Novel Salicylic Acid Analogs Induce a Potent Defense Response in Arabidopsis
Abstract
1. Introduction
2. Results
2.1. ChemMine Results
2.2. Several Putative SA Analogs Increased the Strength of Interactions among NPR3/4 in Y2H
2.3. Several SA Analogs Induced NPR1 Accumulation
2.4. Several SA Analogs Inhibited Bacterial Growth
2.5. SA Analogs that Induced NPR1 Accumulation Were Inducers of PR1 Expression
2.6. The Interaction Between CsNPR1 and CsNPR3 Was Strengthened by Several SA Analogs
3. Discussion
4. Materials and Methods
4.1. Yeast Two-Hybrid (Y2H) Assays
4.2. SA Analog Spray Treatment
4.3. Immunoblotting
4.4. RT-qPCR
4.5. Preparation of SA Analog Solutions
Author Contributions
Funding
Conflicts of Interest
References
- Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gómez-Gómez, L.; Boller, T. Flagellin perception: A paradigm for innate immunity. Trends Plant Sci. 2002, 7, 251–256. [Google Scholar] [CrossRef] [Scilit]
- Zipfel, C.; Kunze, G.; Chinchilla, D.; Caniard, A.; Jones, J.D.; Boller, T.; Felix, G. Perception of the bacterial pamp ef-tu by the receptor efr restricts agrobacterium-mediated transformation. Cell 2006, 125, 749–760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eckardt, N.A. Chitin signaling in plants: Insights into the perception of fungal pathogens and rhizobacterial symbionts. Am. Soc. Plant. Biol. 2008, 20, 241–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boller, T.; Felix, G. A renaissance of elicitors: Perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 2009, 60, 379–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamb, C.J.; Lawton, M.A.; Dron, M.; Dixon, R.A. Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell 1989, 56, 215–224. [Google Scholar] [CrossRef] [Scilit]
- Boudsocq, M.; Willmann, M.R.; McCormack, M.; Lee, H.; Shan, L.; He, P.; Bush, J.; Cheng, S.-H.; Sheen, J. Differential innate immune signalling via ca 2+ sensor protein kinases. Nature 2010, 464, 418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tintor, N.; Ross, A.; Kanehara, K.; Yamada, K.; Fan, L.; Kemmerling, B.; Nürnberger, T.; Tsuda, K.; Saijo, Y. Layered pattern receptor signaling via ethylene and endogenous elicitor peptides during arabidopsis immunity to bacterial infection. Proc. Natl. Acad. Sci. USA 2013, 110, 6211–6216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishina, T.E.; Zeier, J. Pathogen-associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquired resistance in arabidopsis. Plant J. 2007, 50, 500–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luna, E.; Pastor, V.; Robert, J.; Flors, V.; Mauch-Mani, B.; Ton, J. Callose deposition: A multifaceted plant defense response. Mol. Plant-Microbe Interact. 2011, 24, 183–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elmore, J.M.; Lin, Z.-J.D.; Coaker, G. Plant nb-lrr signaling: Upstreams and downstreams. Curr. Opin. Plant Biol. 2011, 14, 365–371. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.; Chen, H.; Curtis, C.; Fu, Z.Q. Go in for the kill: How plants deploy effector-triggered immunity to combat pathogens. Virulence 2014, 5, 710–721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van der Hoorn, R.A.; Kamoun, S. From guard to decoy: A new model for perception of plant pathogen effectors. Plant Cell 2008, 20, 2009–2017. [Google Scholar] [CrossRef] [Scilit]
- Raskin, I. Role of salicylic acid in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1992, 439–462. [Google Scholar] [CrossRef]
- Ward, E.R.; Uknes, S.J.; Williams, S.C.; Dincher, S.S.; Wiederhold, D.L.; Alexander, D.C.; Ahl-Goy, P.; Métraux, J.-P.; Ryals, J.A. Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant Cell 1991, 3, 1085–1094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delaney, T.; Uknes, S.; Vernooij, B.; Friedrich, L.; Weymann, K.; Negrotto, D.; Gaffney, T.; Gut-Rella, M.; Kessmann, H.; Ward, E.; et al. A central role of salicylic acid in plant disease resistance. Science 1994, 266, 1247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wildermuth, M.C.; Dewdney, J.; Wu, G.; Ausubel, F.M. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 2001, 414, 562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strawn, M.A.; Marr, S.K.; Inoue, K.; Inada, N.; Zubieta, C.; Wildermuth, M.C. Arabidopsis isochorismate synthase functional in pathogen-induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. J. Biol. Chem. 2007, 282, 5919–5933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fragnière, C.; Serrano, M.; Abou-Mansour, E.; Métraux, J.; L’Haridon, F. Salicylic acid and its location in response to biotic and abiotic stress. FEBS Lett. 2011, 585, 1847–1852. [Google Scholar] [CrossRef] [Scilit]
- Vlot, A.C.; Dempsey, D.A.; Klessig, D.F. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 2009, 47, 177–206. [Google Scholar] [CrossRef] [Scilit]
- Fu, Z.Q.; Yan, S.; Saleh, A.; Wang, W.; Ruble, J.; Oka, N.; Mohan, R.; Spoel, S.H.; Tada, Y.; Zheng, N.; et al. Npr3 and npr4 are receptors for the immune signal salicylic acid in plants. Nature 2012, 486, 228–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Zhang, D.; Chu, J.Y.; Boyle, P.; Wang, Y.; Brindle, I.D. The arabidopsis npr1 protein is a receptor for the plant defense hormore salicylic acid. Cell Rep. 2012, 1, 639–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, Y.; Sun, T.; Ao, K.; Peng, Y.; Zhang, Y.; Li, X.; Zhang, Y. Opposite roles of salicylic acid receptors npr1 and npr3/npr4 in transcriptional regulation of plant immunity. Cell 2018, 173, 1454–1467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mou, Z.; Fan, W.; Dong, X. Inducers of plant systemic acquired resistance regulate npr1 function through redox changes. Cell 2003, 113, 935–944. [Google Scholar] [CrossRef] [Scilit]
- Fu, Z.Q.; Dong, X. Systemic acquired resistance: Turning local infection into global defense. Annu. Rev. Plant Biol. 2013, 64, 839–863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; Chen, H.; Chen, J.; Chang, M.; Palmer, I.A.; Gassmann, W.; Liu, F.; Fu, Z.Q. Tcp transcription factors interact with npr1 and contribute redundantly to systemic acquired resistance. Front. Plant Sci. 2018, 9, 1153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malamy, J.; Carr, J.P.; Klessig, D.F.; Raskin, I. Salicylic acid: A likely endogenous signal in the resistance response of tobacco to viral infection. Science 1990, 250, 1002–1004. [Google Scholar] [CrossRef] [Scilit]
- Moreau, M.; Tian, M.; Klessig, D.F. Salicylic acid binds npr3 and npr4 to regulate npr1-dependent defense responses. Cell Res. 2012, 22, 1631–1633. [Google Scholar] [CrossRef] [Scilit]
- An, C.; Mou, Z. Salicylic acid and its function in plant immunity. J. Integr. Plant Biol. 2011, 53, 412–428. [Google Scholar] [CrossRef] [Scilit]
- Palmer, I.A.; Shang, Z.; Fu, Z.Q. Salicylic acid-mediated plant defense: Recent developments, missing links, and future outlook. Front. Biol. 2017, 12, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Lu, H.; Greenberg, J.T.; Holuigue, L. Editorial: Salicylic acid signaling networks. Front. Plant Sci. 2016, 7, 238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anand, A.; Uppalapati, S.R.; Ryu, C.-M.; Allen, S.N.; Kang, L.; Tang, Y.; Mysore, K.S. Salicylic acid and systemic acquired resistance play a role in attenuating crown gall disease caused by agrobacterium tumefaciens. Plant Physiol. 2008, 146, 703–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vernooij, B.; Friedrich, L.; Goy, P.A.; Staub, T.; Kessmann, H.; Ryals, J. 2, 6-dichloroisonicotinic acid-induced resistance to pathogens without the accumulation of salicylic acid. Mol. Plant Microbe Interact. 1995, 8, 228–234. [Google Scholar] [CrossRef] [Scilit]
- Leslie, F.; Kay, L.; Wilhelm, R.; Peter, M.; Nicole, S.; Gut, R.M.; Beatrice, M.; Sandra, D.; Theodor, S.; Scott, U.; et al. A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J. 1996, 10, 61–70. [Google Scholar]
- Watanabe, T. Effects of probenazole (oryzemate [registered name]) on each stage of rice blast fungus (Pyricularia oryzae Cavara). J. Pestic. Sci. 1977, 2, 395–404. [Google Scholar] [CrossRef] [Scilit]
- Métraux, J.; Ahlgoy, P.; Staub, T.; Speich, J.; Steinemann, A.; Ryals, J.; Ward, E. Induced systemic resistance in cucumber in response to 2, 6-dichloro-isonicotinic acid and pathogens. In Advances in Molecular Genetics of Plant-Microbe Interactions; Springer: Berlin, Germany, 1991; Volume 1, pp. 432–439. [Google Scholar]
- Yoshida, H.; Konishi, K.; Koike, K.; Nakagawa, T.; Sekido, S.; Yamaguchi, I. Effect of n-cyanomethyl-2-chloroisonicotinamide for control of rice blast. J. Pestic. Sci. 1990, 15, 413–417. [Google Scholar] [CrossRef] [Scilit]
- Bektas, Y.; Eulgem, T. Synthetic plant defense elicitors. Front. Plant Sci. 2015, 5, 804. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Pang, Z.; Trivedi, P.; Zhou, X.; Ying, X.; Jia, H.; Wang, N. ‘Candidatus liberibacter asiaticus’ encodes a functional salicylic acid (sa) hydroxylase that degrades sa to suppress plant defenses. Mol. Plant Microbe Interact. 2017, 30, 620–630. [Google Scholar] [CrossRef] [Scilit]
- You, I.-S.; Murray, R.; Jollie, D.; Gunsalus, I. Purification and characterization of salicylate hydroxylase from pseudomonas putida ppg7. Biochem. Biophys. Res. Commun. 1990, 169, 1049–1054. [Google Scholar] [CrossRef] [Scilit]
- Lawton, K.; Weymann, K.; Friedrich, L.; Vernooij, B.; Uknes, S.; Ryals, J. Systemic acquired resistance in arabidopsis requires salicylic acid but not ethylene. Mol. Plant Microbe Interact. 1995, 8, 863–870. [Google Scholar] [CrossRef] [Scilit]
- Backman, T.W.; Cao, Y.; Girke, T. Chemmine tools: An online service for analyzing and clustering small molecules. Nucleic Acids Res. 2011, 39, W486–W491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.; Chen, J.; Cheng, T.; Gindulyte, A.; He, J.; He, S.; Li, Q.; Shoemaker, B.A.; Thiessen, P.A.; Yu, B. Pubchem 2019 update: Improved access to chemical data. Nucleic Acids Res. 2018, 47, D1102–D1109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Barnaby, J.Y.; Sreedharan, A.; Huang, X.; Orbović, V.; Grosser, J.W.; Wang, N.; Dong, X.; Song, W.-Y. Over-expression of the citrus gene ctnh1 confers resistance to bacterial canker disease. Physiol. Mol. Plant Pathol. 2013, 84, 115–122. [Google Scholar] [CrossRef] [Scilit]
- White, R.F. Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 1979, 99, 410–412. [Google Scholar] [CrossRef] [Scilit]
- Van de Waterbeemd, H.; Camenisch, G.; Folkers, G.; Chretien, J.R.; Raevsky, O.A. Estimation of blood-brain barrier crossing of drugs using molecular size and shape, and h-bonding descriptors. J. Drug Target. 1998, 6, 151–165. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.; Thiessen, P.A.; Bolton, E.E.; Chen, J.; Fu, G.; Gindulyte, A.; Han, L.; He, J.; He, S.; Shoemaker, B.A.; et al. Pubchem substance and compound databases. Nucleic Acids Res 2016, 44, D1202–D1213. [Google Scholar] [CrossRef] [Scilit]
- Parisini, E.; Metrangolo, P.; Pilati, T.; Resnati, G.; Terraneo, G. Halogen bonding in halocarbon–protein complexes: A structural survey. Chem. Soc. Rev. 2011, 40, 2267–2278. [Google Scholar] [CrossRef] [Scilit]
- Wilson, D.C.; Kempthorne, C.J.; Carella, P.; Liscombe, D.K.; Cameron, R.K. Age-related resistance in Arabidopsis thaliana involves the mads-domain transcription factor short vegetative phase and direct action of salicylic acid on Pseudomonas syringae. Mol. Plant Microbe Interact. 2017, 30, 919–929. [Google Scholar] [CrossRef] [Scilit]






| Acid | Name | Molecular_Weight | LogP |
|---|---|---|---|
| 3469 | 2,5-dihydroxybenzoic acid | 1.53 × 102 | 6.67 × 10−1 |
| 9338 | 2,6-dihydroxybenzoic acid | 1.53 × 102 | 6.67 × 10−1 |
| 55251260 | Lithium 2,5-dihydroxybenzoate | 1.60 × 102 | 6.67 × 10−1 |
| 1491 | 2,4-Dihydroxybenzoic acid | 1.53 × 102 | 6.67 × 10−1 |
| 23663423 | Monosodium 2,4-dihydroxybenzoate | 1.76 × 102 | 6.67 × 10−1 |
| 3418 | Fosfosal | 2.17 × 102 | 1.1109 |
| 11812 | 2-Hydroxyisophthalic acid | 1.80 × 102 | 1.3557 |
| 97257 | 2-Hydroxyterephthalic acid | 1.80 × 102 | 1.3557 |
| 6998 | Salicylaldehyde | 1.22 × 102 | 1.4218 |
| 67658 | 5-Fluorosalicylic acid | 1.55 × 102 | 1.4986 |
| 54675839 | 2,5-Dihydroxybenzoate | 1.52 × 102 | 1.5033 |
| 54712708 | 2,4-Dihydroxybenzoate | 1.52 × 102 | 1.5033 |
| 53629521 | 62TEY51RR1 | 3.64 × 102 | 1.6432 |
| 16682734 | Bismuth subsalicylate | 3.63 × 102 | 1.8035 |
| 8388 | 5-Iodosalicylic acid | 2.63 × 102 | 1.9641 |
| 72874 | 2-Hydroxy-4-iodobenzoic acid | 2.63 × 102 | 1.9641 |
| 4133 | Methyl salicylate | 1.52 × 102 | 2.0602 |
| 8375 | 2’-Hydroxyacetophenone | 1.36 × 102 | 2.1286 |
| 6738 | 3-Methylsalicylic acid | 1.51 × 102 | 2.1672 |
| 6973 | 5-Methylsalicylic acid | 1.51 × 102 | 2.1672 |
| 5788 | 4-methylsalicylic acid | 1.51 × 102 | 2.1672 |
| 11279 | 2-hydroxy-6-methylbenzoic acid | 1.51 × 102 | 2.1672 |
| 164578 | 4-Trifluoromethylsalicylic acid | 2.05 × 102 | 2.3783 |
| 8631 | 3,5-Diiodosalicylic acid | 3.89 × 102 | 2.4457 |
| 8365 | Ethyl salicylate | 1.66 × 102 | 2.767 |
| 54683201 | Copper disalicylate | 3.38 × 102 | 2.9625 |
| 54684589 | Magnesium salicylate | 2.99 × 102 | 2.965 |
| 64738 | Magnesium salicylate | 2.99 × 102 | 2.965 |
| 1.02E+08 | Magan | 2.99 × 102 | 2.965 |
| 517068 | Calcium salicylate | 3.14 × 102 | 2.965 |
| 54684600 | Calcium disalicylate | 3.14 × 102 | 2.965 |
| 1.32E+08 | Magnesium salicylate | 3.17 × 102 | 3.1257 |
| 201887 | 2-Hydroxy-3-isopropylbenzoic acid | 1.79 × 102 | 3.5808 |
| 5282387 | Magnesium salicylate tetrahydrate | 3.71 × 102 | 3.6078 |
| 54708862 | Magnesium salicylate tetrahydrate | 3.71 × 102 | 3.6078 |
| 133124 | Whitfield’s ointment | 2.58 × 102 | 3.7803 |
| 6873 | Isobutyl salicylate | 1.94 × 102 | 4.1806 |
| 16330 | Butyl salicylate | 1.94 × 102 | 4.1806 |
| 50216 | Prenyl salicylate | 2.06 × 102 | 4.276 |
| 16299 | Amyl salicylate | 2.08 × 102 | 4.8874 |
| 6437473 | trans-2-Hexenyl salicylate | 2.20 × 102 | 4.9828 |
| 5371102 | cis-3-Hexenyl salicylate | 2.20 × 102 | 4.9828 |
| 103379 | Benzoic acid, 2-hydroxy-, (3Z)-3-hexenyl ester | 2.20 × 102 | 4.9828 |
| 6021887 | 3-Hexenyl salicylate | 2.20 × 102 | 4.9828 |
| 22629 | Hexylsalicylate | 2.22 × 102 | 5.5942 |
| 153705 | 3-Hexylsalicylic acid | 2.21 × 102 | 5.7012 |
| 196549 | Tcp (antiseptic) | 5.56 × 102 | 6.2422 |
| ID | Name | Abbv. | Structure | Formula | Mol. Weight |
|---|---|---|---|---|---|
| 1 | Sodium Salicylate | NaSA | ![]() | C7H5NaO3 | 160.104 g/mol |
| 2 | 4-Hydroxybenzoic Acid | 4-HBA | ![]() | C7H6O3 | 138.122 g/mol |
| 3 | Acetylsalicylic Acid | AcSA | ![]() | C9H8O4 | 180.159 g/mol |
| 4 | 5-Aminosalicylic Acid | 5-AminoSA | ![]() | C7H7NO3 | 183.137 g/mol |
| 5 | Ethyl Salicylate | EtSA | ![]() | C9H10O3 | 166.167 g/mol |
| 6 | 2,5-Dihydroxybenzoic Acid | 2,5-DHBA | ![]() | C7H6O4 | 154.121 g/mol |
| 7 | 5-Methylsalicylic Acid | 5-MeSA | ![]() | C8H8O3 | 152.149 g/mol |
| 8 | 5-Iodosalicylic Acid | 5-I-SA | ![]() | C7H5IO3 | 264.018 g/mol |
| 9 | 5-Fluoro-2-Hydroxybenzoic Acid | 5-F-2-HBA | ![]() | C7H5FO3 | 156.112 g/mol |
| 10 | 2,4-Dihydroxybenzoic Acid | 2,4-DHBA | ![]() | C7H6O4 | 154.121 g/mol |
| 11 | 2-Hydroxyterephthalic Acid | 2-HTPA | ![]() | C8H6O5 | 182.131 g/mol |
| Name | Sequence |
|---|---|
| UBQ5 forward RT | TCTCCGTGGTGGTGCTAAG |
| UBQ5 reverse RT | GAACCTTTCCAGATCCATCG |
| PR1 forward RT | GCAACTGCAGACTCATACAC |
| PR1 reverse RT | GTTGTAGTTAGCCTTCTCGC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Palmer, I.A.; Chen, H.; Chen, J.; Chang, M.; Li, M.; Liu, F.; Fu, Z.Q. Novel Salicylic Acid Analogs Induce a Potent Defense Response in Arabidopsis. Int. J. Mol. Sci. 2019, 20, 3356. https://doi.org/10.3390/ijms20133356
Palmer IA, Chen H, Chen J, Chang M, Li M, Liu F, Fu ZQ. Novel Salicylic Acid Analogs Induce a Potent Defense Response in Arabidopsis. International Journal of Molecular Sciences. 2019; 20(13):3356. https://doi.org/10.3390/ijms20133356
Chicago/Turabian StylePalmer, Ian Arthur, Huan Chen, Jian Chen, Ming Chang, Min Li, Fengquan Liu, and Zheng Qing Fu. 2019. "Novel Salicylic Acid Analogs Induce a Potent Defense Response in Arabidopsis" International Journal of Molecular Sciences 20, no. 13: 3356. https://doi.org/10.3390/ijms20133356
APA StylePalmer, I. A., Chen, H., Chen, J., Chang, M., Li, M., Liu, F., & Fu, Z. Q. (2019). Novel Salicylic Acid Analogs Induce a Potent Defense Response in Arabidopsis. International Journal of Molecular Sciences, 20(13), 3356. https://doi.org/10.3390/ijms20133356












