Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus
Abstract
1. Introduction
2. Results
2.1. High-Throughput Sequencing of Small RNAs
2.2. The Expression of Known miRNAs
2.3. The Prediction and Expression of Novel miRNAs
2.4. The Prediction and Expression of miRNA Target Genes
3. Discussion
4. Materials and Methods
4.1. Plant Growth and Virus Inoculations
4.2. Small RNA Sequencing and Bioinformatics Analyses
4.3. Target Gene Prediction
4.4. Northern Blotting Analysis
4.5. Quantitative Real-time RT-PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
MCMV | maize chlorotic mottle virus |
SCMV | sugarcane mosaic virus |
MLN | maize lethal necrosis |
miRNA | microRNA |
siRNA | small interfering RNA |
vsiRNA | virus-derived siRNA |
qRT-PCR | quantitative real-time reverse transcription-polymerase chain reaction |
References
- Bartel, D.P. microRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Ding, S.-W.; Voinnet, O. Antiviral immunity directed by small RNAs. Cell 2007, 130, 413–426. [Google Scholar] [CrossRef] [PubMed]
- Voinnet, O. Origin, biogenesis, and activity of plant microRNAs. Cell 2009, 136, 669–687. [Google Scholar] [CrossRef]
- Kurihara, Y.; Watanabe, Y. Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc. Natl. Acad. Sci. USA 2004, 101, 12753–12758. [Google Scholar] [CrossRef] [PubMed]
- Park, M.Y.; Wu, G.; Gonzalez-Sulser, A.; Vaucheret, H.; Poethig, R.S. Nuclear processing and export of microRNAs in Arabidopsis. Proc. Natl. Acad. Sci. USA 2005, 102, 3691–3696. [Google Scholar] [CrossRef] [PubMed]
- Baumberger, N.; Baulcombe, D.C. Arabidopsis ARGONAUTE1 is an RNA slicer that selectively recruits microRNAs and short interfering RNAs. Proc. Natl. Acad. Sci. USA 2005, 102, 11928–11933. [Google Scholar] [CrossRef] [PubMed]
- Brodersen, P.; Sakvarelidze-Achard, L.; Bruun-Rasmussen, M.; Dunoyer, P.; Yamamoto, Y.Y.; Sieburth, L.; Voinnet, O. Widespread translational inhibition by plant miRNAs and siRNAs. Science 2008, 320, 1185–1190. [Google Scholar] [CrossRef] [PubMed]
- Jones-Rhoades, M.W.; Bartel, D.P.; Bartel, B. microRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 2006, 57, 19–53. [Google Scholar] [CrossRef]
- Kasschau, K.D.; Xie, Z.; Allen, E.; Llave, C.; Chapman, E.J.; Krizan, K.A.; Carrington, J.C. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev. Cell 2003, 4, 205–217. [Google Scholar] [CrossRef]
- Mlotshwa, S.; Schauer, S.E.; Smith, T.H.; Mallory, A.C.; Herr, J.M.; Roth, B.; Merchant, D.S.; Ray, A.; Bowman, L.H.; Vance, V.B. Ectopic DICER-LIKE1 expression in P1/HC-Pro Arabidopsis rescues phenotypic anomalies but not defects in microRNA and silencing pathways. Plant Cell 2005, 17, 2873–2885. [Google Scholar] [CrossRef]
- Mallory, A.C.; Reinhart, B.J.; Bartel, D.; Vance, V.B.; Bowman, L.H. A viral suppressor of RNA silencing differentially regulates the accumulation of short interfering RNAs and micro-RNAs in tobacco. Proc. Natl. Acad. Sci. USA 2002, 99, 15228–15233. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Li, Y.; Cao, X.; Qi, Y. microRNAs and their regulatory roles in plant-environment interactions. Annu. Rev. Plant Biol. 2019, 70, 489–525. [Google Scholar] [CrossRef] [PubMed]
- Bazzini, A.A.; Hopp, H.E.; Beachy, R.N.; Asurmendi, S. Infection and coaccumulation of tobacco mosaic virus proteins alter microRNA levels, correlating with symptom and plant development. Proc. Natl. Acad. Sci. USA 2007, 104, 12157–12162. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Yang, M.; Zhang, X. The function of small RNAs in plant biotic stress response. J. Integr. Plant Biol. 2016, 58, 312–327. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Castillo-González, C.; Yu, B.; Zhang, X. The functions of plant small RNAs in development and in stress responses. Plant J. 2017, 90, 654–670. [Google Scholar] [CrossRef] [PubMed]
- Rose, L.E.; Overdijk, E.J.R.; van Damme, M. Small RNA molecules and their role in plant disease. Eur. J. Plant Pathol. 2019, 153, 1–14. [Google Scholar] [CrossRef]
- Várallyay, É.; Válóczi, A.; Ágyi, Á.; Burgyán, J.; Havelda, Z. Plant virus-mediated induction of miR168 is associated with repression of ARGONAUTE1 accumulation. EMBO J. 2010, 29, 3507–3519. [Google Scholar] [CrossRef]
- Xia, Z.; Zhao, Z.; Chen, L.; Li, M.; Zhou, T.; Deng, C.; Zhou, Q.; Fan, Z. Synergistic infection of two viruses MCMV and SCMV increases the accumulations of both MCMV and MCMV-derived siRNAs in maize. Sci. Rep. 2016, 6, 20520. [Google Scholar] [CrossRef]
- Wu, J.; Yang, Z.; Wang, Y.; Zheng, L.; Ye, R.; Ji, Y.; Zhao, S.; Ji, S.; Liu, R.; Xu, L.; et al. Viral-inducible Argonaute18 confers broad-spectrum virus resistance in rice by sequestering a host microRNA. eLife 2015, 4, e05733. [Google Scholar] [CrossRef]
- Wang, H.; Jiao, X.; Kong, X.; Hamera, S.; Wu, Y.; Chen, X.; Fang, R.; Yan, Y. A signaling cascade from miR444 to RDR1 in rice antiviral RNA silencing pathway. Plant Physiol. 2016, 170, 2365–2377. [Google Scholar] [CrossRef]
- Wang, Z.; Hardcastle, T.J.; Canto Pastor, A.; Yip, W.H.; Tang, S.; Baulcombe, D.C. A novel DCL2-dependent miRNA pathway in tomato affects susceptibility to RNA viruses. Gene Dev. 2018, 32, 1155–1160. [Google Scholar] [CrossRef] [PubMed]
- He, X.-F.; Fang, Y.-Y.; Feng, L.; Guo, H.-S. Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica. FEBS Lett. 2008, 582, 2445–2452. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Pignatta, D.; Bendix, C.; Brunkard, J.O.; Cohn, M.M.; Tung, J.; Sun, H.; Kumar, P.; Baker, B. microRNA regulation of plant innate immune receptors. Proc. Natl. Acad. Sci. USA 2012, 109, 1790–1795. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Ding, Z.; Wu, K.; Yang, L.; Li, Y.; Yang, Z.; Shi, S.; Liu, X.; Zhao, S.; Yang, Z.; et al. Suppression of jasmonic acid-mediated defense by viral-inducible microRNA319 facilitates virus infection in rice. Mol. Plant 2016, 9, 1302–1314. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Xu, Z.; Duan, C.; Chen, Y.; Meng, Q.; Wu, J.; Hao, Z.; Wang, Z.; Li, M.; Yong, H.; et al. Dual transcriptome analysis reveals insights into the response to Rice black-streaked dwarf virus in maize. J. Exp. Bot. 2016, 67, 4593–4609. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Li, G.; Zhao, Y.; Meng, Z.; Zhao, M.; Li, C.; Zhang, Y.; Li, P.; Ma, C.-L.; Xia, H.; et al. Combined small RNA and gene expression analysis revealed roles of miRNAs in maize response to rice black-streaked dwarf virus infection. Sci. Rep. 2018, 8, 13502. [Google Scholar] [CrossRef] [PubMed]
- Xia, Z.; Zhao, Z.; Li, M.; Chen, L.; Jiao, Z.; Wu, Y.; Zhou, T.; Yu, W.; Fan, Z. Identification of miRNAs and their targets in maize in response to Sugarcane mosaic virus infection. Plant Physiol. Biochem. 2018, 125, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Redinbaugh, M.G.; Stewart, L.R. Maize lethal necrosis: An emerging, synergistic viral disease. Annu. Rev. Virol. 2018, 5, 301–322. [Google Scholar] [CrossRef]
- Scheets, K. Maize chlorotic mottle machlomovirus and Wheat streak mosaic rymovirus concentrations increase in the synergistic disease corn lethal necrosis. Virology 1998, 242, 28–38. [Google Scholar] [CrossRef]
- Adams, I.P.; Miano, D.W.; Kinyua, Z.M.; Wangai, A.; Kimani, E.; Phiri, N.; Reeder, R.; Harju, V.; Glover, R.; Hany, U.; et al. Use of next-generation sequencing for the identification and characterization of Maize chlorotic mottle virus and Sugarcane mosaic virus causing maize lethal necrosis in Kenya. Plant Pathol. 2013, 62, 741–749. [Google Scholar] [CrossRef]
- Xie, L.; Zhang, J.; Wang, Q.; Meng, C.; Hong, J.; Zhou, X. Characterization of Maize chlorotic mottle virus associated with maize lethal necrosis disease in China. J. Phytopathol. 2011, 159, 191–193. [Google Scholar] [CrossRef]
- Wang, Q.; Zhang, C.; Wang, C.; Qian, Y.; Li, Z.; Hong, J.; Zhou, X. Further characterization of Maize chlorotic mottle virus and its synergistic interaction with Sugarcane mosaic virus in maize. Sci. Rep. 2017, 7, 39960. [Google Scholar] [CrossRef] [PubMed]
- Axtell, M.J.; Meyers, B.C. Revisiting criteria for plant microRNA annotation in the era of big data. Plant Cell 2018, 30, 272–284. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Pan, X.; Cox, S.; Cobb, G.; Anderson, T. Evidence that miRNAs are different from other RNAs. Cell. Mol. Life Sci. 2006, 63, 246–254. [Google Scholar] [CrossRef] [PubMed]
- Nannas, N.J.; Dawe, R.K. Genetic and genomic toolbox of Zea mays. Genetics 2015, 199, 655–669. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Cao, Y.; Li, Y.; Xia, Z.; Xie, J.; Carr, J.P.; Wu, B.; Fan, Z.; Zhou, T. Identification of differentially regulated maize proteins conditioning Sugarcane mosaic virus systemic infection. New Phytol. 2017, 215, 1156–1172. [Google Scholar] [CrossRef]
- Zhang, X.; Du, P.; Lu, L.; Xiao, Q.; Wang, W.; Cao, X.; Ren, B.; Wei, C.; Li, Y. Contrasting effects of HC-Pro and 2b viral suppressors from Sugarcane mosaic virus and Tomato aspermy cucumovirus on the accumulation of siRNAs. Virology 2008, 374, 351–360. [Google Scholar] [CrossRef]
- Nogueira, F.T.; Chitwood, D.H.; Madi, S.; Ohtsu, K.; Schnable, P.S.; Scanlon, M.J.; Timmermans, M.C. Regulation of small RNA accumulation in the maize shoot apex. PLoS Genet. 2009, 5, e1000320. [Google Scholar] [CrossRef]
- Zhu, H.; Hu, F.; Wang, R.; Zhou, X.; Sze, S.-H.; Liou, L.W.; Barefoot, A.; Dickman, M.; Zhang, X. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell 2011, 145, 242–256. [Google Scholar] [CrossRef]
- Zhang, Y.-C.; Yu, Y.; Wang, C.-Y.; Li, Z.-Y.; Liu, Q.; Xu, J.; Liao, J.-Y.; Wang, X.-J.; Qu, L.-H.; Chen, F. Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching. Nat. Biotechnol. 2013, 31, 848–852. [Google Scholar] [CrossRef]
- De Luis, A.; Markmann, K.; Cognat, V.; Holt, D.B.; Charpentier, M.; Parniske, M.; Stougaard, J.; Voinnet, O. Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus. Plant Physiol. 2012, 160, 2137–2154. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.; Li, Q.; Wei, H.; Chang, M.-J.; Tunlaya-Anukit, S.; Kim, H.; Liu, J.; Song, J.; Sun, Y.-H.; Yuan, L. Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa. Proc. Natl. Acad. Sci. USA 2013, 110, 10848–10853. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Burd, S.; Lers, A. miR408 is involved in abiotic stress responses in Arabidopsis. Plant J. 2015, 84, 169–187. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.; Zhang, Q.; Wang, Q.; Wang, X.; Liu, J.; Li, M.; Huang, L.; Kang, Z. Target of tae-miR408, a chemocyanin-like protein gene (TaCLP1), plays positive roles in wheat response to high-salinity, heavy cupric stress and stripe rust. Plant Mol. Biol. 2013, 83, 433–443. [Google Scholar] [CrossRef] [PubMed]
- Maunoury, N.; Vaucheret, H. AGO1 and AGO2 act redundantly in miR408-mediated Plantacyanin regulation. PLoS ONE 2011, 6, e28729. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Hu, H.; Zhu, L.; Li, R.; Feng, Y.; Zhang, L.; Yang, Y.; Liu, X.; Zhang, H. Involvement of miR528 in the regulation of arsenite tolerance in rice (Oryza sativa L.). J. Agric. Food Chem. 2015, 63, 8849–8861. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Li, Z.; Li, D.; Yuan, N.; Hu, Q.; Luo, H. Constitutive expression of rice microRNA528 alters plant development and enhances tolerance to salinity stress and nitrogen starvation in creeping bentgrass. Plant Physiol. 2015, 1, 576–593. [Google Scholar] [CrossRef]
- Sun, Q.; Liu, X.; Yang, J.; Liu, W.; Du, Q.; Wang, H.; Fu, C.; Li, W.-X. microRNA528 affects lodging resistance of maize by regulating lignin biosynthesis under nitrogen-luxury conditions. Mol. Plant 2018, 11, 806–814. [Google Scholar] [CrossRef]
- Wu, J.; Yang, R.; Yang, Z.; Yao, S.; Zhao, S.; Wang, Y.; Li, P.; Song, X.; Jin, L.; Zhou, T.; et al. ROS accumulation and antiviral defence control by microRNA528 in rice. Nat. Plants 2017, 3, 16203. [Google Scholar] [CrossRef]
- Chuck, G.; Whipple, C.; Jackson, D.; Hake, S. The maize SBP-box transcription factor encoded by tasselsheath4 regulates bract development and the establishment of meristem boundaries. Development 2010, 137, 1243–1250. [Google Scholar] [CrossRef]
- Suetsugu, N.; Higa, T.; Wada, M. Ferns, mosses and liverworts as model systems for light-mediated chloroplast movements. Plant Cell Environ. 2017, 40, 2447–2456. [Google Scholar] [CrossRef] [PubMed]
- Du, Z.; Chen, A.; Chen, W.; Westwood, J.H.; Baulcombe, D.C.; Carr, J.P. Using a viral vector to reveal the role of miR159 in disease symptom induction by a severe strain of Cucumber mosaic virus. Plant Physiol. 2014, 164, 1378–1388. [Google Scholar] [CrossRef] [PubMed]
- Du, P.; Wu, J.; Zhang, J.; Zhao, S.; Zheng, H.; Gao, G.; Wei, L.; Li, Y. Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors. PLoS Pathog. 2011, 7, e1002176. [Google Scholar] [CrossRef] [PubMed]
- Song, J.B.; Gao, S.; Sun, D.; Li, H.; Shu, X.X.; Yang, Z.M. miR394 and LCR are involved in Arabidopsis salt and drought stress responses in an abscisic acid-dependent manner. BMC Plant Biol. 2013, 13, 210. [Google Scholar] [CrossRef] [PubMed]
- Chand, S.K.; Nanda, S.; Joshi, R.K. Regulation of miR394 in response to Fusarium oxysporum f. sp. cepae (FOC) infection in Garlic (Allium sativum L). Front. Plant Sci. 2016, 7, 258. [Google Scholar] [CrossRef]
- Navarro, L.; Dunoyer, P.; Jay, F.; Arnold, B.; Dharmasiri, N.; Estelle, M.; Voinnet, O.; Jones, J.D.G. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 2006, 312, 436–439. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.-I.; Santi, C.; Jobet, E.; Lacut, E.; El Kholti, N.; Karlowski, W.M.; Verdeil, J.-L.; Breitler, J.C.; Périn, C.; Ko, S.-S. Complex regulation of two target genes encoding SPX-MFS proteins by rice miR827 in response to phosphate starvation. Plant Cell Physiol. 2010, 51, 2119–2131. [Google Scholar] [CrossRef]
- Hewezi, T.; Piya, S.; Qi, M.; Balasubramaniam, M.; Rice, J.H.; Baum, T.J. Arabidopsis miR827 mediates post-transcriptional gene silencing of its ubiquitin E3 ligase target gene in the syncytium of the cyst nematode Heterodera schachtii to enhance susceptibility. Plant J. 2016, 88, 179–192. [Google Scholar] [CrossRef]
- Chávez-Hernández, E.C.; Alejandri-Ramírez, N.D.; Juárez-González, V.T.; Dinkova, T.D. Maize miRNA and target regulation in response to hormone depletion and light exposure during somatic embryogenesis. Front. Plant Sci. 2015, 6, 555. [Google Scholar]
- Enright, A.J.; John, B.; Gaul, U.; Tuschl, T.; Sander, C.; Marks, D.S. microRNA targets in Drosophila. Genome Biol. 2004, 5, R1. [Google Scholar] [CrossRef]
Category | Mock | SCMV | MCMV | S+M | ||||
---|---|---|---|---|---|---|---|---|
Total | Unique | Total | Unique | Total | Unique | Total | Unique | |
Raw reads | 10,042,093 | - | 10,107,781 | - | 10,544,484 | - | 11,306,497 | - |
Clean reads | 9,759,612 | 2,126,945 | 9,892,919 | 1,259,696 | 10,217,242 | 2,180,375 | 11,026,769 | 1,253,995 |
Annotated sequences a | 3,889,735 | 228,265 | 1,212,784 | 114,841 | 3,466,463 | 215,610 | 793,418 | 86,612 |
miRBase (version 21.0) | 184,429 | 3981 | 323,206 | 5216 | 170,066 | 3806 | 130,396 | 3516 |
ncRNA | 3,140,721 | 138,394 | 731,977 | 72,289 | 2,848,339 | 132,250 | 549,274 | 58,696 |
Rfam (version 10) b | 564,585 | 85,890 | 157,601 | 37,336 | 448,058 | 79,554 | 113,748 | 24,400 |
Unannotated sequences | 5,869,877 | 1,898,680 | 8,680,135 | 1,144,855 | 6,750,779 | 1,964,765 | 10,233,351 | 1,167,383 |
SCMV-derived siRNAs c | - | - | 6,740,592 | - | - | - | 6,520,905 | - |
MCMV-derived siRNAs c | - | - | - | - | 1,255,641 | - | 2,044,540 | - |
Novel miRNA | Sequence | Size | Reads a | LP | MFEI | miRNA* | Loci | |||
---|---|---|---|---|---|---|---|---|---|---|
Mock | SCMV | MCMV | S + M | |||||||
miRn-01 | UUGUUGUGUUUCAACUCUAGCCU | 23 | 0.00 | 3.23 | 18.79 | 0.00 | 88 | 0.66 | 1 | |
miRn-02 | UUAAAUCUGGACCCUUCAUCU | 21 | 8.20 | 1.82 | 5.97 | 1.63 | 200 | 1.33 | Yes b | 1 |
miRn-03 | UGUCGUGCACUUGGUGAACACC | 22 | 5.74 | 5.16 | 8.03 | 3.26 | 179 | 0.71 | 1 | |
miRn-04 | UGUCAAUAAGGGCCUGCCUCUGA | 23 | 0.00 | 5.76 | 0.00 | 0.00 | 174 | 0.96 | 1 | |
miRn-05 | UGUCAAUAAGGGCCUACCUCUGA | 23 | 2.87 | 56.10 | 2.35 | 7.71 | 175 | 0.99 | 1 | |
miRn-06 | UGGCGAUGGAAGCUCUGCUUC | 21 | 0.00 | 6.27 | 0.00 | 1.72 | 174 | 0.94 | 1 | |
miRn-07 | UGGCGAUGAGAGUGGUAGCUC | 21 | 0.00 | 33.86 | 0.59 | 9.16 | 235 | 0.84 | Yes | 1 |
miRn-08 | UGCCUGCCUCUUCCAUUCCUUC | 22 | 28.18 | 16.58 | 17.81 | 3.08 | 145 c | 0.90 d | Yes | 2 |
miRn-09 | UGCAUUUUUAGGUCCUUGAAC | 21 | 0.00 | 3.74 | 0.00 | 3.63 | 207 | 1.08 | Yes | 1 |
miRn-10 | UGACUCACUCUUACCGCCCAUG | 22 | 0.00 | 5.66 | 0.00 | 2.27 | 124 | 0.65 | 1 | |
miRn-11 | UGACGCAACACCGUUGGAUGU | 21 | 0.00 | 0.00 | 0.00 | 5.99 | 235 | 1.69 | Yes | 1 |
miRn-12 | UGACAGAAGAGAGUGAGCACA | 21 | 4.71 | 12.84 | 7.05 | 7.35 | 177 | 0.92 | 7 | |
miRn-13 | UGAACUUUUGUACUUUUGGGCC | 22 | 2.66 | 0.51 | 3.23 | 0.00 | 216 | 1.57 | 1 | |
miRn-14 | UGAACACCAUGCUGUUGGCUCC | 22 | 0.00 | 0.00 | 0.00 | 4.90 | 102 | 0.64 | 1 | |
miRn-15 | UCGGUUUUGUGGCUUCCAAAC | 21 | 0.00 | 4.04 | 0.00 | 0.91 | 129 | 1.32 | Yes | 6 |
miRn-16 | UCGGACCAGGCUUCAUUCCCC | 21 | 18867 | 3170 | 21041 | 2736 | 150 | 0.89 | 7 | |
miRn-17 | UCCAGACGUAACCGAACAAGC | 21 | 3.79 | 3.84 | 2.94 | 2.54 | 145 | 1.04 | 7 | |
miRn-18 | UCCAAUCUUCCCGUGAUCCCG | 21 | 3.07 | 1.01 | 4.01 | 0.54 | 120 | 1.35 | Yes | 1 |
miRn-19 | UACUUGACUGAGGUGCUUGGCC | 22 | 0.72 | 0.00 | 3.03 | 0.00 | 190 | 0.71 | 1 | |
miRn-20 | UAAUUACAUAGGUUAGGACUA | 21 | 2.25 | 3.03 | 2.84 | 1.63 | 202 | 1.72 | 1 | |
miRn-21 | GGCCCGCCGAUCACGUCGUGC | 21 | 16.91 | 7.58 | 7.24 | 0.00 | 107 | 0.74 | 2 | |
miRn-22 | GAGGAUUGAAGGGAUUAAAUC | 21 | 0.00 | 3.23 | 0.00 | 0.00 | 107 | 1.39 | 1 | |
miRn-23 | GAGAGAAUCUGGCUGUGAGAAGA | 23 | 3.38 | 0.81 | 1.08 | 0.00 | 118 | 0.70 | 4 | |
miRn-24 | CGGGAACUGGAGAUGCUACUC | 21 | 17.52 | 4.25 | 17.42 | 5.26 | 203 | 1.06 | Yes | 1 |
miRn-25 | CGAGAGUGACGAAGAAAAUCGA | 22 | 1.74 | 0.00 | 6.66 | 0.00 | 142 | 0.68 | 2 | |
miRn-26 | CCUUAAUAAUCUGAAUCCGCGG | 22 | 3.89 | 4.75 | 0.00 | 1.90 | 226 | 1.51 | 1 | |
miRn-27 | CCGUGGCUCCUGCUCCUGAUG | 21 | 0.00 | 3.64 | 0.00 | 0.73 | 186 | 0.98 | 2 | |
miRn-28 | CCCGCCGGCGAGCGCUUUCCU | 21 | 143.55 | 11.52 | 154.64 | 12.06 | 132 | 0.83 | Yes | 4 |
miRn-29 | CACUUUAGGACCACAAAUAAG | 21 | 0.92 | 4.65 | 0.00 | 2.09 | 153 | 1.53 | 6 | |
miRn-30 | CACGGAUACUUUUGGGGCACC | 21 | 0.00 | 11.83 | 16.44 | 0.00 | 110 | 0.68 | 1 | |
miRn-31 | CACCAACUACUGAUUCAGAGGC | 22 | 1.13 | 0.00 | 5.68 | 2.18 | 101 | 0.64 | 1 | |
miRn-32 | CAAGCAUAAAGGUGAAAGGACC | 22 | 0.00 | 0.00 | 0.00 | 3.36 | 210 | 1.21 | Yes | 1 |
miRn-33 | CAAAGAGAAUUGAGGGGGCUA | 21 | 0.00 | 7.58 | 0.00 | 2.18 | 139 | 1.61 | 6 | |
miRn-34 | AUUUUAGCCCCUCCAAUCUCC | 21 | 7.27 | 2.93 | 10.47 | 1.90 | 146 | 1.28 | 9 | |
miRn-35 | AUUGGAGGGGAUUGAGGAGGCU | 22 | 7.79 | 4.04 | 3.91 | 1.18 | 143 | 1.48 | 2 | |
miRn-36 | AUGCGGAGAGGCUCUCGAGAGA | 22 | 47.95 | 91.38 | 153.17 | 52.51 | 189 | 0.92 | Yes | 1 |
miRn-37 | AGUUCGGUCAUCCUGUAGUGAC | 22 | 4.92 | 1.52 | 6.26 | 1.81 | 201 | 1.16 | Yes | 2 |
miRn-38 | AGUAAAUCCCGUCGGUACCCG | 21 | 2.15 | 0.00 | 6.26 | 0.00 | 145 | 1.38 | 3 | |
miRn-39 | AGGACUGGAUCGCCGGAGGGU | 21 | 0.00 | 0.00 | 8.12 | 0.00 | 63 | 0.59 | 1 | |
miRn-40 | AGCGGUGGAAGGGGCAUGCAGA | 22 | 0.72 | 4.95 | 1.76 | 1.09 | 156 | 0.85 | Yes | 1 |
miRn-41 | AGCCGUCGGACAUAAGCUUAUC | 22 | 0.00 | 6.37 | 0.00 | 2.45 | 80 | 1.35 | 2 | |
miRn-42 | AGAGGAUUGAAGGGAUUAAAUC | 22 | 0.00 | 3.23 | 1.37 | 2.00 | 107 | 1.44 | Yes | 2 |
miRn-43 | AGAAACACGUCCCUGUCAGGGC | 22 | 1.95 | 2.53 | 13.80 | 3.99 | 168 | 1.11 | 1 | |
miRn-44 | ACGACUCGAUGCUCGGCACCU | 21 | 5.43 | 0.00 | 0.00 | 0.63 | 55 | 0.58 | 1 | |
miRn-45 | ACCGGAGGAGGUUAGAGGAGC | 21 | 20.19 | 45.49 | 15.46 | 8.34 | 134 | 1.03 | Yes | 1 |
miRn-46 | AAGGAGGUCCUGGACACAUAAG | 22 | 0.00 | 2.93 | 3.82 | 2.09 | 242 | 1.18 | 1 | |
miRn-47 | AACCGGAAGACCUAGAGCUAACU | 23 | 0.00 | 0.00 | 0.00 | 3.36 | 50 | 0.51 | 1 | |
miRn-48 | AAACAAUGUUUGGUUGCCUGGUC | 23 | 11.07 | 1.72 | 9.00 | 1.18 | 81 | 0.81 | 3 | |
miRn-49 | AAAAGACUGAGCCGAAUUGAAAU | 23 | 6.35 | 0.00 | 2.74 | 0.00 | 92 | 1.25 | 7 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xia, Z.; Zhao, Z.; Gao, X.; Jiao, Z.; Wu, Y.; Zhou, T.; Fan, Z. Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus. Int. J. Mol. Sci. 2019, 20, 3146. https://doi.org/10.3390/ijms20133146
Xia Z, Zhao Z, Gao X, Jiao Z, Wu Y, Zhou T, Fan Z. Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus. International Journal of Molecular Sciences. 2019; 20(13):3146. https://doi.org/10.3390/ijms20133146
Chicago/Turabian StyleXia, Zihao, Zhenxing Zhao, Xinran Gao, Zhiyuan Jiao, Yuanhua Wu, Tao Zhou, and Zaifeng Fan. 2019. "Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus" International Journal of Molecular Sciences 20, no. 13: 3146. https://doi.org/10.3390/ijms20133146
APA StyleXia, Z., Zhao, Z., Gao, X., Jiao, Z., Wu, Y., Zhou, T., & Fan, Z. (2019). Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus. International Journal of Molecular Sciences, 20(13), 3146. https://doi.org/10.3390/ijms20133146