Citrus aurantium L. and Its Flavonoids Regulate TNBS-Induced Inflammatory Bowel Disease through Anti-Inflammation and Suppressing Isolated Jejunum Contraction
Abstract
1. Introduction
2. Results
2.1. CAL Improves Symptoms of TNBS-Induced IBD Colitis in Rats
2.2. CAL Suppresses Inflammation in TNBS-Induced Colitis
2.3. The Effects of CAL, Naringenin, Nobiletin, and Hesperetin on Mouse-Isolated Jejunum Contractility
2.4. Mechanism Studies of Naringenin and Nobiletin on Jejunum Contractility
2.5. Anti-Inflammatory Effect of Naringenin, Nobiletin, and Hesperetin in Lipopolysaccharide (LPS)-Induced RAW264.7 Cells
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals
4.3. TNBS-Induced Experimental Colitis
4.4. Colon Damage Assay
4.5. Detection of Inflammatory Cytokines and Mediators in Colon and Serum
4.6. Effects of CAL and Its Flavonoids on Mice Jejunum Contraction
4.7. Inflammatory Response Induced by LPS on RAW264.7
4.8. RT-PCR Analysis
4.9. Western Blot Analysis
4.10. Statistic Analysis
Author Contributions
Acknowledgments
Conflicts of Interest
Abbreviations
IBD | inflammatory bowel disease |
TNBS | 2,4,6-trinitrobenzene sulfonic acid |
NO | nitric oxide |
MPO | myeloperoxidase |
H&E | hematoxylin and eosin |
DAI | disease activity index |
TNF-α | tumor necrosis factor-α |
COX-2 | cyclooxygenase-2 |
iNOS | inducible nitric oxide synthase |
NF-κB | nuclear factor kappa-light-chain-enhancer of activated B cells |
LPS | lipopolysaccharide |
ACh | acetylcholine |
L-NAME | N(ω)-nitro-l-arginine methylester hydrochloride |
NOS | nitric oxide synthase |
IP3 | inositol triphosphate |
References
- Chachu, K.; Osterman, M. How to Diagnose and Treat IBD Mimics in the Refractory IBD Patient Who Does Not Have IBD. Inflamm. Bowel Dis. 2016, 22, 1262–1274. [Google Scholar] [CrossRef] [PubMed]
- Stapersma, L.; Van den brink, G.; Szigethy, E.M.; Escher, J.C.; Utens, E.M.W.J. Systematic review with meta-analysis: anxiety and depression in children and adolescents with inflammatory bowel disease. Aliment Pharmacol. Ther. 2018. [Google Scholar] [CrossRef] [PubMed]
- Gisbert, J.; Chaparro, M. Systematic review with meta-analysis: inflammatory bowel disease in the elderly. Aliment Pharmacol. Ther. 2014, 39, 459–477. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.J.; Gu, J.F.; Hou, X.F.; Chen, J.; Yang, N.; Liu, Y.; Wang, G.; Du, M.; Qiu, H.H.; Luo, Y.; Jiang, Z.Y.; Feng, L. Anti-inflammatory effect of miltirone on inflammatory bowel disease via TLR4/NF-κB/IQGAP2 signaling pathway. Biomed. Pharmacother. 2017, 85, 531–540. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.S.; Chen, M.; Lee, J.; Lee, C.K.; Kim, Y.S. Diagnosis of inflammatory bowel disease in Asia: the results of a multinational web-based survey in the 2(nd) Asian Organization for Crohn’s and Colitis (AOCC) meeting in Seoul. Intest. Res. 2016, 14, 224–230. [Google Scholar] [CrossRef] [PubMed]
- Thia, K.T.; Loftus, E.V., Jr.; Sandborn, W.J.; Yang, S.K. An update on the epidemiology of inflammatory bowel disease in Asia. Am. J. Gastroenterol. 2008, 103, 3167–3182. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Z.R.; Zhu, Z.H.; Yang, Y.Y.; Ruan, W.S.; Peng, X.B.; Su, Y.H.; Peng, L.; Chen, J.Q.; Yin, Q.; Zhao, C.; et al. Incidence and clinical characteristics of inflammatory bowel disease in a developed region of Guangdong Province, China: A prospective population-based study. J. Gastroenterol. Hepatol. 2013, 28, 1148–1153. [Google Scholar] [PubMed]
- Tang, Z.H.; Li, T.; Tong, Y.G.; Chen, X.J.; Chen, X.P.; Wang, Y.T.; Lu, J.J. A Systematic Review of the Anticancer Properties of Compounds Isolated from Licorice (Gancao). Planta Med. 2015, 81, 1670–1687. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.H.; Chen, M.Y.; Li, Y.; Wang, Y.Y.; Wei, L.; Liao, Z.Q.; Wang, M.X.; Ma, F.L.; Liao, Q.F.; Xie, Z.Y. Modulation of Gut Microbiome Composition and Function in Experimental Colitis Treated with Sulfasalazine. Front. Microbiol. 2017, 8, 1703–1717. [Google Scholar] [CrossRef] [PubMed]
- Hommel, K.A.; Baldassano, R.N. Brief report: Barriers to treatment adherence in pediatric inflammatory bowel disease. J. Pediatr. Psychol. 2010, 35, 1005–1010. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.H.; Zhang, C.W.; Bucheli, P.; Wei, D.Z. Citrus flavonoids in fruit and traditional Chinese medicinal food ingredients in China. Plant Foods Hum. Nutr. 2006, 61, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Rani, N.; Bharti, S.; Krishnamurthy, B.; Bhatia, J.; Sharma, C.; Kamal, M.A.; Ojha, S.; Arya, D.S. Pharmacological Properties and Therapeutic Potential of Naringenin: A Citrus Flavonoid of Pharmaceutical Promise. Curr. Pharm. Des. 2016, 22, 4341–4359. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Qian, J.; Cao, J.P.; Wang, D.L.; Liu, C.R.; Yang, R.X.; Li, X.; Sun, C.D. Antioxidant Capacity, Anticancer Ability and Flavonoids Composition of 35 Citrus (Citrus reticulata Blanco) Varieties. Molecules 2017, 22, 1114. [Google Scholar] [CrossRef] [PubMed]
- Pepe, G.; Pagano, F.; Adesso, S.; Sommella, E.; Ostacolo, C.; Manfra, M.; Chieppa, M.; Sala, M.; Russo, M.; Marzocco, S.; et al. Bioavailable Citrus sinensis Extract: Polyphenolic Composition and Biological Activity. Molecules 2017, 22, 623. [Google Scholar] [CrossRef] [PubMed]
- Cheng, L.P.; Ren, Y.J.; Lin, D.B.; Peng, S.; Zhong, B.; Ma, Z.C. The Anti-Inflammatory Properties of Citrus wilsonii Tanaka Extract in LPS-Induced RAW 264.7 and Primary Mouse Bone Marrow-Derived Dendritic Cells. Molecules 2017, 22, 1213. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, M.; Alves, G.; Falcão, A. Investigating herb-drug interactions: the effect of Citrus aurantium fruit extract on the pharmacokinetics of amiodarone in rats. Food Chem. Toxicol. 2013, 60, 153–159. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Zhang, Y.; Wang, X.R.; Guo, L.L.; Han, L.F.; Liu, E.W.; Wang, T. Zhizhu decoction promotes gastric emptying and protects the gastric mucosa. J. Med. Food. 2013, 16, 306–311. [Google Scholar] [CrossRef] [PubMed]
- Xuan, Z.; Wei, W.S.; Yang, B.; Tao, B.C.; Zeng, H.Y.; Jia, W.W.; Min, M.S.; Yu, Y.Z.; Wei, P.; Hong, L.Y. Urinary metabolite profiling of flavonoids in Chinese volunteers after consumption of orange juice by UFLC -Q-TOF-MS/MS. J. Chromatogr. B. 2017, 1061–1062. [Google Scholar]
- Li, S.; Sang, S.; Pan, M.H.; Lai, C.S.; Lo, C.Y.; Yang, C.S. Anti-inflammatory property of the urinary metabolites of nobiletin in mouse. Bioorg. Med. Chem. Lett. 2007, 17, 5177–5181. [Google Scholar]
- Lundberg, S.; Holst, M.; Hellström, P.M. Expression of iNOS mRNA associated with suppression of colonic contraction in rat colitis. Acta Physiol. (Oxf). 2006, 187, 489–494. [Google Scholar] [CrossRef] [PubMed]
- Ohama, T.; Hori, M.; Sato, K.; Ozaki, H.; Karaki, H. Chronic treatment with interleukin-1beta attenuates contractions by decreasing the activities of CPI-17 and MYPT-1 in intestinal smooth muscle. J. Biol. Chem. 2003, 278, 48794–48804. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Peyrin-Biroulet, L.; Eisenhut, M.; Shin, J.I. IBD immunopathogenesis: A comprehensive review of inflammatory molecules. Autoimmun Rev. 2017, 16, 416–426. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.H.; Li, Z.; Meng, Q.J.; Zhang, P.; Yan, P.C.; Zhang, Z.B.; Zhang, H.; Pan, J.R.; Zhai, Y.J.; Liu, Y.G.; Wang, X.K.; Li, W.W.; Zhao, Y.P. Chronic Calcium Channel Inhibitor Verapamil Antagonizes TNF-α-Mediated Inflammatory Reaction and Protects Against Inflammatory Arthritis in Mice. Inflammation 2016, 39, 1624–1634. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.B.; Lee, W.S.; Shin, J.S.; Jang, D.S.; Lee, K.T. Xanthotoxin suppresses LPS-induced expression of iNOS, COX-2, TNF-α, and IL-6 via AP-1, NF-κB, and JAK-STAT inactivation in RAW 264.7 macrophages. Int. Immunopharmacol. 2017, 49, 21–29. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.S.; Wang, J.H.; Gu, S.B.; Liu, Z.B.; Zhang, Y.J.; Zhang, X.X. Simultaneous determination of flavonoids in different parts of Citrus reticulata “Chachi” fruit by high performance liquid chromatography -photodiode array detection. Molecules 2010, 15, 5378–5388. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.C.; Chang, C.M.; Hsu, W.L.; Chiu, S.J.; Tsai, Y.T.; Chou, Y.H.; Hou, M.F.; Wang, J.Y.; Lee, M.H.; Tsai, K.L.; Chang, W.C. Indomethacin inhibits cancer cell migration via attenuation of cellular calcium mobilization. Molecules 2013, 18, 6584–6596. [Google Scholar] [CrossRef] [PubMed]
- Godo, S.; Sawada, A.; Saito, H.; Ikeda, S.; Enkhjargal, B.; Suzuki, K.; Tanaka, S.; Shimokawa, H. Disruption of Physiological Balance Between Nitric Oxide and Endothelium-Dependent Hyperpolarization Impairs Cardiovascular Homeostasis in Mice. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Cancela, J.M. Specific Ca2+ signaling evoked by cholecystokinin and acetylcholine: the roles of NAADP, cADPR, and IP3. Annu. Rev. Physiol. 2001, 63, 99–117. [Google Scholar] [CrossRef] [PubMed]
- Zhan, Z.B.; Deng, K.Z.; Xiong, Y.; Ding, Y.Q.; Deng, M.Z. Stimultaneous determination of six ingredients in Aurantii Fructus Immaturus by HPLC. Chin. Hosp. Pharm. J. 2015, 35, 1080–1082. [Google Scholar]
- Kim, H.; Berstad, A. Experimental colitis in animal models. Scand. J. Gastroenterol. 1992, 27, 529–537. [Google Scholar] [CrossRef] [PubMed]
- Algieri, F.; Rodriguez-Nogales, A.; Garrido-Mesa, J.; Camuesco, D.; Vezza, T.; Garrido-Mesa, N.; Utrilla, P.; Rodriguez-Cabezas, M.E.; Pischel, I.; Galvez, J. Intestinal anti-inflammatory activity of calcium pyruvate in the TNBS model of rat colitis: Comparison with ethyl pyruvate. Biochem. Pharmacol. 2016, 103, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Rashidian, A.; Muhammadnejad, A.; Dehpour, A.R.; Mehr, S.E.; Akhavan, M.M.; Shirkoohi, R.; Chamanara, M.; Mousavi, S.E.; Rezayat, S.M. Atorvastatin attenuates TNBS-induced rat colitis: The involvement of the TLR4/NF-kB signaling pathway. Inflammopharmacology 2016, 24, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Takagi, T.; Naito, Y.; Mizushima, K.; Akagiri, S.; Suzuki, T.; Hirata, I.; Omatsu, T.; Handa, O.; Kokura, S.; Ichikawa, H.; Yoshikawa, T. Inhalation of carbon monoxide ameliorates TNBS-induced colitis in mice through the inhibition of TNF-α expression. Dig. Dis. Sci. 2010, 55, 2797–2804. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Hu, S.H.; Zhang, H.W.; Guan, Q.F.; Yang, Y.H.; Wang, X.M. Anti-inflammatory effects of Dioscorea alata L. anthocyanins in a TNBS-induced colitis model. Food Funct. 2017, 8, 659–669. [Google Scholar] [CrossRef] [PubMed]
- Novak, G.; Parker, C.E.; Pai, R.K.; MacDonald, J.K.; Feagan, B.G.; Sandborn, W.J.; D’Haens, G.; Jairath, V.; Khanna, R. Histologic scoring indices for evaluation of disease activity in Crohn’s disease. Cochrane DB Syst. Rev. 2017, 7, 1–69. [Google Scholar]
- Jian, L.; Meng, Y.L.; Hai, Y.Y.; Wei, W.; Li, F.H.; Qian, C.; Jing, Y.R.; Shao, S.W.; Yi, Z.; Tao, W. Mangiferin Improves Hepatic Lipid Metabolism Mainly Through Its Metabolite-Norathyriol by Modulating SIRT-1/AMPK/SREBP-1c Signaling. Front Pharmacol. 2018, 9. [Google Scholar] [CrossRef]
Colon Damage | Score |
---|---|
No damage | 0 |
Hyperemia with ulcers | 1 |
Hyperemia and wall thickening without ulcers | 2 |
One ulceration site without wall thickening | 3 |
Two or more ulceration sites | 4 |
0.5-cm extension of inflammation or major damage | 5 |
1-cm extension of inflammation or severe damage | 6–10 |
DAI Score | Weight Loss (%) | Stool Consistency | Occult/gross Bleeding |
---|---|---|---|
0 | None | None | None |
1 | 1–5 | Loose | Hem occult positive |
2 | 5–10 | ||
3 | 10–15 | Diarrhea | Gross bleeding |
4 | >15 |
Inflammatory Cell Infiltration | Tissue Damage | ||
---|---|---|---|
No infiltration | 0 | No mucosal damage | 0 |
Increased number of inflammatory cells in the lamina propria | 1 | Discrete epithelial lesions | 1 |
Inflammatory cells extending into the submucosa | 2 | Erosions or focal ulcerations | 2 |
Transmural inflammatory cell infiltration | 3 | Severe mucosal damage with extensive ulceration extending into the bowel wall | 3 |
Species | Gene | Primer Sequence | |
---|---|---|---|
Rat | COX-2 | F: TCGGAGGAGAAGTGGGTTTTAG | R: TTGATGGTGGCTGTCTTGGTAGG |
TNF-α | F: GATGTGGAACTGGCAGAGGAG | R: CACGAGCAGGAATGAGAAGAG | |
iNOS | F: TTGGAGCGAGTTGTGGATTGTT | R: TAGGTGAGGGCTTGCCTGAGTG | |
NF-κB | F: AACACTGCCGACCTCAAGAT | R: CATCGGCTTGAGAAAAGGAG | |
GAPDH | F: TGAGGCCGGTGCTGAGTATGT | R: CAGTCTTCTGGGTGGCAGTGA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, W.; Li, Y.; Liu, M.; Yu, H.; Chen, Q.; Chen, Y.; Ruan, J.; Ding, Z.; Zhang, Y.; Wang, T. Citrus aurantium L. and Its Flavonoids Regulate TNBS-Induced Inflammatory Bowel Disease through Anti-Inflammation and Suppressing Isolated Jejunum Contraction. Int. J. Mol. Sci. 2018, 19, 3057. https://doi.org/10.3390/ijms19103057
He W, Li Y, Liu M, Yu H, Chen Q, Chen Y, Ruan J, Ding Z, Zhang Y, Wang T. Citrus aurantium L. and Its Flavonoids Regulate TNBS-Induced Inflammatory Bowel Disease through Anti-Inflammation and Suppressing Isolated Jejunum Contraction. International Journal of Molecular Sciences. 2018; 19(10):3057. https://doi.org/10.3390/ijms19103057
Chicago/Turabian StyleHe, Wei, Yongmin Li, Mengyang Liu, Haiyang Yu, Qian Chen, Yue Chen, Jingya Ruan, Zhijuan Ding, Yi Zhang, and Tao Wang. 2018. "Citrus aurantium L. and Its Flavonoids Regulate TNBS-Induced Inflammatory Bowel Disease through Anti-Inflammation and Suppressing Isolated Jejunum Contraction" International Journal of Molecular Sciences 19, no. 10: 3057. https://doi.org/10.3390/ijms19103057
APA StyleHe, W., Li, Y., Liu, M., Yu, H., Chen, Q., Chen, Y., Ruan, J., Ding, Z., Zhang, Y., & Wang, T. (2018). Citrus aurantium L. and Its Flavonoids Regulate TNBS-Induced Inflammatory Bowel Disease through Anti-Inflammation and Suppressing Isolated Jejunum Contraction. International Journal of Molecular Sciences, 19(10), 3057. https://doi.org/10.3390/ijms19103057