A Systematic Study of RNAi Effects and dsRNA Stability in Tribolium castaneum and Acyrthosiphon pisum, Following Injection and Ingestion of Analogous dsRNAs
Abstract
1. Introduction
2. Results
2.1. Expression of VTE and IAP during the Development of A. pisum and T. castaneum
2.2. Effect of Injected dsRNAs on Phenotype and Target Gene Expression
2.3. Oral Delivery of dsRNA
2.3.1. Stability of dsRNAs in Insect Diets
2.3.2. Oral Delivery of dsRNAs: Phenotype and Gene Suppression
2.4. In Vitro Stability of dsRNA
2.4.1. Variable Persistence of dsRNAs in Insect Haemolymph
2.4.2. Variable Persistence of dsRNAs in Insect Gut Extracts
3. Discussion
4. Materials and Methods
4.1. Insects
4.2. Cloning of VTE and IAP Gene Sequences for dsRNA Production
4.3. Production of dsRNA: In Vitro Transcription
4.4. Analysis of Gene Expression by Quantitative PCR
4.5. Expression of VTE and (IAP) during the Life Cycle of T. castaneum and A. pisum
4.6. Delivery of dsRNA to Insects
4.6.1. Injection
4.6.2. Feeding
4.7. In Vitro Stability of dsRNA in Insect Tissues
4.7.1. Tissue Extract Preparation
4.7.2. In Vitro dsRNA and dsDNA Gut Stability Assays
4.7.3. In Vitro dsRNA Haemolymph Stability Assays
4.8. Statistical Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Kennerdell, J.R.; Carthew, R.W. Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 1998, 95, 1017–1026. [Google Scholar] [CrossRef]
- Misquitta, L.; Paterson, B.M. Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): A role for nautilus in embryonic somatic muscle formation. Proc. Natl. Acad. Sci. USA 1999, 96, 1451–1456. [Google Scholar] [CrossRef] [PubMed]
- Baum, J.A.; Bogaert, T.; Clinton, W.; Heck, G.R.; Feldmann, P.; Ilagan, O.; Johnson, S.; Plaetinck, G.; Munyikwa, T.; Pleau, M. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef] [PubMed]
- Bucher, G.; Scholten, J.; Klingler, M. Parental RNAi in Tribolium (coleoptera). Curr. Biol. 2002, 12, R85–R86. [Google Scholar] [CrossRef]
- Tomoyasu, Y.; Denell, R.E. Larval RNAi in Tribolium (Coleoptera) for analyzing adult development. Dev. Genes Evol. 2004, 214, 575–578. [Google Scholar] [CrossRef] [PubMed]
- Arakane, Y.; Muthukrishnan, S.; Beeman, R.W.; Kanost, M.R.; Kramer, K.J. Laccase 2 is the phenoloxidase gene required for beetle cuticle tanning. Proc. Natl. Acad. Sci. USA 2005, 102, 11337–11342. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.C.; Miyata, K.; Brown, S.J.; Tomoyasu, Y. Dissecting systemic RNA interference in the red flour beetle Tribolium castaneum: Parameters affecting the efficiency of RNAi. PLoS ONE 2012, 7, e47431. [Google Scholar] [CrossRef] [PubMed]
- Bolognesi, R.; Ramaseshadri, P.; Anderson, J.; Bachman, P.; Clinton, W.; Flannagan, R.; Ilagan, O.; Lawrence, C.; Levine, S.; Moar, W. Characterizing the mechanism of action of double-stranded RNA activity against western corn rootworm (Diabrotica virgifera virgifera LeConte). PLoS ONE 2012, 7, e47534. [Google Scholar] [CrossRef] [PubMed]
- Broehan, G.; Kroeger, T.; Lorenzen, M.; Merzendorfer, H. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum. BMC Genom. 2013, 14, 6. [Google Scholar] [CrossRef] [PubMed]
- San Miguel, K.; Scott, J.G. The next generation of insecticides: dsRNA is stable as a foliar-applied insecticide. Pest Manag. Sci. 2016, 72, 801–809. [Google Scholar] [CrossRef] [PubMed]
- Araujo, R.; Santos, A.; Pinto, F.; Gontijo, N.; Lehane, M.; Pereira, M. RNA interference of the salivary gland nitrophorin 2 in the triatomine bug Rhodnius prolixus (Hemiptera: Reduviidae) by dsRNA ingestion or injection. Insect Biochem. Mol. Biol. 2006, 36, 683–693. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.-B.; Cai, W.-J.; Wang, J.-W.; Hong, G.-J.; Tao, X.-Y.; Wang, L.-J.; Huang, Y.-P.; Chen, X.-Y. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotechnol. 2007, 25, 1307–1313. [Google Scholar] [CrossRef] [PubMed]
- Pitino, M.; Coleman, A.D.; Maffei, M.E.; Ridout, C.J.; Hogenhout, S.A. Silencing of aphid genes by dsRNA feeding from plants. PLoS ONE 2011, 6, e25709. [Google Scholar] [CrossRef] [PubMed]
- Zha, W.; Peng, X.; Chen, R.; Du, B.; Zhu, L.; He, G. Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens. PLoS ONE 2011, 6, e20504. [Google Scholar] [CrossRef] [PubMed]
- Turner, C.; Davy, M.; MacDiarmid, R.; Plummer, K.; Birch, N.; Newcomb, R. RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-stranded RNA feeding. Insect Mol. Biol. 2006, 15, 383–391. [Google Scholar] [CrossRef] [PubMed]
- Tian, H.; Peng, H.; Yao, Q.; Chen, H.; Xie, Q.; Tang, B.; Zhang, W. Developmental control of a lepidopteran pest Spodoptera exigua by ingestion of bacteria expressing dsRNA of a non-midgut gene. PLoS ONE 2009, 4, e6225. [Google Scholar] [CrossRef] [PubMed]
- Bautista, M.A.M.; Miyata, T.; Miura, K.; Tanaka, T. RNA interference-mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochem. Mol. Biol. 2009, 39, 38–46. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Pandit, S.S.; Baldwin, I.T. Tobacco rattle virus vector: A rapid and transient means of silencing Manduca sexta genes by plant mediated RNA interference. PLoS ONE 2012, 7, e31347. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, M.; Zhang, H. RNA interference of four genes in adult Bactrocera dorsalis by feeding their dsRNAs. PLoS ONE 2011, 6, e17788. [Google Scholar] [CrossRef] [PubMed]
- Bellés, X.; Piulachs, M.-D. Structural and RNAi characterization of the German cockroach lipophorin receptor, and the evolutionary relationships of lipoprotein receptors. BMC Mol. Biol. 2007, 8, 53. [Google Scholar]
- Revuelta, L.; Piulachs, M.; Bellés, X.; Castañera, P.; Ortego, F.; Díaz-Ruíz, J.; Hernández-Crespo, P.; Tenllado, F. RNAi of ace1 and ace2 in Blattella germanica reveals their differential contribution to acetylcholinesterase activity and sensitivity to insecticides. Insect Biochem. Mol. Biol. 2009, 39, 913–919. [Google Scholar] [CrossRef] [PubMed]
- Guo, G.-Z.; Geng, Y.-J.; Huang, D.-N.; Xue, C.-F.; Zhang, R.-L. Level of CYP4G19 expression is associated with pyrethroid resistance in Blattella germanica. J. Parasitol. Res. 2010, 2010. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Huang, J.-H.; Lee, H.-J. RNA interference unveils functions of the hypertrehalosemic hormone on cyclic fluctuation of hemolymph trehalose and oviposition in the virgin female Blattella germanica. J. Insect Physiol. 2011, 57, 858–864. [Google Scholar] [CrossRef] [PubMed]
- Hunter, W.; Ellis, J.; Hayes, J.; Westervelt, D.; Glick, E.; Williams, M.; Sela, I.; Maori, E.; Pettis, J.; Cox-Foster, D. Large-scale field application of RNAi technology reducing Israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 2010, 6, e1001160. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Wheeler, M.M.; Oi, F.M.; Scharf, M.E. RNA interference in the termite Reticulitermes flavipes through ingestion of double-stranded RNA. Insect Biochem. Mol. Biol. 2008, 38, 805–815. [Google Scholar] [CrossRef] [PubMed]
- Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.-L.; Barthel, A. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Gu, L.; Knipple, D.C. Recent advances in RNA interference research in insects: Implications for future insect pest management strategies. Crop Prot. 2013, 45, 36–40. [Google Scholar] [CrossRef]
- Scott, J.G.; Michel, K.; Bartholomay, L.C.; Siegfried, B.D.; Hunter, W.B.; Smagghe, G.; Zhu, K.Y.; Douglas, A.E. Towards the elements of successful insect RNAi. J. Insect Physiol. 2013, 59, 1212–1221. [Google Scholar] [CrossRef] [PubMed]
- Bellés, X. Beyond Drosophila: RNAi in vivo and functional genomics in insects. Annu. Rev. Entomol. 2010, 55, 111–128. [Google Scholar] [CrossRef] [PubMed]
- Joga, M.R.; Zotti, M.J.; Smagghe, G.; Christiaens, O. RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: What we know so far. Front. Physiol. 2016, 7, 553. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Khan, S.A.; Heckel, D.G.; Bock, R. Next-generation insect-resistant plants: RNAi-mediated crop protection. Trends Biotechnol. 2017, 35, 871–882. [Google Scholar] [CrossRef] [PubMed]
- Kanakala, S.; Ghanim, M. RNA interference in insect vectors for plant viruses. Viruses 2016, 8, 329. [Google Scholar] [CrossRef] [PubMed]
- Whyard, S.; Singh, A.D.; Wong, S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem. Mol. Biol. 2009, 39, 824–832. [Google Scholar] [CrossRef] [PubMed]
- El Halim, H.M.A.; Alshukri, B.M.; Ahmad, M.S.; Nakasu, E.Y.; Awwad, M.H.; Salama, E.M.; Gatehouse, A.M.; Edwards, M.G. RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum. Sci. Rep. 2016, 6, 29301. [Google Scholar] [CrossRef] [PubMed]
- Knorr, E.; Fishilevich, E.; Tenbusch, L.; Frey, M.L.; Rangasamy, M.; Billion, A.; Worden, S.E.; Gandra, P.; Arora, K.; Lo, W. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests. Sci. Rep. 2018, 8, 2061. [Google Scholar] [CrossRef] [PubMed]
- Revuelta, L.; Ortego, F.; Díaz-Ruíz, J.; Castañera, P.; Tenllado, F.; Hernández-Crespo, P. Contribution of Ldace1 gene to acetylcholinesterase activity in Colorado potato beetle. Insect Biochem. Mol. Biol. 2011, 41, 795–803. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Xu, J.; Palli, R.; Ferguson, J.; Palli, S.R. Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata. Pest Manag. Sci. 2011, 67, 175–182. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Khan, S.A.; Hasse, C.; Ruf, S.; Heckel, D.G.; Bock, R. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science 2015, 347, 991–994. [Google Scholar] [CrossRef] [PubMed]
- Prentice, K.; Christiaens, O.; Pertry, I.; Bailey, A.; Niblett, C.; Ghislain, M.; Gheysen, G.; Smagghe, G. RNAi-based gene silencing through dsRNA injection or ingestion against the African sweet potato weevil Cylas puncticollis (Coleoptera: Brentidae). Pest Manag. Sci. 2017, 73, 44–52. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, T.B.; Dhandapani, R.K.; Duan, J.J.; Palli, S.R. RNA interference in the Asian Longhorned Beetle: Identification of Key RNAi Genes and Reference Genes for RT-qPCR. Sci. Rep. 2017, 7, 8913. [Google Scholar] [CrossRef] [PubMed]
- Powell, M.E.; Bradish, H.M.; Gatehouse, J.A.; Fitches, E.C. Systemic RNAi in the small hive beetle Aethina tumida Murray (Coleoptera: Nitidulidae), a serious pest of the European honey bee Apis mellifera. Pest Manag. Sci. 2017, 73, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Christiaens, O.; Smagghe, G. The challenge of RNAi-mediated control of hemipterans. Curr. Opin. Insect Sci. 2014, 6, 15–21. [Google Scholar] [CrossRef]
- Christiaens, O.; Swevers, L.; Smagghe, G. DsRNA degradation in the pea aphid (Acyrthosiphon pisum) associated with lack of response in RNAi feeding and injection assay. Peptides 2014, 53, 307–314. [Google Scholar] [CrossRef] [PubMed]
- Abdellatef, E.; Will, T.; Koch, A.; Imani, J.; Vilcinskas, A.; Kogel, K.H. Silencing the expression of the salivary sheath protein causes transgenerational feeding suppression in the aphid Sitobion avenae. Plant Biotechnol. J. 2015, 13, 849–857. [Google Scholar] [CrossRef] [PubMed]
- Garbutt, J.S.; Bellés, X.; Richards, E.H.; Reynolds, S.E. Persistence of double-stranded RNA in insect hemolymph as a potential determiner of RNA interference success: Evidence from Manduca sexta and Blattella germanica. J. Insect Physiol. 2013, 59, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Song, H.; Zhang, J.; Li, D.; Cooper, A.M.; Silver, K.; Li, T.; Liu, X.; Ma, E.; Zhu, K.Y.; Zhang, J. A double-stranded RNA degrading enzyme reduces the efficiency of oral RNA interference in migratory locust. Insect Biochem. Mol. Biol. 2017, 86, 68–80. [Google Scholar] [CrossRef] [PubMed]
- Spit, J.; Philips, A.; Wynant, N.; Santos, D.; Plaetinck, G.; Broeck, J.V. Knockdown of nuclease activity in the gut enhances RNAi efficiency in the Colorado potato beetle, Leptinotarsa decemlineata, but not in the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 2017, 81, 103–116. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Peng, Y.; Pu, J.; Fu, W.; Wang, J.; Han, Z. Variation in RNAi efficacy among insect species is attributable to dsRNA degradation in vivo. Insect Biochem. Mol. Biol. 2016, 77, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Wynant, N.; Santos, D.; Verdonck, R.; Spit, J.; Van Wielendaele, P.; Broeck, J.V. Identification, functional characterization and phylogenetic analysis of double stranded RNA degrading enzymes present in the gut of the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 2014, 46, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.; Cai, Z.; Song, J.; Wu, Z.; Zhou, S. dsRNA uptake and persistence account for tissue-dependent susceptibility to RNA interference in the migratory locust, Locusta migratoria. Insect Mol. Biol. 2014, 23, 175–184. [Google Scholar] [CrossRef] [PubMed]
- Allen, M.L.; Walker, W.B., III. Saliva of Lygus lineolaris digests double stranded ribonucleic acids. J. Insect Physiol. 2012, 58, 391–396. [Google Scholar] [CrossRef] [PubMed]
- Lomate, P.R.; Bonning, B.C. Distinct properties of proteases and nucleases in the gut, salivary gland and saliva of southern green stink bug, Nezara viridula. Sci. Rep. 2016, 6, 27587. [Google Scholar] [CrossRef] [PubMed]
- Singh, I.K.; Singh, S.; Mogilicherla, K.; Shukla, J.N.; Palli, S.R. Comparative analysis of double-stranded RNA degradation and processing in insects. Sci. Rep. 2017, 7, 17059. [Google Scholar] [CrossRef] [PubMed]
- Wieczorek, H.; Grber, G.; Harvey, W.R.; Huss, M.; Merzendorfer, H.; Zeiske, W. Structure and regulation of insect plasma membrane H+ V-ATPase. J. Exp. Biol. 2000, 203, 127–135. [Google Scholar] [PubMed]
- Wieczorek, H.; Beyenbach, K.W.; Huss, M.; Vitavska, O. Vacuolar-type proton pumps in insect epithelia. J. Exp. Biol. 2009, 212, 1611–1619. [Google Scholar] [CrossRef] [PubMed]
- Wuriyanghan, H.; Falk, B.W. RNA interference towards the potato psyllid, Bactericera cockerelli, is induced in plants infected with recombinant Tobacco mosaic virus (TMV). PLoS ONE 2013, 8, e66050. [Google Scholar] [CrossRef] [PubMed]
- Fu, K.-Y.; Guo, W.-C.; Lü, F.-G.; Liu, X.-P.; Li, G.-Q. Response of the vacuolar ATPase subunit E to RNA interference and four chemical pesticides in Leptinotarsa decemlineata (Say). Pestic. Biochem. Physiol. 2014, 114, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Igaki, T.; Yamamoto-Goto, Y.; Tokushige, N.; Kanda, H.; Miura, M. Down-regulation of DIAP1 Triggers a NovelDrosophila Cell Death Pathway Mediated by Dark and DRONC. J. Biol. Chem. 2002, 277, 23103–23106. [Google Scholar] [CrossRef] [PubMed]
- Walker, W.B., III; Allen, M.L. RNA interference-mediated knockdown of IAP in Lygus lineolaris induces mortality in adult and pre-adult life stages. Entomol. Exp. Appl. 2011, 138, 83–92. [Google Scholar] [CrossRef]
- Powell, M.; Pyati, P.; Cao, M.; Bell, H.; Gatehouse, J.A.; Fitches, E. Insecticidal effects of dsRNA targeting the Diap1 gene in dipteran pests. Sci. Rep. 2017, 7, 15147. [Google Scholar] [CrossRef] [PubMed]
- Walker, W.B.; Allen, M.L. Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris. J. Insect Sci. 2010, 10, 173. [Google Scholar] [CrossRef] [PubMed]
- Arakane, Y.; Muthukrishnan, S.; Kramer, K.; Specht, C.; Tomoyasu, Y.; Lorenzen, M.; Kanost, M.; Beeman, R. The Tribolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix. Insect Mol. Biol. 2005, 14, 453–463. [Google Scholar] [CrossRef] [PubMed]
- Jaubert-Possamai, S.; Le Trionnaire, G.; Bonhomme, J.; Christophides, G.K.; Rispe, C.; Tagu, D. Gene knockdown by RNAi in the pea aphid Acyrthosiphon pisum. BMC Biotechnol. 2007, 7, 63. [Google Scholar] [CrossRef] [PubMed]
- Arimatsu, Y.; Kotani, E.; Sugimura, Y.; Furusawa, T. Molecular characterization of a cDNA encoding extracellular dsRNase and its expression in the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 2007, 37, 176–183. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, P.; Petfalski, E.; Shevchenko, A.; Mann, M.; Tollervey, D. The exosome: A conserved eukaryotic RNA processing complex containing multiple 3′→5′ exoribonucleases. Cell 1997, 91, 457–466. [Google Scholar] [CrossRef]
- Cheng, Z.-F.; Zuo, Y.; Li, Z.; Rudd, K.E.; Deutscher, M.P. The vacB Gene Required for Virulence in Shigella flexneri and Escherichia coli Encodes the Exoribonuclease RNase R. J. Biol. Chem. 1998, 273, 14077–14080. [Google Scholar] [CrossRef] [PubMed]
- Febvay, G.; Delobel, B.; Rahbé, Y. Influence of the amino acid balance on the improvement of an artificial diet for a biotype of Acyrthosiphon pisum (Homoptera: Aphididae). Can. J. Zool. 1988, 66, 2449–2453. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to Image J: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Bodnaryk, R.; Fields, P. A rapid and simple flour-disk bioassay for testing substances active against stored-product insects. Can. Entomol. 1996, 128, 865–875. [Google Scholar] [CrossRef]
- Arakawa, T. Phenylthiourea, an Effective Inhibitor of the Insect Haemolymph Melanization Reaction, Interferes with the Detection of Lipoprotein Hydroperoxide. Appl. Entomol. Zool. 1995, 30, 443–449. [Google Scholar] [CrossRef]
Gene (Accession No.) | Insect Species | Sequence 5′-3′ |
---|---|---|
V-type ATPase E subunit (XM_965528) | Tc | cDNA sub-cloning and in vitro transcription: F: TATCTCGAGACCAGGCGAGATATTCACAGC R: TATCTCGAGAAACGAGCCTCCAAGGTGTTG |
qPCR analyses: F: CCAAGCATTTTTAATGCA CCAC R: AACCACCACGACCTTGAATAG | ||
Inhibitor of Apoptosis (XM_969968.2) | Tc | cDNA sub-cloning and in vitro transcription: F: ATATCTAGAAGTTCGGCTGTAACTCCCG R: ATACTAGACATCCGGAACGTCTCACTCT |
qPCR analyses: F: AAGCGAAAAGTTGAGGCAAGC R: AACCATTGCTTTCTTACTCGAAGG | ||
GAPDH (XP_974181.1) | Tc | qPCR analyses: F: CCGGGATGGCGTTCAG R: CCAAACGCACCGTCAAATC |
V-type ATPase E subunit (XM_001946489) | Ap | cDNA sub-cloning and in vitro transcription: F: TATCTCGAGGGGCCGCCTGGT R: ATATCTAGACACGAACACGTAATGTGA |
qPCR analyses: F: CCGAGTATAAGGCAGCATCCA R: CTTATGTGCCAACAACTCAATACCA | ||
Inhibitor of Apoptosis (XM_001944122.3) | Ap | cDNA sub-cloning and in vitro transcription: F: TATCTCGAGGGTCTGAAGGACTGGGAAGAA R: GCTTCCGGCGTAGGTGTTCTAGAATA |
qPCR analyses: F: GATTATTGGCAACAAGGTGATGATC R: AACCAGCAGAAGAATCGTTAAAAAA | ||
GAPDH (NM_001293474.1) | Ap | qPCR analyses: F: CAATGGAAACAAGATCAAGGTGTT R: ACCAGCAGATCCCCATTGG |
Kanamycin resistance (JN638547) | - | F: AGGCTATTCGGCTATGAC R: CGATAGAAGGCGATGCG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, M.; Gatehouse, J.A.; Fitches, E.C. A Systematic Study of RNAi Effects and dsRNA Stability in Tribolium castaneum and Acyrthosiphon pisum, Following Injection and Ingestion of Analogous dsRNAs. Int. J. Mol. Sci. 2018, 19, 1079. https://doi.org/10.3390/ijms19041079
Cao M, Gatehouse JA, Fitches EC. A Systematic Study of RNAi Effects and dsRNA Stability in Tribolium castaneum and Acyrthosiphon pisum, Following Injection and Ingestion of Analogous dsRNAs. International Journal of Molecular Sciences. 2018; 19(4):1079. https://doi.org/10.3390/ijms19041079
Chicago/Turabian StyleCao, Min, John A. Gatehouse, and Elaine C. Fitches. 2018. "A Systematic Study of RNAi Effects and dsRNA Stability in Tribolium castaneum and Acyrthosiphon pisum, Following Injection and Ingestion of Analogous dsRNAs" International Journal of Molecular Sciences 19, no. 4: 1079. https://doi.org/10.3390/ijms19041079
APA StyleCao, M., Gatehouse, J. A., & Fitches, E. C. (2018). A Systematic Study of RNAi Effects and dsRNA Stability in Tribolium castaneum and Acyrthosiphon pisum, Following Injection and Ingestion of Analogous dsRNAs. International Journal of Molecular Sciences, 19(4), 1079. https://doi.org/10.3390/ijms19041079