A Novel Sugar Transporter from Dianthus spiculifolius, DsSWEET12, Affects Sugar Metabolism and Confers Osmotic and Oxidative Stress Tolerance in Arabidopsis
Abstract
1. Introduction
2. Results
2.1. Sequence Analysis of DsSWEET12
2.2. Expression and Subcellular Localization of DsSWEET12
2.3. Overexpression of DsSWEET12 in Arabidopsis Affects Seedling Growth and Sugar Metabolism
2.4. Overexpression of DsSWEET12 in Arabidopsis Improves Tolerance to Osmotic and Oxidative Stresses
3. Discussion
4. Materials and Methods
4.1. Identification of DsSWEET12 and Sequence Analysis
4.2. Plant Material and Growth Conditions
4.3. RNA Extraction and Quantitative Real-Time PCR (qPCR) Analyses
4.4. Vector Construction and Plant Transformation
4.5. Confocal Laser Scanning Microscopy
4.6. Sugar Starvation and Stress Tolerance Assay
4.7. Sugar Content Analysis
4.8. Statistical Analyses
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Chen, L.Q. SWEET sugar transporters for phloem transport and pathogen nutrition. New Phytol. 2014, 201, 1150–1155. [Google Scholar] [CrossRef] [PubMed]
- Lemoine, R.; La Camera, S.; Atanassova, R.; Dedaldechamp, F.; Allario, T.; Pourtau, N.; Bonnemain, J.L.; Laloi, M.; Coutos-Thevenot, P.; Maurousset, L.; et al. Source-to-sink transport of sugar and regulation by environmental factors. Front. Plant Sci. 2013, 4, 272. [Google Scholar] [CrossRef] [PubMed]
- Durand, M.; Mainson, D.; Porcheron, B.; Maurousset, L.; Lemoine, R.; Pourtau, N. Carbon source-sink relationship in Arabidopsis thaliana: The role of sucrose transporters. Planta 2017. [Google Scholar] [CrossRef] [PubMed]
- Eom, J.S.; Chen, L.Q.; Sosso, D.; Julius, B.T.; Lin, I.W.; Qu, X.Q.; Braun, D.M.; Frommer, W.B. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr. Opin. Plant Biol. 2015, 25, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Kanno, Y.; Oikawa, T.; Chiba, Y.; Ishimaru, Y.; Shimizu, T.; Sano, N.; Koshiba, T.; Kamiya, Y.; Ueda, M.; Seo, M. AtSWEET13 and AtSWEET14 regulate gibberellin-mediated physiological processes. Nat. Commun. 2016, 7, 13245. [Google Scholar] [CrossRef] [PubMed]
- Streubel, J.; Pesce, C.; Hutin, M.; Koebnik, R.; Boch, J.; Szurek, B. Five phylogenetically close rice SWEET genes confer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol. 2013, 200, 808–819. [Google Scholar] [CrossRef] [PubMed]
- Mizuno, H.; Kasuga, S.; Kawahigashi, H. The sorghum SWEET gene family: Stem sucrose accumulation as revealed through transcriptome profiling. Biotechnol. Biofuels 2016, 9, 127. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Q.M.; Tang, Z.; Xu, Q.; Deng, X.X. Isolation, phylogenetic relationship and expression profiling of sugar transporter genes in sweet orange (Citrus sinensis). Plant Cell Tissue Organ Cult. 2014, 119, 609–624. [Google Scholar] [CrossRef]
- Chen, L.Q.; Hou, B.H.; Lalonde, S.; Takanaga, H.; Hartung, M.L.; Qu, X.Q.; Guo, W.J.; Kim, J.G.; Underwood, W.; Chaudhuri, B.; et al. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 2010, 468, 527–532. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, Y.; Yang, C.; Tian, Z.; Li, J. AtSWEET4, a hexose facilitator, mediates sugar transport to axial sinks and affects plant development. Sci. Rep. 2016, 6, 24563. [Google Scholar] [CrossRef] [PubMed]
- Lin, I.W.; Sosso, D.; Chen, L.Q.; Gase, K.; Kim, S.G.; Kessler, D.; Klinkenberg, P.M.; Gorder, M.K.; Hou, B.H.; Qu, X.Q.; et al. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature 2014, 508, 546–549. [Google Scholar] [CrossRef] [PubMed]
- Hedrich, R.; Sauer, N.; Neuhaus, H.E. Sugar transport across the plant vacuolar membrane: Nature and regulation of carrier proteins. Curr. Opin. Plant Biol. 2015, 25, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Klemens, P.A.; Patzke, K.; Deitmer, J.; Spinner, L.; Le Hir, R.; Bellini, C.; Bedu, M.; Chardon, F.; Krapp, A.; Neuhaus, H.E. Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth, and stress tolerance in Arabidopsis. Plant Physiol. 2013, 163, 1338–1352. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.J.; Nagy, R.; Chen, H.Y.; Pfrunder, S.; Yu, Y.C.; Santelia, D.; Frommer, W.B.; Martinoia, E. SWEET17, a facilitative transporter, mediates fructose transport across the tonoplast of Arabidopsis roots and leaves. Plant Physiol. 2014, 164, 777–789. [Google Scholar] [CrossRef] [PubMed]
- Chardon, F.; Bedu, M.; Calenge, F.; Klemens, P.A.; Spinner, L.; Clement, G.; Chietera, G.; Leran, S.; Ferrand, M.; Lacombe, B.; et al. Leaf fructose content is controlled by the vacuolar transporter SWEET17 in Arabidopsis. Curr. Biol. 2013, 23, 697–702. [Google Scholar] [CrossRef] [PubMed]
- Le Hir, R.; Spinner, L.; Klemens, P.A.; Chakraborti, D.; de Marco, F.; Vilaine, F.; Wolff, N.; Lemoine, R.; Porcheron, B.; Gery, C.; et al. Disruption of the sugar transporters AtSWEET11 and AtSWEET12 affects vascular development and freezing tolerance in Arabidopsis. Mol. Plant 2015, 8, 1687–1690. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.Q.; Qu, X.Q.; Hou, B.H.; Sosso, D.; Osorio, S.; Fernie, A.R.; Frommer, W.B. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science 2012, 335, 207–211. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.Q.; Lin, I.W.; Qu, X.Q.; Sosso, D.; McFarlane, H.E.; Londono, A.; Samuels, A.L.; Frommer, W.B. A cascade of sequentially expressed sucrose transporters in the seed coat and endosperm provides nutrition for the Arabidopsis embryo. Plant Cell 2015, 27, 607–619. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Huang, S.; Zhou, J.; Yang, B. Designer TAL effectors induce disease susceptibility and resistance to Xanthomonas oryzae pv. oryzae in rice. Mol. Plant 2013, 6, 781–789. [Google Scholar] [CrossRef] [PubMed]
- Zhou, A.; Ma, H.; Liu, E.; Jiang, T.; Feng, S.; Gong, S.; Wang, J. Transcriptome sequencing of Dianthus spiculifolius and analysis of the genes involved in responses to combined cold and drought stress. Int. J. Mol. Sci. 2017, 18, 849. [Google Scholar] [CrossRef] [PubMed]
- Couee, I.; Sulmon, C.; Gouesbet, G.; El Amrani, A. Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants. J. Exp. Bot. 2006, 57, 449–459. [Google Scholar] [CrossRef] [PubMed]
- Zhou, A.; Bu, Y.; Takano, T.; Zhang, X.; Liu, S. Conserved V-ATPase c subunit plays a role in plant growth by influencing V-ATPase-dependent endosomal trafficking. Plant Biotechnol. J. 2016, 14, 271–283. [Google Scholar] [CrossRef] [PubMed]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′→3′) | Purpose |
---|---|---|
DsSWEET12-qF | CAAAGCATTCCCTATGTGGTG | qPCR |
DsSWEET12-qR | TAGTTTGCTTGTCGGCGTAGA | qPCR |
DsActin-qF | CGGTGGCTCTATCCTCGCTT | qPCR |
DsActin-qR | TTCCTGTGGACGATTGACGG | qPCR |
AtActin1-F (AT2G37620) | GAAAATGGCTGATGGTGAAG | RT-PCR |
AtActin1-R | CTCATAGATAGGAACAGTGTGGC | RT-PCR |
DsSWEET12 (BamHI)-F | GGATCCATGACTACTTTTGCTCACTTC | Cloning and Subcellular localization |
DsSWEET12 (SacI)-R | GAGCTCTTAGGCAGTCACGGCAATT | Cloning |
DsSWEET12 (KpnI)-R | GGTACCGCAGTCACGGCAATTTGAG | Subcellular localization |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, A.; Ma, H.; Feng, S.; Gong, S.; Wang, J. A Novel Sugar Transporter from Dianthus spiculifolius, DsSWEET12, Affects Sugar Metabolism and Confers Osmotic and Oxidative Stress Tolerance in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 497. https://doi.org/10.3390/ijms19020497
Zhou A, Ma H, Feng S, Gong S, Wang J. A Novel Sugar Transporter from Dianthus spiculifolius, DsSWEET12, Affects Sugar Metabolism and Confers Osmotic and Oxidative Stress Tolerance in Arabidopsis. International Journal of Molecular Sciences. 2018; 19(2):497. https://doi.org/10.3390/ijms19020497
Chicago/Turabian StyleZhou, Aimin, Hongping Ma, Shuang Feng, Shufang Gong, and Jingang Wang. 2018. "A Novel Sugar Transporter from Dianthus spiculifolius, DsSWEET12, Affects Sugar Metabolism and Confers Osmotic and Oxidative Stress Tolerance in Arabidopsis" International Journal of Molecular Sciences 19, no. 2: 497. https://doi.org/10.3390/ijms19020497
APA StyleZhou, A., Ma, H., Feng, S., Gong, S., & Wang, J. (2018). A Novel Sugar Transporter from Dianthus spiculifolius, DsSWEET12, Affects Sugar Metabolism and Confers Osmotic and Oxidative Stress Tolerance in Arabidopsis. International Journal of Molecular Sciences, 19(2), 497. https://doi.org/10.3390/ijms19020497