Role of Klf4 in the Regulation of Apoptosis and Cell Cycle in Rat Granulosa Cells during the Periovulatory Period
Abstract
1. Introduction
2. Results
2.1. LH Regulates the Expression of Klf4, Bcl-2, and Cell Cycle Genes in Preovulatory GCs
2.2. Effect of Klf4 on Expression of Apoptosis-Related and Cell Cycle-Related Genes in Preovulatory GCs
2.3. Klf4 Overexpression Reduces Cell Viability and Proliferation of GCs
2.4. Klf4 Overexpression Induces Apoptosis and Promotes Cell Cycle Arrest in GCs
3. Discussion
4. Materials and Methods
4.1. Animals and Reagents
4.2. Preparation and Culture of Preovulatory Granulosa Cells
4.3. Plasmid Construction and Transfection
4.4. Total RNA Extraction and Real-Time Quantitative RT-PCR Analysis
4.5. Western Blot Analysis
4.6. Cell Counting Kit-8 Assays
4.7. Caspase 3/7 Assays
4.8. 5-Bromo-2′-Deoxyuridine (BrdU) Incorporation
4.9. Flow Cytometric Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hirshfield, A.N. Development of follicles in the mammalian ovary. Int. Rev. Cytol. 1991, 124, 43–101. [Google Scholar] [PubMed]
- Leo, C.P.; Pisarska, M.D.; Hsueh, A.J. DNA array analysis of changes in preovulatory gene expression in the rat ovary. Biol. Reprod. 2001, 65, 269–276. [Google Scholar] [CrossRef] [PubMed]
- Espey, L.L.; Richards, J.S. Temporal and spatial patterns of ovarian gene transcription following an ovulatory dose of gonadotropin in the rat. Biol. Reprod. 2002, 67, 1662–1670. [Google Scholar] [CrossRef] [PubMed]
- Black, A.R.; Black, J.D.; Azizkhan-Clifford, J. Sp1 and krüppel-like factor family of transcription factors in cell growth regulation and cancer. J. Cell. Physiol. 2001, 188, 143–160. [Google Scholar] [CrossRef] [PubMed]
- Ghaleb, A.M.; Nandan, M.O.; Chanchevalap, S.; Dalton, W.B.; Hisamuddin, I.M.; Vincent, W.Y. Krüppel-like factors 4 and 5: The yin and yang regulators of cellular proliferation. Cell Res. 2005, 15, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Ohnishi, S.; Ohnami, S.; Laub, F.; Aoki, K.; Suzuki, K.; Kanai, Y.; Haga, K.; Asaka, M.; Ramirez, F.; Yoshida, T. Downregulation and growth inhibitory effect of epithelial-type Krüppel-like transcription factor KLF4, but not KLF5, in bladder cancer. Biochem. Biophys. Res. Commun. 2003, 308, 251–256. [Google Scholar] [CrossRef]
- Wang, J.; Place, R.F.; Huang, V.; Wang, X.; Noonan, E.J.; Magyar, C.E.; Huang, J.; Li, L.-C. Prognostic value and function of KLF4 in prostate cancer: RNAa and vector-mediated overexpression identify KLF4 as an inhibitor of tumor cell growth and migration. Cancer Res. 2010, 70, 10182–10191. [Google Scholar] [CrossRef]
- Ji, J.; Wang, H.-S.; Gao, Y.-Y.; Sang, L.-M.; Zhang, L. Synergistic anti-tumor effect of KLF4 and curcumin in human gastric carcinoma cell line. Asian Pac. J. Cancer Prev. 2014, 15, 7747–7752. [Google Scholar] [CrossRef]
- Natesampillai, S.; Kerkvliet, J.; Leung, P.C.; Veldhuis, J.D. Regulation of Kruppel-like factor 4, 9, and 13 genes and the steroidogenic genes LDLR, StAR, and CYP11A in ovarian granulosa cells. Am. J. Physiol. Endocrinol. Metab. 2008, 294, E385–E391. [Google Scholar] [CrossRef]
- Xu, L.; Sun, H.; Zhang, M.; Jiang, Y.; Zhang, C.; Zhou, J.; Ding, L.; Hu, Y.; Yan, G. MicroRNA-145 protects follicular granulosa cells against oxidative stress-induced apoptosis by targeting Krüppel-like factor 4. Mol. Cell. Endocrinol. 2017, 452, 138–147. [Google Scholar] [CrossRef]
- Williams, G.T.; Smith, C.A. Molecular regulation of apoptosis: Genetic controls on cell death. Cell 1993, 74, 777–779. [Google Scholar] [CrossRef]
- Hirshfield, A.N. Effect of a low dose of pregnant mare’s serum gonadotropin on follicular recruitment and atresia in cycling rats. Biol. Reprod. 1986, 35, 113–118. [Google Scholar] [CrossRef]
- Liu, H.-C.; He, Z.; Rosenwaks, Z. Application of complementary DNA microarray (DNA chip) technology in the study of gene expression profiles during folliculogenesis. Fertil. Steril. 2001, 75, 947–955. [Google Scholar] [CrossRef]
- Robker, R.L.; Richards, J.S. Hormone-induced proliferation and differentiation of granulosa cells: A coordinated balance of the cell cycle regulators cyclin D2 and p27Kip1. Mol. Endocrinol. 1998, 12, 924–940. [Google Scholar] [CrossRef]
- Sherr, C.J. D-type cyclins. Trends Biochem. Sci. 1995, 20, 187–190. [Google Scholar] [CrossRef]
- Zhang, W.; Geiman, D.E.; Shields, J.M.; Dang, D.T.; Mahatan, C.S.; Kaestner, K.H.; Biggs, J.R.; Kraft, A.S.; Yang, V.W. The Gut-Enriched Kruppel-Like Factor (Kruppel-Like Factor 4) Mediates the Transactivating Effecto of p53 on the p21WAF1/Cip1 Promoter. J. Biol. Chem. 2000, 275, 18391–18398. [Google Scholar] [CrossRef] [PubMed]
- Shie, J.-L.; Chen, Z.Y.; Fu, M.; Pestell, R.G.; Tseng, C.-C. Gut-enriched Krüppel-like factor represses cyclin D1 promoter activity through Sp1 motif. Nucleic Acids Res. 2000, 28, 2969–2976. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.Y.; Shie, J.-L.; Tseng, C.-C. Gut-enriched Krüppel-like factor represses ornithine decarboxylase gene expression and functions as checkpoint regulator in colonic cancer cells. J. Biol. Chem. 2002, 277, 46831–46839. [Google Scholar] [CrossRef] [PubMed]
- Wei, D.; Kanai, M.; Jia, Z.; Le, X.; Xie, K. Krüppel-like factor 4 induces p27Kip1 expression in and suppresses the growth and metastasis of human pancreatic cancer cells. Cancer Res. 2008, 68, 4631–4639. [Google Scholar] [CrossRef] [PubMed]
- Yoon, H.S.; Chen, X.; Yang, V.W. Krüppel-like factor 4 mediates p53-dependent G1/S cell cycle arrest in response to DNA damage. J. Biol. Chem. 2003, 278, 2101–2105. [Google Scholar] [CrossRef]
- Rowland, B.D.; Peeper, D.S. KLF4, p21 and context-dependent opposing forces in cancer. Nat. Rev. Cancer 2006, 6, 11–23. [Google Scholar] [CrossRef] [PubMed]
- Toyoshima, H.; Hunter, T. p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell 1994, 78, 67–74. [Google Scholar] [CrossRef]
- Hengst, L.; Reed, S.I. Translational control of p27Kip1 accumulation during the cell cycle. Science 1996, 271, 1861–1864. [Google Scholar] [CrossRef] [PubMed]
- Hussein, M.R. Apoptosis in the ovary: Molecular mechanisms. Hum. Reprod. Update 2005, 11, 162–178. [Google Scholar] [CrossRef] [PubMed]
- Robker, R.L.; Richards, J.S. Hormonal control of the cell cycle in ovarian cells: Proliferation versus differentiation. Biol. Reprod. 1998, 59, 476–482. [Google Scholar] [CrossRef] [PubMed]
- Chaffin, C.L.; Schwinof, K.M.; Stouffer, R.L. Gonadotropin and steroid control of granulosa cell proliferation during the periovulatory interval in rhesus monkeys. Biol. Reprod. 2001, 65, 755–762. [Google Scholar] [CrossRef] [PubMed]
- Quirk, S.; Cowan, R.; Harman, R.; Hu, C.-L.; Porter, D. Ovarian follicular growth and atresia: The relationship between cell proliferation and survival. J. Anim. Sci. 2004, 82, E40–E52. [Google Scholar] [CrossRef]
- Markström, E.; Svensson, E.C.; Shao, R.; Svanberg, B.; Billig, H. Survival factors regulating ovarian apoptosis—Dependence on follicle differentiation. Reproduction 2002, 123, 23–30. [Google Scholar] [CrossRef]
- Oltvai, Z.N.; Milliman, C.L.; Korsmeyer, S.J. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993, 74, 609–619. [Google Scholar] [CrossRef]
- Lakhani, S.A.; Masud, A.; Kuida, K.; Porter, G.A.; Booth, C.J.; Mehal, W.Z.; Inayat, I.; Flavell, R.A. Caspases 3 and 7, key mediators of mitochondrial events of apoptosis. Science 2006, 311, 847–851. [Google Scholar] [CrossRef]
- Yoon, O.; Roh, J. Downregulation of KLF4 and the Bcl-2/Bax ratio in advanced epithelial ovarian cancer. Oncol. Lett. 2012, 4, 1033–1036. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Zhao, J.; Li, Q.; Yang, W.; Song, Q.; Li, W.; Liu, J. KLF4 promotes hydrogen-peroxide-induced apoptosis of chronic myeloid leukemia cells involving the bcl-2/bax pathway. Cell Stress Chaperones 2010, 15, 905–912. [Google Scholar] [CrossRef] [PubMed]
- Whitlock, N.C.; Bahn, J.H.; Lee, S.-H.; Eling, T.E.; Baek, S.J. Resveratrol-induced apoptosis is mediated by early growth response-1, Krüppel-like factor 4, and activating transcription factor 3. Cancer Prev. Res. 2011, 4, 116–127. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Zhao, M.-Z.; Cui, N.-P.; Lin, D.-D.; Zhang, A.-Y.; Qin, Y.; Liu, C.-Y.; Yan, W.-T.; Shi, J.-H.; Chen, B.-P. Krüppel-like factor 4 induces apoptosis and inhibits tumorigenic progression in SK-BR-3 breast cancer cells. FEBS Open Bio 2015, 5, 147–154. [Google Scholar] [CrossRef]
- Chun, S.Y.; Billig, H.; Tilly, J.L.; Furuta, I.; Tsafriri, A.; Hsueh, A.J. Gonadotropin suppression of apoptosis in cultured preovulatory follicles: Mediatory role of endogenous insulin-like growth factor I. Endocrinology 1994, 135, 1845–1853. [Google Scholar] [CrossRef] [PubMed]
- Kaipia, A.; Hsueh, A.J. Regulation of ovarian follicle atresia. Annu. Rev. Physiol. 1997, 59, 349–363. [Google Scholar] [CrossRef]
- Chouzouris, T.M.; Dovolou, E.; Krania, F.; Pappas, I.S.; Dafopoulos, K.; Messinis, I.E.; Anifandis, G.; Amiridis, G.S. Effects of ghrelin on activation of Akt1 and ERK1/2 pathways during in vitro maturation of bovine oocytes. Zygote 2017, 25, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Dovolou, E.; Messinis, I.E.; Periquesta, E.; Dafopoulos, K.; Gutierrez-Adan, A.; Amiridis, G.S. Ghrelin accelerates in vitro maturation of bovine oocytes. Reprod. Domest. Anim. 2014, 49, 665–672. [Google Scholar] [CrossRef]
- Strober, W. Trypan blue test of cell viability. Curr. Protoc. Immunol. 2001, 21, A.3B.1–A.3B.2. [Google Scholar]
Gene | Primer Sequence (5′-3′) | Product Size (bp) | Accession Number |
---|---|---|---|
Klf4 | F: GAGAGGAACTCTCTCACATGAAGC | 185 | NM_053713.1 |
R: AAGGATAAAGTCTAGGTCCAGGAGA | |||
Bax | F: TGTTTGCTGATGGCAACTTC | 104 | NM_017059.1 |
R: GATCAGCTCGGGCACTTTAG | |||
Bcl-2 | F: GGGATGCCTTTGTGGAACTA | 138 | NM_016993.1 |
R: CTCACTTGTGGCCCAGGTAT | |||
Cyclin D1 | F: TCAAGTGTGACCCGGACTG | 213 | NM_171992.4 |
R: CACTACTTGGTGACTCCCGC | |||
Cyclin D2 | F: CGATGATCGCAACTGGAAGC | 232 | NM_022267.1 |
R: TGGTCCGGATCTTCCACAGA | |||
p21Cip1 | F: TGAGGGACCAGTACATGAGAACT | 192 | NM_031515.1 |
R: GAGCCTGTTTCGTGTCTACTGTT | |||
p27Kip1 | F: TCGCGGCTCCGAGACTT | 204 | NM_031762.3 |
R: TCTCCAAGTCCCGGGTTAGT | |||
18S rRNA | F: CGCGGTTCTATTTTGTTGGT | 218 | M11188.1 |
R: AGTCGGCATCGTTTATGGTC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, H.; Roh, J. Role of Klf4 in the Regulation of Apoptosis and Cell Cycle in Rat Granulosa Cells during the Periovulatory Period. Int. J. Mol. Sci. 2019, 20, 87. https://doi.org/10.3390/ijms20010087
Choi H, Roh J. Role of Klf4 in the Regulation of Apoptosis and Cell Cycle in Rat Granulosa Cells during the Periovulatory Period. International Journal of Molecular Sciences. 2019; 20(1):87. https://doi.org/10.3390/ijms20010087
Chicago/Turabian StyleChoi, Hyeonhae, and Jaesook Roh. 2019. "Role of Klf4 in the Regulation of Apoptosis and Cell Cycle in Rat Granulosa Cells during the Periovulatory Period" International Journal of Molecular Sciences 20, no. 1: 87. https://doi.org/10.3390/ijms20010087
APA StyleChoi, H., & Roh, J. (2019). Role of Klf4 in the Regulation of Apoptosis and Cell Cycle in Rat Granulosa Cells during the Periovulatory Period. International Journal of Molecular Sciences, 20(1), 87. https://doi.org/10.3390/ijms20010087