Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Animal Models
4.2. High-Performance Liquid Chromatography (HPLC)
4.3. Quantitative Real-Time Polymerase Chain Reaction (PCR)
4.4. Western Blot
4.5. Immunohistochemistry Staining
4.6. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
| ADMA | Asymmetric dimethylarginine |
| AMPK | AMP-activated protein kinase (AMPK) |
| AT1R | Angiotensin II type I receptor |
| DOHaD | Developmental origins of health and disease |
| HFA | High-fat diet |
| HFR | High-fructose diet |
| mTOR | Mammalian target of rapamycin |
| ND | Normal diet |
| PGC-1α | PPARγ coactivator-1α |
| PPAR | Peroxisome proliferator-activated receptor |
| RAS | Renin-angiotensin system |
| SDMA | Symmetric dimethylarginine |
| SIRT1 | Sirtuin-1 |
| SIRT4 | Sirtuin-4 |
References
- Bailey, C.J. Metformin: Historical overview. Diabetologia 2017, 60, 1566–1576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, J.A.; Simpson, S.H.; Toth, E.L.; Majumdar, S.R. Reduced cardiovascular morbidity and mortality associated with metformin use in subjects with type 2 diabetes. Diabet. Med. 2005, 22, 497–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katsi, V.; Georgiopoulos, G.; Vogiatzi, G.; Oikonomou, D.; Megapanou, M.; Skoumas, J.; Vlachopoulos, C.; Nihoyannopoulos, P.; Tousoulis, D. Effects of oral and non-insulin injectable antidiabetic treatment in hypertension: A Systematic Review. Curr. Pharm. Des. 2017, 23, 3743–3750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goh, J.E.; Sadler, L.; Rowan, J. Metformin for gestational diabetes in routine clinical practice. Diabet. Med. 2011, 28, 1082–1087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lindsay, R.S.; Loeken, M.R. Metformin use in pregnancy: Promises and uncertainties. Diabetologia 2017, 60, 1612–1619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khokhar, A.; Umpaichitra, V.; Chin, V.L.; Perez-Colon, S. Metformin use in children and adolescents with prediabetes. Pediatr. Clin. N. Am. 2017, 64, 1341–1353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanson, M.; Gluckman, P. Developmental origins of noncommunicable disease: Population and public health implications. Am. J. Clin. Nutr. 2011, 94, 1754S–1758S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, R.J.; Segal, M.S.; Sautin, Y.; Nakagawa, T.; Feig, D.I.; Kang, D.H.; Gersch, M.S.; Benner, S.; Sánchez-Lozada, L.G. Potential role of sugar (fructose) in the epidemic of hypertension, obesity and the metabolic syndrome, diabetes, kidney disease, and cardiovascular disease. Am. J. Clin. Nutr. 2007, 86, 899–906. [Google Scholar] [PubMed]
- Tain, Y.L.; Chan, J.Y.; Hsu, C.N. Maternal fructose intake affects transcriptome changes and programmed hypertension in offspring in later life. Nutrients 2016, 8, 757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Wu, K.L.; Lee, W.C.; Leu, S.; Chan, J.Y. Maternal fructose-intake-induced renal programming in adult male offspring. J. Nutr. Biochem. 2015, 26, 642–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, L.; Seki, Y.; Vuguin, P.M.; Charron, M.J. Animal models of in utero exposure to a high fat diet: A review. Biochim. Biophys. Acta 2014, 1842, 507–519. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Lee, W.C.; Wu, K.L.H.; Leu, S.; Chan, J.Y.H. Maternal high fructose intake increases the vulnerability to post-weaning high-fat diet-induced programmed hypertension in male offspring. Nutrients 2018, 10, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jansson, T.; Powell, T.L. Role of placental nutrient sensing in developmental programming. Clin. Obstet. Gynecol. 2013, 56, 591–601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Efeyan, A.; Comb, W.C.; Sabatini, D.M. Nutrient-sensing mechanisms and pathways. Nature 2015, 517, 302–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, R.J.; Perez-Pozo, S.E.; Sautin, Y.Y.; Manitius, J.; Sanchez-Lozada, L.G.; Feig, D.I.; Shafiu, M.; Segal, M.; Glassock, R.J.; Shimada, M.; et al. Hypothesis: Could excessive fructose intake and uric acid cause type 2 diabetes? Endocr. Rev. 2009, 30, 96–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dennery, P.A. Oxidative stress in development: Nature or nurture? Free Radic. Biol. Med. 2010, 49, 1147–1151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thompson, L.P.; Al-Hasan, Y. Impact of oxidative stress in fetal programming. J. Pregnancy 2012, 2012, 582748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Interplay between oxidative stress and nutrient sensing signaling in the developmental origins of cardiovascular disease. Int. J. Mol. Sci. 2017, 18, 841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Targeting on asymmetric dimethylarginine related nitric oxide-reactive oxygen species imbalance to reprogram the development of hypertension. Int. J. Mol. Sci. 2016, 17, 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilcox, C.S. Oxidative stress and nitric oxide deficiency in the kidney: A critical link to hypertension? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 289, R913–R935. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bestermann, W.H., Jr. The ADMA-metformin hypothesis: Linking the cardiovascular consequences of the metabolic syndrome and type 2 diabetes. Cardiorenal Med. 2011, 1, 211–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klachko, D.; Whaley-Connell, A. Use of Metformin in patients with kidney and cardiovascular diseases. Cardiorenal Med. 2011, 1, 87–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kett, M.M.; Denton, K.M. Renal programming: Cause for concern? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R791–R803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Chan, S.H.H.; Chan, J.Y.H. Biochemical basis for pharmacological intervention as a reprogramming strategy against hypertension and kidney disease of developmental origin. Biochem. Pharmacol. 2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Lin, I.C.; Yu, H.R.; Huang, L.T.; Hsu, C.N. Resveratrol prevents the combined maternal plus postweaning high-fat-diets-induced hypertension in male offspring. J. Nutr. Biochem. 2017, 48, 120–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, Q.; Song, P.; Ding, Y.; Zou, M.H. Activation of AMP-activated protein kinase by metformin ablates angiotensin II-induced endoplasmic reticulum stress and hypertension in mice in vivo. Br. J. Pharmacol. 2017, 174, 2140–2151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajani, R.; Pastor-Soler, N.M.; Hallows, K.R. Role of AMP-activated protein kinase in kidney tubular transport, metabolism, and disease. Curr. Opin. Nephrol. Hypertens. 2017, 26, 375–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, C.M.; Kuo, H.C.; Hsu, C.N.; Huang, L.T.; Tain, Y.L. Metformin reduces asymmetric dimethylarginine and prevents hypertension in spontaneously hypertensive rats. Transl. Res. 2014, 164, 452–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Toxic dimethylarginines: Asymmetric dimethylarginine (ADMA) and symmetric dimethylarginine (SDMA). Toxins 2017, 9, 92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobori, H.; Nangaku, M.; Navar, L.G. Nishiyama A. The intrarenal renin-angiotensin system: From physiology to the pathobiology of hypertension and kidney disease. Pharmacol. Rev. 2007, 59, 251–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nesti, L.; Natali, A. Metformin effects on the heart and the cardiovascular system: A review of experimental and clinical data. Nutr. Metab. Cardiovasc. Dis. 2017, 27, 657–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caliceti, C.; Calabria, D.; Roda, A.; Cicero, A.F.G. Fructose intake, serum uric acid, and cardiometabolic disorders: A critical review. Nutrients 2017, 9, 395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krzystek-Korpacka, M.; Patryn, E.; Kustrzeba-Wojcicka, I.; Chrzanowska, J.; Gamian, A.; Noczynska, A. The effect of a one-year weight reduction program on serum uric acid in overweight/obese children and adolescents. Clin. Chem. Lab. Med. 2011, 49, 915–921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forcato, S.; Novi, D.R.B.D.S.; Costa, N.O.; Borges, L.I.; Góes, M.L.M.; Ceravolo, G.S.; Gerardin, D.C.C. In utero and lactational exposure to metformin induces reproductive alterations in male rat offspring. Reprod. Toxicol. 2017, 74, 48–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kautzky-Willer, A.; Harreiter, J. Sex and gender differences in therapy of type 2 diabetes. Diabetes Res. Clin. Pract. 2017, 131, 230–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Leu, S.; Wu, K.L.; Lee, W.C.; Chan, J.Y. Melatonin prevents maternal fructose intake-induced programmed hypertension in the offspring: Roles of nitric oxide and arachidonic acid metabolites. J. Pineal Res. 2014, 57, 80–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Groups | ND/ND | HFR/ND | ND/HFA | HFR/HFA | HFR/HFA+M |
|---|---|---|---|---|---|
| Mortality | 0% | 0% | 0% | 0% | 0% |
| BW (g) | 413 ± 11 | 398 ± 10 | 489 ± 12 a,b | 407 ± 13 c | 418 ± 15 c |
| Left kidney weight (g) | 1.57 ± 0.1 | 1.68 ± 0.05 | 2.02 ± 0.04 a,b | 1.7 ± 0.06 a | 1.5 ± 0.08 c,d |
| Left kidney weight/100 g BW | 0.38 ± 0.02 | 0.42 ± 0.01 a | 0.41 ± 0.02 a | 0.43 ± 0.02 a | 0.36 ± 0.01 b,c,d |
| Liver weight (g) | 16.8 ± 1 | 15.5 ± 0.7 | 19.2 ± 1 | 17.2 ± 0.8 | 15.9 ± 1.3 |
| Liver weight/100 g BW | 4.12 ± 0.3 | 3.9 ± 0.12 | 3.92 ± 0.16 | 4.22 ± 0.16 | 3.78 ± 0.18 |
| Mean arterial pressure (mm Hg) | 98 ± 1 | 104 ± 1 a | 107 ± 2 a | 119 ± 3 a,b,c | 98 ± 3 b,c,d |
| Creatinine (μmol/L) | 16.0 ± 0.8 | 16.7 ± 0.2 | 25.5 ± 0.2 a.b | 21.9 ± 0.6 a,b | 13.6 ± 0.6 c,d |
| Uric acid | 73.5 ± 3.1 | 86.3 ± 2.7 | 76.5 ± 2.9 | 93.3 ± 3.4 a | 36.2 ± 1.6 a,b,c,d |
| Groups | ND/ND | HFR/ND | ND/HFA | HFR/HFA | HFR/HFA+M |
|---|---|---|---|---|---|
| l-citrulline | 57.2 ± 1.1 | 51.4 ± 1 | 68.8 ± 1.5 | 56.6 ± 1.6 | 107.7 ± 7.8 a,b,c,d |
| l-arginine | 241.1 ± 4.7 | 208 ± 5.8 | 167.3 ± 8.5 a | 158.9 ± 2.1 a | 155 ± 6.6 a,b,c,d |
| ADMA | 1.01 ± 0.03 | 1.02 ± 0.04 | 0.93 ± 0.01 | 0.86 ± 0.01 | 1.8 ± 0.1 a,b,c,d |
| SDMA | 0.61 ± 0.01 | 0.58 ± 0.01 | 0.55 ± 0.01 | 0.52 ± 0.01 | 1.1 ± 0.02 a,b,c,d |
| l-arginine-to-ADMA ratio | 233 ± 1 | 202 ± 3 | 179 ± 8 a | 176 ± 3 a | 92 ± 3 a,b,c,d |
| Gene | Forward | Reverse |
|---|---|---|
| Sirt1 | 5 tggagcaggttgcaggaatcca 3 | 5 tggcttcatgatggcaagtggc 3 |
| Sirt4 | 5 ccctttggaccatgaaaaga 3 | 5 cggatgaaatcaatgtgctg 3 |
| Prkaa2 | 5 agctcgcagtggcttatcat 3 | 5 ggggctgtctgctatgagag3 |
| Prkab2 | 5 cagggccttatggtcaagaa 3 | 5 cagcgcatagagatggttca 3 |
| Prkag2 | 5 gtgtgggagaagctctgagg 3 | 5 agaccacacccagaagatgc 3 |
| Ppara | 5 agaagttgcaggaggggatt 3 | 5 ttcttgatgacctgcacgag 3 |
| Pparrb | 5 gatcagcgtgcatgtgttct 3 | 5 cagcagtccgtctttgttga 3 |
| Pparg | 5 ctttatggagcctaagtttgagt 3 | 5 gttgtcttggatgtcctcg 3 |
| Ppargc1a | 5 cccattgagggctgtgatct 3 | 5 tcagtgaaatgccggagtca 3 |
| Ren | 5 aacattaccagggcaactttcact 3 | 5 acccccttcatggtgatctg 3 |
| Atp6ap2 | 5 gaggcagtgaccctcaacat 3 | 5 ccctcctcacacaacaaggt 3 |
| Agt | 5 gcccaggtcgcgatgat 3 | 5 tgtacaagatgctgagtgaggcaa 3 |
| Ace | 5 caccggcaaggtctgctt 3 | 5 cttggcatagtttcgtgaggaa 3 |
| Agtr1a | 5 gctgggcaacgagtttgtct 3 | 5 cagtccttcagctggatcttca 3 |
| Rn18s | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Wu, K.L.H.; Lee, W.-C.; Leu, S.; Chan, J.Y.H. Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets. Int. J. Mol. Sci. 2018, 19, 1066. https://doi.org/10.3390/ijms19041066
Tain Y-L, Wu KLH, Lee W-C, Leu S, Chan JYH. Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets. International Journal of Molecular Sciences. 2018; 19(4):1066. https://doi.org/10.3390/ijms19041066
Chicago/Turabian StyleTain, You-Lin, Kay L. H. Wu, Wei-Chia Lee, Steve Leu, and Julie Y. H. Chan. 2018. "Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets" International Journal of Molecular Sciences 19, no. 4: 1066. https://doi.org/10.3390/ijms19041066
APA StyleTain, Y.-L., Wu, K. L. H., Lee, W.-C., Leu, S., & Chan, J. Y. H. (2018). Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets. International Journal of Molecular Sciences, 19(4), 1066. https://doi.org/10.3390/ijms19041066

