Transcriptome Profiling of Two Ornamental and Medicinal Papaver Herbs
Abstract
:1. Introduction
2. Results
2.1. De Novo Transcript Assembly and Annotations
2.2. Differentially-Expressed Transcripts
2.3. Secondary Metabolite Biosynthesis Transcript Profiles
2.4. Biosynthesis of Isoquinoline Alkaloid (BIA)
2.5. Cytochrome Transcripts
3. Discussion
4. Materials and Methods
4.1. Plant Samples
4.2. PacBio Iso-Seq Library Preparation and Sequencing
4.3. PacBio Sequence Assembly and Annotation
4.4. Illumina Library Preparation and Sequencing
4.5. LC-QTOF-MS/MS Metabolome Analysis
4.6. Differential Gene Expression
4.7. KEGG Secondary Metabolite Biosynthesis Proteins
4.8. Ortholog Analysis and Phylogeny Construction
4.9. Cytochrome Family Analysis
4.10. qRT-PCR for Ramdom Selected Transcripts
4.11. Data Submission
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Zunic, L.; Skrbo, A.; Dobraca, A. Historical Contribution of Pharmaceutics to Botany and Pharmacognosy Development. Mater. Sociomed. 2017, 29, 291–300. [Google Scholar] [CrossRef] [PubMed]
- Barceloux, D.G. Heroin and the Opium Poppy Plant (Papaver somniferum L.). In Medical Toxicology of Drug Abuse; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2012; pp. 546–578. [Google Scholar]
- Bernath, J. Poppy: The Genus Papaver; Harwood Academic Publishers: London, UK, 1999; Volume 3, p. 390. [Google Scholar]
- Park, J.-Y. The War on “Red Drugs”: Anticommunism and Drug Policy in Republic of Korea, 1945–1960. Korean J. Med. Hist. 2016, 25, 77–110. [Google Scholar] [CrossRef] [PubMed]
- United Nations Office on Drugs and Crime. World Drug Report 2017; United Nations Publications: New York, NY, USA, 2017. [Google Scholar]
- NCBI. National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/taxonomy/ (accessed on 1 June 2018).
- Choe, S.; Lee, E.; Jin, G.-N.; Lee, Y.H.; Kim, S.Y.; Choi, H.; Chung, H.; Hwang, B.Y.; Kim, S. Genetic and chemical components analysis of Papaver setigerum naturalized in Korea. Forensic Sci. Int. 2012, 222, 387–393. [Google Scholar] [CrossRef] [PubMed]
- Kati, V.; Le Corre, V.; Michel, S.; Jaffrelo, L.; Poncet, C.; Délye, C. Isolation and Characterisation of 11 Polymorphic Microsatellite Markers in Papaver rhoeas L. (Corn Poppy), a Major Annual Plant Species from Cultivated Areas. Int. J. Mol. Sci. 2013, 14, 470. [Google Scholar] [CrossRef] [PubMed]
- Voglmayr, H.; Montes-Borrego, M.; Landa, B.B. Disentangling Peronospora on Papaver: Phylogenetics, Taxonomy, Nomenclature and Host Range of Downy Mildew of Opium Poppy (Papaver somniferum) and Related Species. PLoS ONE 2014, 9, e96838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Facco, E.; Zanette, G. The Odyssey of Dental Anxiety: From Prehistory to the Present. A Narrative Review. Front. Psych. 2017, 8, 1155. [Google Scholar] [CrossRef] [PubMed]
- Dang, Y.; Mu, Y.; Wang, K.; Xu, K.; Yang, J.; Zhu, Y.; Luo, B. Papaverine inhibits lipopolysaccharide-induced microglial activation by suppressing NF-κB signaling pathway. Drug Des. Dev. Ther. 2016, 10, 851–859. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Dang, T.-T.T.; Facchini, P.J. Noscapine comes of age. Phytochemistry 2015, 111, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Trang, T.; Al-Hasani, R.; Salvemini, D.; Salter, M.W.; Gutstein, H.; Cahill, C.M. Pain and Poppies: The Good, the Bad, and the Ugly of Opioid Analgesics. J. Neurosci. 2015, 35, 13879–13888. [Google Scholar] [CrossRef] [PubMed]
- Çoban, İ.; Toplan, G.G.; Özbek, B.; Gürer, Ç.U.; Sarıyar, G. Variation of alkaloid contents and antimicrobial activities of Papaver rhoeas L. growing in Turkey and northern Cyprus. Pharm. Biol. 2017, 55, 1894–1898. [Google Scholar] [CrossRef] [PubMed]
- Todorova, T.; Pesheva, M.; Gregan, F.; Chankova, S. Antioxidant, Antimutagenic, and Anticarcinogenic Effects of Papaver rhoeas L. Extract on Saccharomyces cerevisiae. J. Med. Food 2014, 18, 460–467. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Cui, Y.; Chen, X.; Li, Y.; Xu, Z.; Duan, B.; Li, Y.; Song, J.; Yao, H. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis. Molecules 2018, 23, 437. [Google Scholar] [CrossRef] [PubMed]
- Hicks, D.M.; Ouvrard, P.; Baldock, K.C.R.; Baude, M.; Goddard, M.A.; Kunin, W.E.; Mitschunas, N.; Memmott, J.; Morse, H.; Nikolitsi, M.; et al. Food for Pollinators: Quantifying the Nectar and Pollen Resources of Urban Flower Meadows. PLoS ONE 2016, 11, e0158117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, I.-K.; Hwang, B.S.; Kim, D.-W.; Kim, J.-Y.; Woo, E.E.; Lee, Y.-J.; Choi, H.J.; Yun, B.-S. Characterization of Neuraminidase Inhibitors in Korean Papaver rhoeas Bee Pollen Contributing to Anti-Influenza Activities In Vitro. Planta Med. 2016, 82, 524–529. [Google Scholar] [CrossRef] [PubMed]
- Kukula-Koch, W. The Elevation of LC-ESI-Q-TOF-MS Response in the Analysis of Isoquinoline Alkaloids from Some Papaveraceae and Berberidaceae Representatives. J. Anal. Methods Chem. 2017, 2017, 9. [Google Scholar] [CrossRef] [PubMed]
- Choe, S.; Kim, S.; Lee, C.; Yang, W.; Park, Y.; Choi, H.; Chung, H.; Lee, D.; Hwang, B.Y. Species identification of Papaver by metabolite profiling. Forensic Sci. Int. 2011, 211, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Dudek, B.; Warskulat, A.-C.; Schneider, B. The Occurrence of Flavonoids and Related Compounds in Flower Sections of Papaver nudicaule. Plants 2016, 5, 28. [Google Scholar] [CrossRef] [PubMed]
- Derya Yeşim, H.; Nazan, Y.; Oğuzhan, A.; Meltem, D.; Ahmet, H.; Ümit, D. Pyrolysis of poppy capsule pulp for bio-oil production. Waste Manag. Res. 2016, 34, 1316–1321. [Google Scholar]
- Tovar-Mendez, A.; McClure, B. Plant Reproduction: Self-Incompatibility to Go. Curr. Biol. 2016, 26, R115–R117. [Google Scholar] [CrossRef] [PubMed]
- Wheeler, M.J.; de Graaf, B.H.J.; Hadjiosif, N.; Perry, R.M.; Poulter, N.S.; Osman, K.; Vatovec, S.; Harper, A.; Franklin, F.C.H.; Franklin-Tong, V.E. Identification of the pollen self-incompatibility determinant in Papaver rhoeas. Nature 2009, 459, 992. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Eaves, D.J.; Sanchez-Moran, E.; Franklin, F.C.H.; Franklin-Tong, V.E. The Papaver rhoeas S determinants confer self-incompatibility to Arabidopsis thaliana in planta. Science 2015, 350, 684–687. [Google Scholar] [CrossRef] [PubMed]
- Scarabel, L.; Pernin, F.; Délye, C. Occurrence, genetic control and evolution of non-target-site based resistance to herbicides inhibiting acetolactate synthase (ALS) in the dicot weed Papaver rhoeas. Plant Sci. 2015, 238, 158–169. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, A.; Matsumura, E.; Koyanagi, T.; Katayama, T.; Kawano, N.; Yoshimatsu, K.; Yamamoto, K.; Kumagai, H.; Sato, F.; Minami, H. Total biosynthesis of opiates by stepwise fermentation using engineered Escherichia coli. Nat. Commun. 2016, 7, 10390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Galanie, S.; Thodey, K.; Trenchard, I.J.; Filsinger Interrante, M.; Smolke, C.D. Complete biosynthesis of opioids in yeast. Science 2015, 349, 1095. [Google Scholar] [CrossRef] [PubMed]
- Pathak, S.; Lakhwani, D.; Gupta, P.; Mishra, B.K.; Shukla, S.; Asif, M.H.; Trivedi, P.K. Comparative Transcriptome Analysis Using High Papaverine Mutant of Papaver somniferum Reveals Pathway and Uncharacterized Steps of Papaverine Biosynthesis. PLoS ONE 2013, 8, e65622. [Google Scholar] [CrossRef] [PubMed]
- Desgagné-Penix, I.; Farrow, S.C.; Cram, D.; Nowak, J.; Facchini, P.J. Integration of deep transcript and targeted metabolite profiles for eight cultivars of opium poppy. Plant Mol. Biol. 2012, 79, 295–313. [Google Scholar] [CrossRef] [PubMed]
- Desgagné-Penix, I.; Khan, M.F.; Schriemer, D.C.; Cram, D.; Nowak, J.; Facchini, P.J. Integration of deep transcriptome and proteome analyses reveals the components of alkaloid metabolism in opium poppy cell cultures. BMC Plant Biol. 2010, 10, 252. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, R.M.; Seppey, M.; Simão, F.A.; Manni, M.; Ioannidis, P.; Klioutchnikov, G.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO Applications from Quality Assessments to Gene Prediction and Phylogenomics. Mol. Biol. Evol. 2018, 35, 543–548. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Liu, Y.; Huang, P.; Ma, Y.; Qing, Z.; Tang, Q.; Cao, H.; Cheng, P.; Zheng, Y.; Yuan, Z.; et al. The Genome of Medicinal Plant Macleaya cordata Provides New Insights into Benzylisoquinoline Alkaloids Metabolism. Mol. Plant 2017, 10, 975–989. [Google Scholar] [CrossRef] [PubMed]
- Paudel, K.R.; Panth, N. Phytochemical Profile and Biological Activity of Nelumbo nucifera. Evidence-Based Complement. Alter. Med. 2015, 2015, 16. [Google Scholar] [CrossRef] [PubMed]
- Filiault, D.; Ballerini, E.; Mandakova, T.; Akoz, G.; Derieg, N.; Schmutz, J.; Jenkins, J.; Grimwood, J.; Shu, S.; Hayes, R.; et al. The Aquilegia genome: Adaptive radiation and an extraordinarily polymorphic chromosome with a unique history. bioRxiv 2018, 264101. [Google Scholar] [CrossRef]
- Luo, W.; Brouwer, C. Pathview: An R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics 2013, 29, 1830–1831. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S. Triterpene Structural Diversification by Plant Cytochrome P450 Enzymes. Front. Plant Sci. 2017, 8, 1886. [Google Scholar] [CrossRef] [PubMed]
- Subramaniyam, S.; Mathiyalagan, R.; Natarajan, S.; Kim, Y.-J.; Jang, M.-g.; Park, J.-H.; Yang, D.C. Transcript expression profiling for adventitious roots of Panax ginseng Meyer. Gene 2014, 546, 89–96. [Google Scholar] [CrossRef] [PubMed]
- Devi, B.S.R.; Kim, Y.-J.; Sathiyamoorthy, S.; Khorolragchaa, A.; Gayathri, S.; Parvin, S.; Yang, D.-U.; Selvi, S.K.; Lee, O.R.; Lee, S.; et al. Classification and characterization of putative cytochrome P450 genes from Panax ginseng C. A. Meyer. Biochemistry 2011, 76, 1347–1359. [Google Scholar] [CrossRef] [PubMed]
- Miettinen, K.; Pollier, J.; Buyst, D.; Arendt, P.; Csuk, R.; Sommerwerk, S.; Moses, T.; Mertens, J.; Sonawane, P.D.; Pauwels, L.; et al. The ancient CYP716 family is a major contributor to the diversification of eudicot triterpenoid biosynthesis. Nat. Commun. 2017, 8, 14153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hagel, J.M.; Facchini, P.J. Benzylisoquinoline Alkaloid Metabolism: A Century of Discovery and a Brave New World. Plant Cell Physiol. 2013, 54, 647–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luk, L.Y.P.; Bunn, S.; Liscombe, D.K.; Facchini, P.J.; Tanner, M.E. Mechanistic Studies on Norcoclaurine Synthase of Benzylisoquinoline Alkaloid Biosynthesis: An Enzymatic Pictet−Spengler Reaction. Biochemistry 2007, 46, 10153–10161. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.-J.; Facchini, P. Norcoclaurine Synthase Is a Member of the Pathogenesis-Related 10/Bet v1 Protein Family. Plant Cell 2010, 22, 3489–3503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hori, K.; Yamada, Y.; Purwanto, R.; Minakuchi, Y.; Toyoda, A.; Hirakawa, H.; Sato, F. Mining of the Uncharacterized Cytochrome P450 Genes Involved in Alkaloid Biosynthesis in California Poppy Using a Draft Genome Sequence. Plant Cell Physiol. 2018, 59, 222–233. [Google Scholar] [CrossRef] [PubMed]
- Nobuhiro, I.; Kinuko, I.; Fumihiko, S. Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica. FEBS J. 2007, 274, 1019–1035. [Google Scholar]
- Purwanto, R.; Hori, K.; Yamada, Y.; Sato, F. Unraveling Additional O-Methylation Steps in Benzylisoquinoline Alkaloid Biosynthesis in California Poppy (Eschscholzia californica). Plant Cell Physiol. 2017, 58, 1528–1540. [Google Scholar] [CrossRef] [PubMed]
- Morris, J.S.; Facchini, P.J. Isolation and Characterization of Reticuline N-Methyltransferase Involved in Biosynthesis of the Aporphine Alkaloid Magnoflorine in Opium Poppy. J. Biol. Chem. 2016, 291, 23416–23427. [Google Scholar] [CrossRef] [PubMed]
- Díaz Chávez, M.L.; Rolf, M.; Gesell, A.; Kutchan, T.M. Characterization of two methylenedioxy bridge-forming cytochrome P450-dependent enzymes of alkaloid formation in the Mexican prickly poppy Argemone mexicana. Arch. Biochem. Biophys. 2011, 507, 186–193. [Google Scholar] [CrossRef] [PubMed]
- Beaudoin, G.A.W.; Facchini, P.J. Isolation and characterization of a cDNA encoding (S)-cis-N-methylstylopine 14-hydroxylase from opium poppy, a key enzyme in sanguinarine biosynthesis. Biochem. Biophys. Res. Commun. 2013, 431, 597–603. [Google Scholar] [CrossRef] [PubMed]
- Abedini, D.; Monfared, S.R.; Abbasi, A. The effects of promoter variations of the N-Methylcanadine 1-Hydroxylase (CYP82Y1) gene on the noscapine production in opium poppy. Sci. Rep. 2018, 8, 4973. [Google Scholar] [CrossRef] [PubMed]
- Dang, T.-T.T.; Chen, X.; Facchini, P.J. Acetylation serves as a protective group in noscapine biosynthesis in opium poppy. Nat. Chem. Biol. 2014, 11, 104. [Google Scholar] [CrossRef] [PubMed]
- Gesell, A.; Rolf, M.; Ziegler, J.; Diaz Chavez, M.L.; Huang, F.C.; Kutchan, T.M. CYP719B1 is salutaridine synthase, the C-C phenol-coupling enzyme of morphine biosynthesis in opium poppy. J. Biol. Chem. 2009, 284, 24432–24442. [Google Scholar] [CrossRef] [PubMed]
- Gordon, S.P.; Tseng, E.; Salamov, A.; Zhang, J.; Meng, X.; Zhao, Z.; Kang, D.; Underwood, J.; Grigoriev, I.V.; Figueroa, M.; et al. Widespread Polycistronic Transcripts in Fungi Revealed by Single-Molecule mRNA Sequencing. PLoS ONE 2015, 10, e0132628. [Google Scholar] [CrossRef] [PubMed]
- Fu, L.; Niu, B.; Zhu, Z.; Wu, S.; Li, W. CD-HIT: Accelerated for clustering the next-generation sequencing data. Bioinformatics 2012, 28, 3150–3152. [Google Scholar] [CrossRef] [PubMed]
- Conesa, A.; Götz, S. Blast2GO: A Comprehensive Suite for Functional Analysis in Plant Genomics. Int. J. Plant Genom. 2008, 2008, 619832. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Stoeckert, C.J.; Roos, D.S. OrthoMCL: Identification of Ortholog Groups for Eukaryotic Genomes. Genome Res. 2003, 13, 2178–2189. [Google Scholar] [CrossRef] [PubMed]
- Yamada, K.D.; Tomii, K.; Katoh, K. Application of the MAFFT sequence alignment program to large data—Reexamination of the usefulness of chained guide trees. Bioinformatics 2016, 32, 3246–3251. [Google Scholar] [CrossRef] [PubMed]
- Talavera, G.; Castresana, J. Improvement of Phylogenies after Removing Divergent and Ambiguously Aligned Blocks from Protein Sequence Alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Gricman, Ł.; Vogel, C.; Pleiss, J. Identification of universal selectivity-determining positions in cytochrome P450 monooxygenases by systematic sequence-based literature mining. Proteins Struct. Funct. Bioinform. 2015, 83, 1593–1603. [Google Scholar] [CrossRef] [PubMed]
A. Sequencing and Assembly | ||||
---|---|---|---|---|
Technology | PacBio (Iso-Seq) | Illumina (Hi-Seq) | ||
Reads | Bases (MB) | Reads | Bases (GB) | |
Raw Sequence (HQ * Reads) | 324,602 | 700 | 1,273,902,514 | 128.8 |
Processed Sequence | 324,602 | 700 | 1,235,970,946 | 125.8 |
Denovo Assembled Contigs (N50) | 120,926 (3117) | 302 | ||
Reference Mapped | 79.7% (Average of mapped reads) | |||
Expressed | 59,135 | |||
B. Annotations | ||||
# of Sequences | # of Reference IDs | |||
BLAST Hits | 93,672 (77.5%) | 29,862 | ||
Gene Ontology | 69,399 (57.4%) | 3587 | ||
KEGG Enzymes | 13,187 (11%) | 675 | ||
C. Transdecoder | ||||
Total Transcripts | 103,043 (85.2%) | |||
Complete | 83,384 (68.9%) | |||
5′ Partial | 15,913 (13.1%) | |||
3′ Partial | 3664 (3%) | |||
Internal | 82 | |||
D. BUSCO | ||||
Total Core Genes | 1440 (100%) | |||
Complete | 1185 (82.3%) | |||
Fragmented Core Genes | 75 (5.2%) | |||
Missing Core Genes | 180 (5.2%) |
Transcripts | Forward | Reverse |
---|---|---|
PORISO0045617 | GACAATGAACAAGGATACC | CTTCTTCTGCTTCGTCTA |
PORISO0059405 | CTTCCATTGTTGCTCTTCTACTTG | TGCTGCTGCTGTTGATGA |
PPNISO0009509 | ATCGTGTGAAGGAGATAC | TTAGGACCAGTGCTTATG |
PPNISO0023750 | AACCACCACCAAGATACC | GGCGATAAGCAACTAATGTC |
PPNISO0040912 | GCTGTTAGAGATGTGGAA | CTTCTTCGTCGTAATTCTG |
PPNISO0060303 | TTATGGTGGCAAGATGAGT | TGTTGTTCGGTCCAGTAA |
PPRISO0016643 | TCCATTATCAGCCAGTTC | TCTCCGCTTATGTAATCG |
PPRISO0023519 | GATTCTCGCATTCGGATT | ATCACCATTGGATCTTGTC |
PSIISO0004667 | CTTGTGTTCTTGATGGGAAA | CGATAAGGCTAGGCAGAT |
PSIISO0007238 | TGGATACTTGGCATCTTG | GTGGCTTACATCTTCCTT |
PSIISO0009650 | CCAAGGAACTCTTCATCA | CTTGCGTTCATTAGACTTAC |
PSIISO0024140 | CAATGGAGAAGAATGGATGA | GTAACACAAGGAAGGATGAA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oh, J.; Shin, Y.; Ha, I.J.; Lee, M.Y.; Lee, S.-G.; Kang, B.-C.; Kyeong, D.; Kim, D. Transcriptome Profiling of Two Ornamental and Medicinal Papaver Herbs. Int. J. Mol. Sci. 2018, 19, 3192. https://doi.org/10.3390/ijms19103192
Oh J, Shin Y, Ha IJ, Lee MY, Lee S-G, Kang B-C, Kyeong D, Kim D. Transcriptome Profiling of Two Ornamental and Medicinal Papaver Herbs. International Journal of Molecular Sciences. 2018; 19(10):3192. https://doi.org/10.3390/ijms19103192
Chicago/Turabian StyleOh, Jaehyeon, Younhee Shin, In Jin Ha, Min Young Lee, Seok-Geun Lee, Byeong-Chul Kang, Dongsoo Kyeong, and Dowan Kim. 2018. "Transcriptome Profiling of Two Ornamental and Medicinal Papaver Herbs" International Journal of Molecular Sciences 19, no. 10: 3192. https://doi.org/10.3390/ijms19103192
APA StyleOh, J., Shin, Y., Ha, I. J., Lee, M. Y., Lee, S.-G., Kang, B.-C., Kyeong, D., & Kim, D. (2018). Transcriptome Profiling of Two Ornamental and Medicinal Papaver Herbs. International Journal of Molecular Sciences, 19(10), 3192. https://doi.org/10.3390/ijms19103192