Evaluation of Promoter Methylation of RASSF1A and ATM in Peripheral Blood of Breast Cancer Patients and Healthy Control Individuals
Abstract
1. Introduction
2. Results
2.1. Promoter Methylation Levels of RASSF1A and ATM in BC Patients and Healthy Controls and Its Correlation to Clinical Characteristics
2.2. Comparison of the Results from This Study with the Results of Infinium HumanMethylation450 BeadChip Array and with Literature
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. DNA Isolation and Bisulfite Conversion
4.3. Primer Design and PCR Amplification
4.4. Methylation Analysis
4.5. 450K Methylation Study
4.6. Statistical Analysis
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
| BC | breast cancer |
| RASSF1A | RAS-association domain family member 1A gene |
| ATM | ataxia-telangiectasia mutated gene |
| 450K | Infinium HumanMethylation450 BeadChip |
| IQR | interquartile range |
| DCIS | ductal carcinoma in situ |
| IDC | invasive ductal carcinoma |
| cfDNA | cell free DNA |
| CTCs | circulating tumor cells |
References
- Ferlay, J.; Soerjomataram, I.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, E359–E386. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.; Naishadham, D.; Jemal, A. Cancer statistics, 2013. CA Cancer J. Clin. 2013, 63, 11–30. [Google Scholar] [CrossRef] [PubMed]
- Elmore, J.G.; Barton, M.B.; Moceri, V.M.; Polk, S.; Arena, P.J.; Fletcher, S.W. Ten-year risk of false positive screening mammograms and clinical breast examinations. N. Engl. J. Med. 1998, 338, 1089–1096. [Google Scholar] [CrossRef] [PubMed]
- Alagaratnam, T.T.; Wong, J. Limitations of mammography in Chinese females. Clin. Radiol. 1985, 36, 175–177. [Google Scholar] [CrossRef]
- Baylin, S.B.; Herman, J.G.; Graff, J.R.; Vertino, P.M.; Issa, J.P. Alterations in DNA methylation: A fundamental aspect of neoplasia. Adv. Cancer Res. 1998, 72, 141–196. [Google Scholar] [PubMed]
- Sadikovic, B.; Al-Romaih, K.; Squire, J.A.; Zielenska, M. Cause and consequences of genetic and epigenetic alterations in human cancer. Curr. Genom. 2008, 9, 394–408. [Google Scholar] [CrossRef] [PubMed]
- Merlo, A.; Herman, J.G.; Mao, L.; Lee, D.J.; Gabrielson, E.; Burger, P.C.; Baylin, S.B.; Sidransky, D. 5′ CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat. Med. 1995, 1, 686–692. [Google Scholar] [CrossRef] [PubMed]
- Herman, J.G.; Umar, A.; Polyak, K.; Graff, J.R.; Ahuja, N.; Issa, J.P.; Markowitz, S.; Willson, J.K.; Hamilton, S.R.; Kinzler, K.W.; et al. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl. Acad. Sci. USA 1998, 95, 6870–6875. [Google Scholar] [CrossRef] [PubMed]
- Baylin, S.B. DNA methylation and gene silencing in cancer. Nat. Clin. Pract. Oncol. 2005, 2 (Suppl. 1), S4–S11. [Google Scholar] [CrossRef] [PubMed]
- Leonhardt, H.; Cardoso, M.C. DNA methylation, nuclear structure, gene expression and cancer. J. Cell. Biochem. 2000, 79 (Suppl. 35), 78–83. [Google Scholar] [CrossRef]
- Yuan, Y.; Liu, H.; Sahin, A.; Dai, J.L. Reactivation of SYK expression by inhibition of DNA methylation suppresses breast cancer cell invasiveness. Int. J. Cancer 2005, 113, 654–659. [Google Scholar] [CrossRef] [PubMed]
- Robertson, K.D.; Jones, P.A. DNA methylation: Past, present and future directions. Carcinogenesis 2000, 21, 461–467. [Google Scholar] [CrossRef] [PubMed]
- Momparler, R.L. Cancer epigenetics. Oncogene 2003, 22, 6479–6483. [Google Scholar] [CrossRef] [PubMed]
- Ehrlich, M. DNA hypomethylation, cancer, the immunodeficiency, centromeric region instability, facial anomalies syndrome and chromosomal rearrangements. J. Nutr. 2002, 132 (Suppl. 8), 2424S–2429S. [Google Scholar] [CrossRef] [PubMed]
- Umbricht, C.B.; Evron, E.; Gabrielson, E.; Ferguson, A.; Marks, J.; Sukumar, S. Hypermethylation of 14-3-3 sigma (stratifin) is an early event in breast cancer. Oncogene 2001, 20, 3348–3353. [Google Scholar] [CrossRef] [PubMed]
- Evron, E.; Dooley, W.C.; Umbricht, C.B.; Rosenthal, D.; Sacchi, N.; Gabrielson, E.; Soito, A.B.; Hung, D.T.; Ljung, B.; Davidson, N.E.; et al. Detection of breast cancer cells in ductal lavage fluid by methylation-specific PCR. Lancet 2001, 357, 1335–1336. [Google Scholar] [CrossRef]
- Evron, E.; Umbricht, C.B.; Korz, D.; Raman, V.; Loeb, D.M.; Niranjan, B.; Buluwela, L.; Weitzman, S.A.; Marks, J.; Sukumar, S. Loss of cyclin D2 expression in the majority of breast cancers is associated with promoter hypermethylation. Cancer Res. 2001, 61, 2782–2787. [Google Scholar] [PubMed]
- Belinsky, S.A.; Nikula, K.J.; Palmisano, W.A.; Michels, R.; Saccomanno, G.; Gabrielson, E.; Baylin, S.B.; Herman, J.G. Aberrant methylation of p16(INK4a) is an early event in lung cancer and a potential biomarker for early diagnosis. Proc. Natl. Acad. Sci. USA 1998, 95, 11891–11896. [Google Scholar] [CrossRef] [PubMed]
- Esteller, M.; Sparks, A.; Toyota, M.; Sanchez-Cespedes, M.; Capella, G.; Peinado, M.A.; Gonzalez, S.; Tarafa, G.; Sidransky, D.; Meltzer, S.J.; et al. Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. Cancer Res. 2000, 60, 4366–4371. [Google Scholar] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Choi, J.Y.; Lee, K.M.; Sung, H.; Park, S.K.; Oze, I.; Pan, K.F.; You, W.C.; Chen, Y.X.; Fang, J.Y.; et al. DNA methylation in peripheral blood: A potential biomarker for cancer molecular epidemiology. J. Epidemiol. 2012, 22, 384–394. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Fleischhacker, M.; Rabien, A. Cell-free DNA in the blood as a solid tumor biomarker—A critical appraisal of the literature. Clin. Chim. Acta 2010, 411, 1611–1624. [Google Scholar] [CrossRef] [PubMed]
- Dammann, R.; Li, C.; Yoon, J.H.; Chin, P.L.; Bates, S.; Pfeifer, G.P. Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat. Genet. 2000, 25, 315–319. [Google Scholar] [PubMed]
- Richter, A.M.; Walesch, S.K.; Dammann, R.H. Aberrant Promoter Methylation of the Tumour Suppressor RASSF10 and Its Growth Inhibitory Function in Breast Cancer. Cancers 2016, 8, 26. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.L.; Kang, S.Y.; Shin, Y.K.; Choi, J.S.; Kim, S.H.; Lee, S.J.; Bae, D.S.; Ahn, G. Aberrant hypermethylation of RASSF1A promoter in ovarian borderline tumors and carcinomas. Virchows Arch. 2006, 448, 331–336. [Google Scholar] [CrossRef] [PubMed]
- Pfeifer, G.P.; Dammann, R. Methylation of the tumor suppressor gene RASSF1A in human tumors. Biochemistry 2005, 70, 576–583. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Yoon, J.H.; Dammann, R.; Pfeifer, G.P. Frequent hypermethylation of the RASSF1A gene in prostate cancer. Oncogene 2002, 21, 6835–6840. [Google Scholar] [CrossRef] [PubMed]
- Kristensen, L.S.; Raynor, M.P.; Candiloro, I.; Dobrovic, A. Methylation profiling of normal individuals reveals mosaic promoter methylation of cancer-associated genes. Oncotarget 2012, 3, 450–461. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, M.; Rahman, N. ATM and breast cancer susceptibility. Oncogene 2006, 25, 5906–5911. [Google Scholar] [CrossRef] [PubMed]
- Begam, N.; Jamil, K.; Raju, S.G. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer. Asian Pac. J. Cancer Prev. 2017, 18, 3003–3009. [Google Scholar] [PubMed]
- Majchrzak-Celinska, A.; Paluszczak, J.; Szalata, M.; Barciszewska, A.M.; Nowak, S.; Kleszcz, R.; Sherba, A.; Baer-Dubowska, W. The methylation of a panel of genes differentiates low-grade from high-grade gliomas. Tumour Biol. 2015, 36, 3831–3841. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Su, X.; Ai, L.; Li, M.; Fan, C.Y.; Weiss, L.M. Promoter hypermethylation of multiple genes in gastric lymphoma. Leuk. Lymphoma 2007, 48, 1988–1996. [Google Scholar] [CrossRef] [PubMed]
- Bai, A.H.; Tong, J.H.; To, K.F.; Chan, M.W.; Man, E.P.; Lo, K.W.; Lee, J.F.; Sung, J.J.; Leung, W.K. Promoter hypermethylation of tumor-related genes in the progression of colorectal neoplasia. Int. J. Cancer 2004, 112, 846–853. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.H.; Yazici, H.; Wu, H.C.; Terry, M.B.; Gonzalez, K.; Qu, M.; Dalay, N.; Santella, R.M. Aberrant promoter hypermethylation and genomic hypomethylation in tumor, adjacent normal tissues and blood from breast cancer patients. Anticancer Res. 2010, 30, 2489–2496. [Google Scholar] [PubMed]
- Zmetakova, I.; Danihel, L.; Smolkova, B.; Mego, M.; Kajabova, V.; Krivulcik, T.; Rusnak, I.; Rychly, B.; Danis, D.; Repiska, V.; et al. Evaluation of protein expression and DNA methylation profiles detected by pyrosequencing in invasive breast cancer. Neoplasma 2013, 60, 635–646. [Google Scholar] [CrossRef] [PubMed]
- Flanagan, J.M.; Munoz-Alegre, M.; Henderson, S.; Tang, T.; Sun, P.; Johnson, N.; Fletcher, O.; Dos Santos Silva, I.; Peto, J.; Boshoff, C.; et al. Gene-body hypermethylation of ATM in peripheral blood DNA of bilateral breast cancer patients. Hum. Mol. Genet. 2009, 18, 1332–1342. [Google Scholar] [CrossRef] [PubMed]
- Brennan, K.; Garcia-Closas, M.; Orr, N.; Fletcher, O.; Jones, M.; Ashworth, A.; Swerdlow, A.; Thorne, H.; Riboli, E.; Vineis, P.; et al. Intragenic ATM methylation in peripheral blood DNA as a biomarker of breast cancer risk. Cancer Res. 2012, 72, 2304–2313. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.; Cheng, J.; Cao, X.; Surowy, H.; Burwinkel, B. Blood-based DNA methylation as biomarker for breast cancer: A systematic review. Clin. Epigenetics 2016, 8, 115. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, I.A.; Pusch, C.M.; Hamed, T.; Rashad, H.; Idris, A.; El-Fadle, A.A.; Blin, N. Epigenetic alterations by methylation of RASSF1A and DAPK1 promoter sequences in mammary carcinoma detected in extracellular tumor DNA. Cancer Genet. Cytogenet. 2010, 199, 96–100. [Google Scholar] [CrossRef] [PubMed]
- Dulaimi, E.; Hillinck, J.; Ibanez de Caceres, I.; Al-Saleem, T.; Cairns, P. Tumor suppressor gene promoter hypermethylation in serum of breast cancer patients. Clin. Cancer Res. 2004, 10 Pt 1, 6189–6193. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.H.; McCullough, L.E.; Gammon, M.D.; Wu, H.C.; Zhang, Y.J.; Wang, Q.; Xu, X.; Teitelbaum, S.L.; Neugut, A.I.; Chen, J.; et al. Promoter Hypermethylation in White Blood Cell DNA and Breast Cancer Risk. J. Cancer 2015, 6, 819–824. [Google Scholar] [CrossRef] [PubMed]
- Harrison, K.; Hoad, G.; Scott, P.; Simpson, L.; Horgan, G.W.; Smyth, E.; Heys, S.D.; Haggarty, P. Breast cancer risk and imprinting methylation in blood. Clin. Epigenetics 2015, 7, 92. [Google Scholar] [CrossRef] [PubMed]
- Ito, Y.; Koessler, T.; Ibrahim, A.E.; Rai, S.; Vowler, S.L.; Abu-Amero, S.; Silva, A.L.; Maia, A.T.; Huddleston, J.E.; Uribe-Lewis, S.; et al. Somatically acquired hypomethylation of IGF2 in breast and colorectal cancer. Hum. Mol. Genet. 2008, 17, 2633–2643. [Google Scholar] [CrossRef] [PubMed]
- Widschwendter, M.; Apostolidou, S.; Raum, E.; Rothenbacher, D.; Fiegl, H.; Menon, U.; Stegmaier, C.; Jacobs, I.J.; Brenner, H. Epigenotyping in peripheral blood cell DNA and breast cancer risk: A proof of principle study. PLoS ONE 2008, 3, e2656. [Google Scholar] [CrossRef] [PubMed]
- Hoque, M.O.; Feng, Q.; Toure, P.; Dem, A.; Critchlow, C.W.; Hawes, S.E.; Wood, T.; Jeronimo, C.; Rosenbaum, E.; Stern, J.; et al. Detection of aberrant methylation of four genes in plasma DNA for the detection of breast cancer. J. Clin. Oncol. 2006, 24, 4262–4269. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulou, E.; Davilas, E.; Sotiriou, V.; Georgakopoulos, E.; Georgakopoulou, S.; Koliopanos, A.; Aggelakis, F.; Dardoufas, K.; Agnanti, N.J.; Karydas, I.; et al. Cell-free DNA and RNA in plasma as a new molecular marker for prostate and breast cancer. Ann. N. Y. Acad. Sci. 2006, 1075, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Yazici, H.; Terry, M.B.; Cho, Y.H.; Senie, R.T.; Liao, Y.; Andrulis, I.; Santella, R.M. Aberrant methylation of RASSF1A in plasma DNA before breast cancer diagnosis in the Breast Cancer Family Registry. Cancer Epidemiol. Biomarkers Prev. 2009, 18, 2723–2725. [Google Scholar] [CrossRef] [PubMed]
- Van der Auwera, I.; Elst, H.J.; Van Laere, S.J.; Maes, H.; Huget, P.; van Dam, P.; Van Marck, E.A.; Vermeulen, P.B.; Dirix, L.Y. The presence of circulating total DNA and methylated genes is associated with circulating tumour cells in blood from breast cancer patients. Br. J. Cancer 2009, 100, 1277–1286. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Shin, M.H.; Kweon, S.S.; Park, M.H.; Yoon, J.H.; Lee, J.S.; Choi, C.; Fackler, M.J.; Sukumar, S. Evaluation of promoter hypermethylation detection in serum as a diagnostic tool for breast carcinoma in Korean women. Gynecol. Oncol. 2010, 118, 176–181. [Google Scholar] [CrossRef] [PubMed]
- Kloten, V.; Becker, B.; Winner, K.; Schrauder, M.G.; Fasching, P.A.; Anzeneder, T.; Veeck, J.; Hartmann, A.; Knuchel, R.; Dahl, E. Promoter hypermethylation of the tumor-suppressor genes ITIH5, DKK3, and RASSF1A as novel biomarkers for blood-based breast cancer screening. Breast Cancer Res. 2013, 15, R4. [Google Scholar] [CrossRef] [PubMed]
- Brooks, J.D.; Cairns, P.; Shore, R.E.; Klein, C.B.; Wirgin, I.; Afanasyeva, Y.; Zeleniuch-Jacquotte, A. DNA methylation in pre-diagnostic serum samples of breast cancer cases: Results of a nested case-control study. Cancer Epidemiol. 2010, 34, 717–723. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.C.; Delgado-Cruzata, L.; Flom, J.D.; Perrin, M.; Liao, Y.; Ferris, J.S.; Santella, R.M.; Terry, M.B. Repetitive element DNA methylation levels in white blood cell DNA from sisters discordant for breast cancer from the New York site of the Breast Cancer Family Registry. Carcinogenesis 2012, 33, 1946–1952. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Gammon, M.D.; Hernandez-Vargas, H.; Herceg, Z.; Wetmur, J.G.; Teitelbaum, S.L.; Bradshaw, P.T.; Neugut, A.I.; Santella, R.M.; Chen, J. DNA methylation in peripheral blood measured by LUMA is associated with breast cancer in a population-based study. FASEB J. 2012, 26, 2657–2666. [Google Scholar] [CrossRef] [PubMed]
- Chan, K.C.; Zhang, J.; Hui, A.B.; Wong, N.; Lau, T.K.; Leung, T.N.; Lo, K.W.; Huang, D.W.; Lo, Y.M. Size distributions of maternal and fetal DNA in maternal plasma. Clin. Chem. 2004, 50, 88–92. [Google Scholar] [CrossRef] [PubMed]
- Radpour, R.; Sikora, M.; Grussenmeyer, T.; Kohler, C.; Barekati, Z.; Holzgreve, W.; Lefkovits, I.; Zhong, X.Y. Simultaneous isolation of DNA, RNA, and proteins for genetic, epigenetic, transcriptomic, and proteomic analysis. J. Proteome Res. 2009, 8, 5264–5274. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zimmermann, B.; Rusterholz, C.; Kang, A.; Holzgreve, W.; Hahn, S. Size separation of circulatory DNA in maternal plasma permits ready detection of fetal DNA polymorphisms. Clin. Chem. 2004, 50, 1002–1011. [Google Scholar] [CrossRef] [PubMed]
- Van der Vaart, M.; Pretorius, P.J. The origin of circulating free DNA. Clin. Chem. 2007, 53, 2215. [Google Scholar] [CrossRef] [PubMed]
- Radpour, R.; Barekati, Z.; Kohler, C.; Lv, Q.; Burki, N.; Diesch, C.; Bitzer, J.; Zheng, H.; Schmid, S.; Zhong, X.Y. Hypermethylation of tumor suppressor genes involved in critical regulatory pathways for developing a blood-based test in breast cancer. PLoS ONE 2011, 6, e16080. [Google Scholar] [CrossRef] [PubMed]
- Ehrich, M.; Nelson, M.R.; Stanssens, P.; Zabeau, M.; Liloglou, T.; Xinarianos, G.; Cantor, C.R.; Field, J.K.; van den Boom, D. Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry. Proc. Natl. Acad. Sci. USA 2005, 102, 15785–15790. [Google Scholar] [CrossRef] [PubMed]
- Edge, S.B.; Compton, C.C. The American Joint Committee on Cancer: The 7th edition of the AJCC cancer staging manual and the future of TNM. Ann. Surg. Oncol. 2010, 17, 1471–1474. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.; Holland-Letz, T.; Slynko, A.; Cuk, K.; Marme, F.; Schott, S.; Heil, J.; Qu, B.; Golatta, M.; Bewerunge-Hudler, M.; et al. DNA methylation array analysis identifies breast cancer associated RPTOR, MGRN1 and RAPSN hypomethylation in peripheral blood DNA. Oncotarget 2016, 7, 64191–64202. [Google Scholar] [CrossRef] [PubMed]
| CpG Site | Case, n | Control, n | BC Cases Median (IQR) | Controls Median (IQR) | p-Value * | p-Value ** |
|---|---|---|---|---|---|---|
| RASSF1A_CpG_1 | 222 | 144 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 0.03 | 0.31 |
| RASSF1A_CpG_8 | 216 | 134 | 0.00 (0.00–0.02) | 0.00 (0.00–0.02) | 1.00 | 0.76 |
| RASSF1A_CpG_9 | 223 | 141 | 0.01 (0.00–0.02) | 0.01 (0.00–0.03) | 1.00 | 0.78 |
| RASSF1A_CpG_11,12 | 187 | 121 | 0.13 (0.11–0.16) | 0.14 (0.11–0.17) | 1.00 | 0.38 |
| RASSF1A_CpG_13 | 222 | 141 | 0.04 (0.00–0.08) | 0.04 (0.00–0.08) | 1.00 | 0.90 |
| RASSF1A_CpG_14,15 | 187 | 121 | 0.13 (0.11–0.16) | 0.14 (0.11–0.17) | 1.00 | 0.35 |
| RASSF1A_CpG_16 | 226 | 146 | 0.02 (0.00–0.03) | 0.02 (0.02–0.03) | 1.00 | 0.15 |
| RASSF1A_CpG_19 | 216 | 134 | 0.00 (0.00–0.02) | 0.00 (0.00–0.02) | 1.00 | 0.09 |
| RASSF1A_CpG_20 | 216 | 134 | 0.00 (0.00–0.02) | 0.00 (0.00–0.02) | 1.00 | 0.34 |
| RASSF1A_CpG_21,22 | 226 | 145 | 0.05 (0.04–0.06) | 0.05 (0.03–0.07) | 0.62 | 0.64 |
| RASSF1A_CpG_23 | 226 | 146 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 0.28 | 0.70 |
| RASSF1A_CpG_24 | 226 | 145 | 0.03 (0.02–0.05) | 0.03 (0.02–0.07) | 1.00 | 0.79 |
| RASSF1A_CpG_25 | 223 | 141 | 0.01 (0.00–0.02) | 0.01 (0.00–0.03) | 1.00 | 0.31 |
| RASSF1A_CpG_26 | 226 | 146 | 0.04 (0.03–0.05) | 0.04 (0.03–0.05) | 1.00 | 0.76 |
| MEAN | 226 | 146 | 0.037 (0.029–0.048) | 0.042 (0.032–0.054) | 0.25 | 0.78 |
| CpG Site | Case, n | Control, n | BC Cases Median (IQR) | Controls Median (IQR) | p-Value * | p-Value ** |
|---|---|---|---|---|---|---|
| ATM_CpG_1 | 222 | 146 | 0.02 (0.01–0.03) | 0.02 (0.01–0.02) | 1.00 | 0.95 |
| ATM_CpG_2,3,4,5 | 142 | 95 | 0.07 (0.06–0.10) | 0.07 (0.06–0.09) | 1.00 | 0.91 |
| ATM_CpG_6 | 223 | 146 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 1.00 | 0.37 |
| ATM_CpG_7,8 | 223 | 146 | 0.05 (0.03–0.06) | 0.04 (0.03–0.06) | 1.00 | 0.60 |
| ATM_CpG_10,11 | 221 | 145 | 0.11 (0.10–0.13) | 0.12 (0.10–0.13) | 1.00 | 0.95 |
| ATM_CpG_12 | 223 | 146 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 1.00 | 0.94 |
| ATM_CpG_13,14 | 223 | 146 | 0.03 (0.02–0.04) | 0.03 (0.02–0.04) | 1.00 | 0.43 |
| ATM_CpG_17 | 219 | 145 | 0.00 (0.00–0.04) | 0.01 (0.00–0.04) | 1.00 | 0.73 |
| ATM_CpG_18,19 | 223 | 146 | 0.13 (0.12–0.16) | 0.14 (0.12–0.18) | 0.22 | 0.18 |
| ATM_CpG_20,21 | 223 | 146 | 0.02 (0.02–0.03) | 0.02 (0.02–0.03) | 1.00 | 0.36 |
| ATM_CpG_26 | 219 | 146 | 0.06 (0.04–0.09) | 0.07 (0.05–0.09) | 1.00 | 0.21 |
| ATM_CpG_27 | 223 | 146 | 0.11 (0.10–0.12) | 0.11 (0.10–0.12) | 1.00 | 0.66 |
| ATM_CpG_28 | 222 | 146 | 0.02 (0.02–0.03) | 0.02 (0.02–0.03) | 1.00 | 0.75 |
| ATM_CpG_29 | 223 | 146 | 0.03 (0.02–0.03) | 0.03 (0.02–0.03) | 1.00 | 0.68 |
| ATM_CpG_32 | 223 | 145 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 1.00 | 0.53 |
| ATM_CpG_33 | 223 | 146 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 1.00 | 0.15 |
| ATM_CpG_34 | 223 | 146 | 0.13 (0.10–0.16) | 0.14 (0.10–0.18) | 1.00 | 0.70 |
| ATM_CpG_35 | 219 | 145 | 0.00 (0.00–0.04) | 0.01 (0.00–0.04) | 1.00 | 0.78 |
| ATM_CpG_36 | 223 | 145 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 1.00 | 0.14 |
| ATM_CpG_37 | 223 | 146 | 0.13 (0.10–0.16) | 0.14 (0.10–0.18) | 1.00 | 0.16 |
| ATM_CpG_38 | 192 | 135 | 0.00 (0.00–0.01) | 0.00 (0.00–0.01) | 1.00 | 0.95 |
| ATM_CpG_39 | 223 | 146 | 0.02 (0.01–0.04) | 0.02 (0.01–0.03) | 1.00 | 0.91 |
| MEAN | 223 | 146 | 0.047 (0.042–0.055) | 0.048 (0.042–0.056) | 1.00 | 0.37 |
| Characteristics | BC Patients Number (%) |
|---|---|
| Tumor, lymph node and metastasis (TNM) Stage | |
| stage 0 | 1 (0.4%) |
| stage I | 69 (30.1%) |
| stage II | 72 (31.4%) |
| stage III | 15 (6.6%) |
| stage IV | 4 (1.7%) |
| neoadjuvant chemotherapy * | 50 (21.8%) |
| unknown | 18 (7.9%) |
| Type of BC | |
| Ductal | 179 (78.2%) |
| Lobular | 13 (5.7%) |
| Ductal-Lobular | 3 (1.3%) |
| ductal carcinoma in situ (DCIS) | 4 (1.7%) |
| Others | 10 (4.4%) |
| unknown | 24 (10.5%) |
| Estrogen receptor (ER) Status a | |
| negative | 21 (9.2%) |
| positive | 160 (69.9%) |
| unknown | 48 (21.0%) |
| Progesterone receptor (PR) Status a | |
| negative | 36 (15.7%) |
| positive | 145 (63.3%) |
| unknown | 48 (21.0%) |
| Human epidermal growth factor receptor 2 (HER2) Status b | |
| negative | 165 (72.1%) |
| positive | 16 (7.0%) |
| unknown | 48 (21.0%) |
| Gene | 450K Results | Sequenom MassARRAY EpiTYPER Assay | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CpG | Cases No./CTL No. | BC Cases Mean ± SD | CTL Mean ± SD | p-Value a | CpG | Cases No./CTL No. | BC Cases Median (IQR) | CTL Median (IQR) | p-Value b | |
| RASSF1A | cg 12966367 | 48/48 | 0.029 ± 0.005 | 0.027 ± 0.004 | 0.19 | CpG_1 | 229/151 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 0.03 |
| cg25486143 | 48/48 | 0.014 ± 0.002 | 0.014 ± 0.002 | 0.80 | CpG_14 | 229/151 | 0.13 (0.11–0.16) | 0.14 (0.11–0.17) | 1.00 | |
| cg06172942 | 48/48 | 0.038 ± 0.007 | 0.038 ± 0.011 | 0.91 | CpG_15 | 229/151 | 0.13 (0.11–0.16) | 0.14 (0.11–0.17) | 1.00 | |
| cg 03297783 | 48/48 | 0.015 ± 0.002 | 0.016 ± 0.002 | 0.35 | CpG_19 | 229/151 | 0.00 (0.00–0.02) | 0.00 (0.00–0.02) | 1.00 | |
| cg08047457 * | 48/48 | 0.030 ± 0.004 | 0.030 ± 0.004 | 0.87 | CpG_2 | 229/151 | — | — | — | |
| cg25747192 * | 48/48 | 0.043 ± 0.007 | 0.043 ± 0.008 | 0.99 | CpG_3 | 229/151 | — | — | — | |
| cg21554552 * | 48/48 | 0.031 ± 0.005 | 0.030 ± 0.005 | 0.42 | CpG_4 | 229/151 | — | — | — | |
| cg27569446 * | 48/48 | 0.012 ± 0.002 | 0.011 ± 0.002 | 0.65 | CpG_5 | 229/151 | — | — | — | |
| cg04540383 * | 48/48 | 0.032 ± 0.004 | 0.033 ± 0.005 | 0.92 | CpG_18 | 229/151 | — | — | — | |
| Mean | 48/48 | 0.204 ± 0.005 | 0.205 ± 0.005 | 0.56 | Mean | 229/151 | 0.037 (0.029–0.048) | 0.042 (0.032–0.054) | 0.25 | |
| ATM | cg19288979 | 48/48 | 0.075 ± 0.006 | 0.076 ± 0.007 | 0.95 | CpG_1 | 229/151 | 0.02 (0.01–0.03) | 0.02 (0.01–0.02) | 1.00 |
| cg10610482 | 48/48 | 0.040 ± 0.005 | 0.037 ± 0.005 | 0.31 | CpG_2 | 229/151 | 0.07 (0.06–0.10) | 0.07 (0.06–0.09) | 1.00 | |
| cg12848864 | 48/48 | 0.051 ± 0.007 | 0.048 ± 0.007 | 0.38 | CpG_4 | 229/151 | 0.07 (0.06–0.10) | 0.07 (0.06–0.09) | 1.00 | |
| cg03165700 | 48/48 | 0.047 ± 0.007 | 0.044 ± 0.005 | 0.16 | CpG_5 | 229/151 | 0.07 (0.06–0.10) | 0.07 (0.06–0.09) | 1.00 | |
| cg15504467 | 48/48 | 0.027 ± 0.003 | 0.026 ± 0.004 | 0.36 | CpG_6 | 229/151 | 0.00 (0.00–0.00) | 0.00 (0.00–0.00) | 1.00 | |
| cg05033322 | 48/48 | 0.028 ± 0.004 | 0.027 ± 0.003 | 0.82 | CpG_7 | 229/151 | 0.05 (0.03–0.06) | 0.04 (0.03–0.06) | 1.00 | |
| cg16693212 | 48/48 | 0.033 ± 0.004 | 0.031 ± 0.004 | 0.29 | CpG_8 | 229/151 | 0.05 (0.03–0.06) | 0.04 (0.03–0.06) | 1.00 | |
| cg15370815 | 48/48 | 0.074 ± 0.007 | 0.072 ± 0.007 | 0.60 | CpG_10 | 229/151 | 0.11 (0.10–0.13) | 0.12 (0.10–0.13) | 1.00 | |
| cg16788234 | 48/48 | 0.052 ± 0.008 | 0.051 ± 0.007 | 0.82 | CpG_11 | 229/151 | 0.11 (0.10–0.13) | 0.12 (0.10–0.13) | 1.00 | |
| cg24030675 | 48/48 | 0.013 ± 0.001 | 0.013 ± 0.001 | 0.58 | CpG_17 | 229/151 | 0.00 (0.00–0.04) | 0.01 (0.00–0.04) | 1.00 | |
| cg06053805 | 48/48 | 0.012 ± 0.001 | 0.011 ± 0.003 | 0.14 | CpG_18 | 229/151 | 0.13 (0.12–0.16) | 0.14 (0.12–0.18) | 0.22 | |
| cg06750635 | 48/48 | 0.012 ± 0.001 | 0.011 ± 0.001 | 0.69 | CpG_19 | 229/151 | 0.13 (0.12–0.16) | 0.14 (0.12–0.18) | 0.22 | |
| cg25400013 | 48/48 | 0.016 ± 0.002 | 0.016 ± 0.001 | 0.94 | CpG_21 | 229/151 | 0.02 (0.02–0.03) | 0.02 (0.02–0.03) | 1.00 | |
| cg20342375 * | 48/48 | 0.021 ± 0.003 | 0.020 ± 0.002 | 0.085 | CpG_9 | 229/151 | — | — | — | |
| cg22837512 * | 48/48 | 0.023 ± 0.003 | 0.023 ± 0.002 | 0.99 | CpG_15 | 229/151 | — | — | — | |
| cg18391757 * | 48/48 | 0.025 ± 0.004 | 0.025 ± 0.004 | 0.72 | CpG_22 | 229/151 | — | — | — | |
| Mean | 48/48 | 0.236 ± 0.002 | 0.235 ± 0.002 | 0.79 | Mean | 229/151 | 0.047 (0.042–0.055) | 0.048 (0.042–0.056) | 1.00 | |
| Gene | Sample Type | Group | Number | Age (y, Mean ± SD) |
|---|---|---|---|---|
| RASSF1A | Peripheral blood DNA | Sporadic BC | 229 | 48.37 ± 7.08 |
| Controls | 151 | 43.76 ± 14.49 | ||
| ATM | Peripheral blood DNA | Sporadic BC | 229 | 48.37 ± 7.08 |
| Controls | 151 | 43.76 ± 14.49 |
| Target | Primer | Sequence (5′-3′) |
|---|---|---|
| RASSF1A | sense | aggaagagagGTAATGGAAATTTGGGTGTAGGGAT |
| antisense | cagtaatacgactcactatagggagaaggctCTAACAACCCAAAATAACAAAACCA | |
| ATM | sense | aggaagagagAGGGAAAATTTTTGGTTTTAAAGGT |
| antisense | cagtaatacgactcactatagggagaaggctCCATATCCACCAATAACCAAC |
| Amplicon | Sequence (5′-3′) |
|---|---|
| RASSF1A | GCAATGGAAACCTGGGTGCAGGGACTGTGGGGCCCGAAGGCGGGGCTGGGCGCGCTCTCGCAGAGCCCCCCCCGCCTTGCCCTTCCTTCCCTCCTTCGTCCCCTCCTCACACCCCACCCCGGACGGCCACAACGACGGCGACCGCAAAGCACCACGCGGAGATACCCGTGTTTCTGGAGGCCAGCTTTACTGTGCTAGAGGAAGAGGGTCCCCACATCCGGCCCTGGCCCTCCTGGTCCGGTTTGCTGAAGCAACACACTTGGCCTACCCACTGGGTGGGGCAGGAAGTCTCGAGCCTTCACTTGGGGTGAGGAGGAGGGAGATCGGTCAGCAGCTTTACCGCCCGCTCTGCTCTCCACTGCGGAGACTGGGGCTCCGGCAGAGGCTGGACCGTGATCTTGAGGTTCAGGGGTGCATTCTGGGTGGATTCCCTTGGCATGGGTGGTCGGCCCTCAGCAACTGCAGCCCTCATTTGGCTCTGTCACCCTGGGCTGCCAG |
| ATM | AGGGAAAACCTTTGGCCTCAAAGGTCCTTCTGTCCAGCATAGCCGGGTCCAATAACCCTCCATCCCGCGTCCGCGCTTACCCAATACAAGCCGGGCTACGTCCGAGGGTAACAACATGATCAAAACCACAGCAGGAACCACAATAAGGAACAAGACTCAGGTTAAAGCAAACACAGCGACAGCTCCTGCGCCGCATCTCCTGGTTCCAGTGGCGGCACTGAACTCGCGGCAATTTGTCCCGCCTCTTTCGCTTCACGGCAGCCAATCGCTTCCGCCAGAGAAAGAAAGGCGCCGAAATGAAACCCGCCTCCGTTCGCCTTCGGAACTGTCGTCACTTCCGTCCTCAGACTTGGAGGGGCGGGGATGAGGAGGGCGGGGAGGACGACGAGGGCGAAGAGGGTGGGTGAGAGCCCCGGAGCCCGAGCCGAAGGGCGAGCCGCAAACGCTAAGTCGCTGGCCATTGGTGGACATGG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, X.; Tang, Q.; Holland-Letz, T.; Gündert, M.; Cuk, K.; Schott, S.; Heil, J.; Golatta, M.; Sohn, C.; Schneeweiss, A.; et al. Evaluation of Promoter Methylation of RASSF1A and ATM in Peripheral Blood of Breast Cancer Patients and Healthy Control Individuals. Int. J. Mol. Sci. 2018, 19, 900. https://doi.org/10.3390/ijms19030900
Cao X, Tang Q, Holland-Letz T, Gündert M, Cuk K, Schott S, Heil J, Golatta M, Sohn C, Schneeweiss A, et al. Evaluation of Promoter Methylation of RASSF1A and ATM in Peripheral Blood of Breast Cancer Patients and Healthy Control Individuals. International Journal of Molecular Sciences. 2018; 19(3):900. https://doi.org/10.3390/ijms19030900
Chicago/Turabian StyleCao, Xue, Qiuqiong Tang, Tim Holland-Letz, Melanie Gündert, Katarina Cuk, Sarah Schott, Jörg Heil, Michael Golatta, Christof Sohn, Andreas Schneeweiss, and et al. 2018. "Evaluation of Promoter Methylation of RASSF1A and ATM in Peripheral Blood of Breast Cancer Patients and Healthy Control Individuals" International Journal of Molecular Sciences 19, no. 3: 900. https://doi.org/10.3390/ijms19030900
APA StyleCao, X., Tang, Q., Holland-Letz, T., Gündert, M., Cuk, K., Schott, S., Heil, J., Golatta, M., Sohn, C., Schneeweiss, A., & Burwinkel, B. (2018). Evaluation of Promoter Methylation of RASSF1A and ATM in Peripheral Blood of Breast Cancer Patients and Healthy Control Individuals. International Journal of Molecular Sciences, 19(3), 900. https://doi.org/10.3390/ijms19030900

