h, and the half maximal inhibitory concentration (IC₅₀) was 60.25 mM (Figure 1B). Therefore, the concentration of 60 mM was chosen for the model of H₂O₂-induced lung injury. The cell state in the H₂S + H₂O₂ group was better than that in the H₂O₂ group under an optical microscope (Figure 1E). To further determine whether H₂S had a protective effect on H₂O₂-induced apoptosis, A549 cells were pre-treated with H₂S for 2 h and then subjected to H₂O₂. As shown in Figure 1C, H₂S obviously reduced H₂O₂ cytotoxicity. The flow cytometric analysis confirmed that the cell apoptosis rate in the H₂S pre-treatment group was significantly decreased compared with that in the H₂O₂ group (Figure 1D). A colony formation assay indicated that the A549 cells in the H₂O₂ group were barely forming clones. With pre-treatment of H₂S, A549 cells could form a few clones (Figure 1E). The expression of apoptosis genes was further examined. Compared to the untreated cells, A549 cells expressed more cleaved-caspase 3 when treated with H₂O₂. Meanwhile, the activity of caspase 3 was decreased in the protection group compared with the injury group (Figure 1F). The ratio of Bax and Bcl-2 mRNA expression was markedly decreased when pre-treated with H₂S compared to that in the H₂O₂ group. Western blot analysis was in agreement with the quantitative real-time PCR (qRT-PCR) results, showing that the protein expression of Bax was up-regulated and Bcl-2 was down-regulated in the H₂O₂ group. H₂S pre-treatment could decrease Bax expression and increase Bcl-2 expression (Figure 1G). These results indicated that H₂S reduced H₂O₂-induced injury in lung epithelial cells.

2.2. Protection Effect of H₂S on Reactive Oxygen Species Injury

Upon H₂O₂ treatment, a massive production of intracellular reactive oxygen species (ROS) was observed. However, ROS production could be suppressed by pre-treatment of H₂S (Figure 2A). Superoxide dismutase (SOD) and glutathione peroxidase (GSH-PX) are the main oxygen free radical scavengers [26]. Catalase (CAT) is involved in peroxide breakdown and malondialdehyde (MDA) is one of the final products of polyunsaturated acid peroxidation [27]. Therefore, we decided to test the activities of SOD, GSH-PX, and CAT, and the MDA production in A549 cells. Our data showed that SOD, GSH-PX, and CAT activities were decreased in the H₂O₂ group compared to the control group. However, these phenomena were completely reversed by H₂S pre-treatment (Figure 2B–D). As shown in Figure 2E, H₂O₂ obviously increased MDA production, while H₂S pre-treatment efficiently lowered the content of MDA. These findings suggested that H₂S could attenuate H₂O₂-induced oxidative stress in A549 cells.

2.3. H₂O₂ Suppressed Endogenous H₂S Production in A549 Cells

Endogenous H₂S production was measured to further determine the effects of oxidative stress induced by H₂O₂. The results showed that the rates of H₂S production were significantly increased with H₂S treatment, while blocked by H₂O₂ treatment (Figure 3A). Inhibitory functions of H₂O₂ were confirmed by qRT-PCR analysis, which demonstrated that H₂O₂ suppressed H₂S-producing enzymes CBS, CSE, and MPST expression (Figure 3B). Western blot analysis showed the same trend with the mRNA expression. H₂O₂ resulted in significant CBS, CSE, and MPST expression inhibition. However, pre-treatment of H₂S attenuated the reduction effect induced by H₂O₂ (Figure 3C,D). Therefore, we preliminarily determined that H₂O₂-induced oxidative injury was associated with endogenous H₂S-producing enzymes.

2.4. Effect of H₂S on H₂O₂ Injury A549 Cells in Mitochondrial Membrane Potential (Δψ) and Energy Metabolism

Mitochondrial function is highly susceptible to ROS injury, and the change in mitochondrial membrane potential (Δψ) is the sign of damage [28]. We investigated whether H₂S regulated Δψ change induced by H₂O₂. Mitochondria in the control group exhibited high Δψ, which showed red fluorescence. However, mitochondria showed less intense red fluorescence, but more intense green fluorescence, with H₂O₂ exposure. H₂S pre-treatment could improve the red fluorescence intensity, which illustrated that H₂S might prevent the loss of Δψ (Figure 4A). H₂O₂-induced mitochondrial function injury directly resulted in the reduction of the ATP output, while H₂S could increase ATP production (Figure 4B). With H₂O₂ treatment, the enzymatic activity of lactate dehydrogenase (LDH) was decreased compared to the control group (Figure 4C). Meanwhile, our results showed that H₂S accelerated the metabolic process, resulting in an increase of glucose consumption, lactic acid production, and pyruvate uptake (Figure 4D,F). These findings indicated that H₂O₂ decreased the mitochondrial membrane potential, as well as energy metabolism progress.

2.5. Effect of H₂S on ROS-Induced Intracellular [Ca²⁺] and Endoplasmic Reticulum Stress

The ER lumen is the main storage of [Ca²⁺], and ER dysfunction promotes the calcium output [20]. We first detected intracellular [Ca²⁺] with the Fluo-3, AM fluorescence probe, and the results showed that H₂S limited the [Ca²⁺] overload under H₂O₂ stress (Figure 5A). GRP78 and CHOP, the two main ER stress markers, were measured by western blot analysis. As shown in Figure 5B, H₂O₂ injury contributed to the overexpression of GRP78 and CHOP, but H₂S pre-treatment blocked these increases. We further investigated the effect of H₂S on the ER stress pathway. H₂O₂ stimulated the phosphorylation expression of IRE1 and eIF2α, and then up-regulated ATF4 and ATF6. However, H₂S significantly decreased the level of ATF6, but had a slight effect on p-IRE1, p-eIF2α, and ATF4. Therefore, we preliminarily determined that H₂O₂ caused calcium overload via ER stress.

2.6. Effect of H₂S on the Mitogen-Activated Protein Kinase (MAPK) Signaling Pathway in H₂O₂-Treated A549 Cells

ROS play a crucial part in cells via regulation of the MAPK signaling pathway [29]. Herein, phosphorylated levels of p38, ERK, JNK, and AKT were examined via western blot analysis to investigate whether H₂O₂ was involved in MAPK pathway activation. The results showed that the phosphorylation of p38 and ERK was up-regulated and the phosphorylation of AKT was suppressed by H₂O₂ treatment, compared with that in the control group. However, H₂S pre-treatment decreased the p-p38 and p-ERK, but had little effect on p-JNK expression (Figure 6A,B). Therefore, the results suggested that H₂S mediated H₂O₂-induced MAPK activation in A549 cells.

3. Discussion

Recently, a growing number of researches indicate that H₂S participates in the regulation of various physiological and pathological processes in the human body [5,30,31]. Our research found that 10–50 μM NaHS promoted cell proliferation. Therefore, the cyto-protective effect of H₂S could only be achieved at a low level of NaHS. The lung is susceptible to a hyperoxia environment, and excessive ROS production can damage the physiological functions of lung tissue, such as epithelial function, endothelial cells, and airway smooth muscle [32]. Therefore, preventing oxidative stress has become an important target for lung diseases. In this study, we investigated whether exogenous H₂S attenuated ROS-induced injury in human lung epithelial A549 cells. The results showed that H₂S protected A549 cells from H₂O₂-induced apoptosis, maintained the redox balance, and defended the oxidative stress. H₂S pre-treatment also preserved mitochondrial membrane potential, which was essential for ATP production and energy metabolism. Moreover, H₂S attenuated intracellular [Ca²⁺] and ER stress induced by ROS.

H₂O₂ is widely used to model the oxidative stress of mammalian cells. The cell morphology, survival rate, and expression of apoptosis-associated proteins were detected to ensure that the oxidative injury model was successfully established for the subsequent experiments. The results showed that the A549 cell survival rate was 53.72 ± 5.31% with stimulation of 60 mM H₂O₂, while the cell activity was increased by 17.75 ± 4.69% for the H₂O₂ group with 50 μM H₂S pre-treatment. Moreover, lactate dehydrogenase, which is located in the cytoplasm of normal cells, but is released into the cell culture medium when cells are injured, is a sensitive marker of cell damage. H₂O₂ significantly increased LDH release (Figure S1), which demonstrated that the model was successfully constricted.

High levels of ROS could lead to an imbalance of the cellular redox state and oxidative stress, as well as induce cell apoptosis [33]. Therefore, we chose to measure intracellular reactive oxygen species, glutathione, superoxide dismutase, and malondialdehyde as the biomarker evaluation of oxidative damage. The results showed that H₂S could reverse the decrease of SOD, GSH-PX, and CAT and increase MDA induced by H₂O₂. In contrast, H₂O₂ suppressed the endogenous H₂S production and H₂S-producing enzymes CBS, CSE, and MPST, to further enhance oxidative stress. Recent studies have demonstrated that cell apoptosis induced by ROS could activate the MAPK pathway [34]. ERK, JNK, and p38 are three of the main components in the MAPK family [35]. Our results indicate that H₂O₂ treatment triggered the phosphorylation of ERK and p38. However, pre-treatment with H₂S significantly altered H₂O₂-induced p-ERK and p-p38, but slightly altered p-JNK. Meanwhile, H₂S activated the phosphorylation of AKT to promote cell proliferation when A549 cells became injured. These results provide evidence for the critical roles of H₂S in ROS-induced apoptosis via the MAPK signaling pathway.

Mitochondria are the main sites of oxidative phosphorylation and ATP production [36]. H₂O₂ exposure causes the irreversible damage of mitochondria and loss of Δψ in cardiac fibroblasts [37]. Our previous study showed that a low concentration (less than 10 μM) of H₂S facilitated electron transport and participated in the regulation of mitochondrial respiration in a bovine heart in vitro [38]. Therefore, in this study, we aimed to investigate whether H₂S is involved in mitochondria stabilization in H₂O₂-induced lung injury. The results showed H₂O₂ decreased Δψ and inhibited the activities of metabolic enzymes, reducing energy production in A549 cells. A lack of energy due to oxidative damage further aggravated cell damage. However, H₂S, which facilitated glucose utilization and increased ATP production, played a protective role in human lung epithelial cells. These findings indicate that H₂S neutralized the damaging effects of H₂O₂ in cell metabolism and mitochondria producing energy.

ER stress can activate apoptotic signals to remove the damaged cells. Under physiological conditions, GRP78 is bound to the three ER stress sensors inositol requiring enzyme 1 (IRE1), protein kinase RNA-like ER kinase (PERK), and activating transcription factor 6 (ATF6), to form a stable complex [39]. Under ER stress conditions, calcium dyshomeostasis and misfolded proteins accumulate in the ER. GRP78 is released from the sensors and triggers an unfold protein response (UPR) [40]. The stress sensors are activated, and in the meantime, up-regulate GRP78 and CHOP expression [41]. Our data indicate that H₂O₂ obviously increased the expression of GRP78 and CHOP. Following ER stress, three signaling pathways: the IRE1 pathway, the PERK/eIF2α/ATF4 pathway, and the ATF6 pathway, were activated [42]. All these pathways are capable of altering the levels of Bcl-2 family members to elicit apoptosis [43]. Therefore, these three pathways were examined in response to H₂O₂ treatment. In the IRE1 pathway, H₂O₂ increased the phosphorylation of IRE1, but H₂S pre-treatment changed p-IRE1 expression slightly. In the second pathway, H₂O₂ activated p-ERK, resulting in a large increase of phospho-eIF2α and ATF4. However, only a little change in p-eIF2α and ATF4 could be observed with H₂S pre-treatment. For the last pathway, the results showed that H₂S treatment significantly inhibited H₂O₂-induced AFT6 up-regulation. These findings indicated that the protective effect of H₂S against H₂O₂-induced injury was closely related to ER stress via the ATF6 pathway.

ER stress and oxidative stress together have an impact on many diseases, including diabetes, cardiovascular disease, and cancer [44,45,46]. Overwhelming ROS production disrupts the redox equilibrium in the ER lumen, leading to excessive ER stress and cell apoptosis [47,48,49]. Meanwhile, ER stress facilitates ROS overproduction and thus activates the Ca²⁺/XO/ROS/mPTP pathway [50]. Therefore, combination therapies that suppress both ROS and ER stress might be a potential therapeutic agent to protect lung injury. Our results show that pre-treatment with H₂S could counteract ROS and ER stress processes and might provide an effective way to regulate the tumor microenvironment.

4. Materials and Methods

4.1. Cell Culture

The human lung epithelial cell line A549 was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 medium (Solarbio Science & Technology, Beijing, China) with 10% fetal bovine serum (FBS) at 37 °C and 5% CO₂. NaHS and H₂O₂ were purchased from Sigma-Aldrich (St. Louis, MO, USA) and the solution was prepared immediately before use. A549 cells treated with serum-free medium, 50 μM H₂S, and 60 mM H₂O₂ were the control group, H₂S group, and H₂O₂ group, respectively. A549 cells pre-treated with H₂S (50 μM) for 2 h and then subjected to H₂O₂ (60 mM) for 10 h were the protection group (H₂S+H₂O₂). A549 cells were rinsed with phosphate buffer saline (PBS) buffer three times after H₂S pretreatment, before subjecting the cells to H₂O₂ challenge. After 12 h of treatment, cells were then used for the subsequent experiments.

4.2. Cell Viability and Colony Formation

1.0 × 10⁴ cells were plated in 96-well plates to assess cell viabilities. Different concentrations of NaHS (0, 10, 25, 50, 100, 200 μM) and H₂O₂ (0, 20, 40, 60, 80, 100, 200 mM) were added to the serum-free medium. After 12 h treatment, cells were assessed via an MTT assay and the optical density was measured at 490 nm by a multifunction microplate reader (Tecan Infinite, Mannedorf, Switzerland).

3 × 10² A549 cells/well were seeded in 6-well plates for a colony formation assay. After two weeks, colonies were fixed in methanol, stained with 0.1% crystal violet, and photographed to count the number.

4.3. Analysis of Cell Apoptosis

The apoptosis assays were measured with a BBcellProbe™ Annexin V FITC/PI Apoptosis Detection Kit (BestBio, Shanghai, China). Briefly, A549 cells were collected in 400 μL binding buffer and incubated with 5 μL Annexin V and 10 μL PI for 10 min. A CytoFLEX flow cytometer (Beckman Coulter Life Sciences, Indianapolis, IN, USA) was used to measure apoptosis rates. Caspase 3 activity was detected by a caspase 3 activity assay kit (BestBio), according to the manufacturer’s instructions. Briefly, after being lysed on ice for 30 min, cellular proteins were incubated in reaction buffer with Ac-DEVD-pNA at 37 °C for 4 h. The 405 nm absorbance was measured via NanoDrop 2000 apparatus (Thermo Fisher Scientific, Waltham, MA, USA).

4.4. Quantitative Real-Time PCR (qRT-PCR)

RNA was isolated using a Total RNA Purification Kit (BioTeke Corporation, Beijing, China), as per the manufacturer’s instructions, and reverse transcribed into cDNA using a PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Bio, Kyoto, Japan). qRT-PCR was performed using SYBR Green PCR Mastermix (Solarbio Science & Technology) and DNA amplification was performed using an Applied Biosystems ABI 7500 thermal cycler (Thermo Fisher Scientific). The results were calculated using the 2^−ΔΔCt method. β-actin was the internal control. The primer sequences are listed in

Table 1. Quantitative real-time PCR (qRT-PCR) primers used in the study.

Gene	Forward (5′-3′)	Reverse (5′-3′)
CBS	AATGGTGACGCTTGGGAA	TGAGGCGGATCTGTTTGA
CSE	AAGACGCCTCCTCACAAGGT	ATATTCAAAACCCGAGTGCTGG
MPST	GACCCCGCCTTCATCAAG	CATGTACCACTCCACCCA
Bax	TGGCAGCTGACATGTTTTCTGA	TCACCCAACCACCCTGGTCTT
Bcl-2	CAGTTGGGCAACAGAGAACCAT	AGCCCTTGTCCCCAATTTGGAA
β-actin	CTGGAACGGTGAAGGTGACA	AAGGGACTTCCTGTAACAATGCA

.

4.5. Western Blot

Cellular proteins were extracted in RIPA lysis buffer (BioTeke Corporation) on ice. An equal protein content of cell lysates was loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electrophoretically resolved, and then transferred onto polyvinylidene difluoride western blot membranes (Roche, Basel, Switzerland). The membranes were blocked for 3 h at 25 °C in 5% skim milk, and then incubated with specific primary and secondary antibodies. Immunoblots were detected using an ECL Western Blotting Substrate (Solarbio Science & Technology) and visualized using a Tanon 5200 digital imaging system (Tanon Science & Technology, Shanghai, China). Primary antibodies were caspase-3, cleaved-caspase-3, Bcl-2, Bax, GRP78, CHOP, IRE1, elF2α, ATF4, ATF6, p-38, p-p38, ERK, p-ERK, JNK, p-JNK, AKT and p-AKT (Wanleibio, Shenyang, China), β-actin, MPST, p-IRE1 (Bioss, Beijing, China), CBS, CSE (Omnimabs, Alhambra, CA, USA), and p-elF2α (Abbkine, Wuhan, China). Secondary antibodies (goat anti-rabbit IgG/HRP antibody, goat anti-mouse IgG/HRP antibody) were purchased from Bioss. Western blotting quantification results were evaluated with Image J software.

4.6. Measurement of H₂S in Cell Culture Supernatants

H₂S production was tested using a methylene blue assay as per the manufacturer’s instructions (Solarbio Science & Technology). Briefly, the test is based on the reaction between H₂S and zinc acetate that forms zinc sulfide, which is then dissolved in N, N-dimethyl-p-phenylenediamine sulfate. Upon ammonium ferric sulfate addition, methylene blue forms were then quantified from the absorbance read using a UV-VIS spectrophotometer (UV-2700, Shimadzu, Kyoto, Japan).

4.7. Measurement of [Ca²⁺]

[Ca²⁺] measurement was performed according to the manufacturer’s instructions (Solarbio Science & Technology). Briefly, A549 cells were incubated in hanks balanced salt solution (1% FBS) with Fluo-3, AM at 37 °C for 40 min. Then, cells were washed with HEPES buffer saline three times and examined using IX73 fluorescence microscopy (Olympus, Kyoto, Japan).

4.8. Measurement of Mitochondrial Membrane Potential (Δψ)

Mitochondrial membrane potential was measured with a mitochondria-specific cationic dye JC-1 (BestBio), according to the manufacturer’s instructions. Briefly, A549 cells were incubated in dye buffer with 5 μL JC-1 for 15 min at 37 °C and observed using an LSM710 laser scanning confocal microscope (Carl Zeiss, Oberkochen, Germany).

4.9. Reactive Oxygen Species (ROS), Malondialdehyde (MDA), Superoxide Dismutase (SOD), Glutathione (GSH), and Catalase-Peroxidase (CAT) Assays

ROS was measured with 2′,7′-dichloroflurescein-diacetate (DCFH-DA, BestBio) and observed using an LSM710 laser scanning confocal microscope (Carl Zeiss). MDA content (Wanleibio), SOD activity, GSH concentration, and CAT activity (Solarbio Science & Technology) were measured following the manufacturer’s instructions.

4.10. Metabolic Assays

ATP production was detected using an ATP Bioluminescent Assay Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s instructions. Glucose consumption assay, lactic acid production, pyruvate, and lactate dehydrogenase (LDH) were performed with a Glucose Measurement Assay Kit (Rongsheng Biotech, Shanghai, China), Lactic Acid Assay Kit (Nanjing Jiancheng Bioengineering Institute), Pyruvate Assay Kit (Nanjing Jiancheng Bioengineering Institute), and LDH Assay Kit (Wanleibio), respectively, according to the manufacturer’s instructions.

4.11. Statistical Analysis

All results were expressed as means ± standard deviation (SD) from at least three independent experiments. Data between-group differences were evaluated by two-tailed t-tests. SPSS 16.0 (IBM Corporation, Chicago, IL, USA) and GraphPad Prism 6.0 (GraphPad Software, La Jolla, CA, USA) software were used to perform all statistical analyses. Only results with p-value < 0.05 were considered statistically significant.

5. Conclusions

In summary, our results demonstrated that H₂S reduced ROS production and markedly inhibited apoptosis induced by H₂O₂, as well as maintained the structural and functional integrity of the mitochondria in A549 cells. Moreover, H₂S attenuated [Ca²⁺] overload and ER stress induced by H₂O₂. These findings might provide an effective way to counteract ROS and ER stress processes in H₂O₂-induced lung injury.