Validation of Suitable Housekeeping Genes for the Normalization of mRNA Expression for Studying Tumor Acidosis
Abstract
1. Introduction
2. Results
2.1. Expression Profile of Candidate HKG
2.2. Analysis of the Stability of Candidate Reference Genes in Acid Tumor Microenvironment
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.2. Illumina Genome Analyzer Sequencing and Data Analysis
4.3. RNA Isolation and cDNA Synthesis
4.4. RT-qPCR
4.5. Stability and Statistical Analysis for Reference Genes
4.6. Comprehensive Analysis of Ranks
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| 18S rRNA | 18S ribosomal RNA |
| ACTB | Actin β |
| B2M | β-2-Microglobulin |
| G6PD | Glucose-6-phosphate dehydrogenase |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
| GUSB | β-Glucuronidase |
| HKG | Housekeeping genes |
| HMBS | Hydroxymethylbilane synthase |
| HPRT1 | Hypoxanthine phosphoribosyltransferase 1 |
| PGK1 | Phosphoglycerate kinase 1 |
| PPIA | Peptidylprolyl isomerase A |
| RPL13a | Ribosomal protein L13a |
| SDHA | Succinate dehydrogenase complex, subunit A |
| TBP | TATA-binding protein |
| TUBB | Tubulin, β class I |
| YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide |
References
- Quail, D.F.; Joyce, J.A. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kolosenko, I.; Avnet, S.; Baldini, N.; Viklund, J.; De Milito, A. Therapeutic implications of tumor interstitial acidification. Semin. Cancer Biol. 2017, 43, 119–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Warburg, O. On the origin of cancer cells. Science 1956, 123, 309–314. [Google Scholar] [PubMed]
- Schornack, P.A.; Gillies, R.J. Contributions of cell metabolism and H+ diffusion to the acidic pH of tumors. Neoplasia 2003, 5, 135–145. [Google Scholar] [CrossRef] [Scilit]
- Lemma, S.; Di Pompo, G.; Porporato, P.E.; Sboarina, M.; Russell, S.; Gillies, R.J.; Baldini, N.; Sonveaux, P.; Avnet, S. MDA-MB-231 breast cancer cells fuel osteoclast metabolism and activity: A new rationale for the pathogenesis of osteolytic bone metastases. Biochim. Biophys. Acta 2017, 1863, 3254–3264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horsman, M.R.; Vaupel, P. Pathophysiological Basis for the Formation of the Tumor Microenvironment. Front. Oncol. 2016, 6, 66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Longo, D.L.; Bartoli, A.; Consolino, L.; Bardini, P.; Arena, F.; Schwaiger, M.; Aime, S. In Vivo Imaging of Tumor Metabolism and Acidosis by Combining PET and MRI-CEST pH Imaging. Cancer Res. 2016, 76, 6463–6470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luetke, A.; Meyers, P.A.; Lewis, I.; Juergens, H. Osteosarcoma treatment—Where do we stand? A state of the art review. Cancer Treat. Rev. 2014, 40, 523–532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geller, D.S.; Gorlick, R. Osteosarcoma: A review of diagnosis, management, and treatment strategies. Clin. Adv. Hematol. Oncol. 2010, 8, 705–718. [Google Scholar] [PubMed]
- Ferrari, S.; Perut, F.; Fagioli, F.; Brach Del Prever, A.; Meazza, C.; Parafioriti, A.; Picci, P.; Gambarotti, M.; Avnet, S.; Baldini, N.; et al. Proton pump inhibitor chemosensitization in human osteosarcoma: From the bench to the patients’ bed. J. Transl. Med. 2013, 11, 268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perut, F.; Avnet, S.; Fotia, C.; Baglìo, S.R.; Salerno, M.; Hosogi, S.; Kusuzaki, K.; Baldini, N. V-ATPase as an effective therapeutic target for sarcomas. Exp. Cell Res. 2014, 320, 21–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonuccelli, G.; Avnet, S.; Grisendi, G.; Salerno, M.; Granchi, D.; Dominici, M.; Kusuzaki, K.; Baldini, N. Role of mesenchymal stem cells in osteosarcoma and metabolic reprogramming of tumor cells. Oncotarget 2014, 5, 7575–7588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avnet, S.; Lemma, S.; Cortini, M.; Pellegrini, P.; Perut, F.; Zini, N.; Kusuzaki, K.; Chano, T.; Grisendi, G.; Dominici, M.; et al. Altered pH gradient at the plasma membrane of osteosarcoma cells is a key mechanism of drug resistance. Oncotarget 2016, 7, 63408–63423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chano, T.; Avnet, S.; Kusuzaki, K.; Bonuccelli, G.; Sonveaux, P.; Rotili, D.; Mai, A.; Baldini, N. Tumour-specific metabolic adaptation to acidosis is coupled to epigenetic stability in osteosarcoma cells. Am. J. Cancer Res. 2016, 6, 859–875. [Google Scholar] [PubMed]
- Avnet, S.; Di Pompo, G.; Chano, T.; Errani, C.; Ibrahim-Hashim, A.; Gillies, R.J.; Donati, D.M.; Baldini, N. Cancer-associated mesenchymal stroma fosters the stemness of osteosarcoma cells in response to intratumoral acidosis via NF-κB activation. Int. J. Cancer 2017, 140, 1331–1345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cortini, M.; Avnet, S.; Baldini, N. Mesenchymal stroma: Role in osteosarcoma progression. Cancer Lett. 2017, 405, 90–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, A.J.; Geller, D.S.; Gorlick, R. Therapy for osteosarcoma: Where do we go from here? Paediatr. Drugs 2008, 10, 315–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Isakoff, M.S.; Bielack, S.S.; Meltzer, P.; Gorlick, R. Osteosarcoma: Current Treatment and a Collaborative Pathway to Success. J. Clin. Oncol. 2015, 33, 3029–3035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szabo, A.; Perou, C.M.; Karaca, M.; Perreard, L.; Palais, R.; Quackenbush, J.F.; Bernard, P.S. Statistical modeling for selecting housekeeper genes. Genome Biol. 2004, 5, R59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lemma, S.; Avnet, S.; Salerno, M.; Chano, T.; Baldini, N. Identification and validation of housekeeping genes for gene expression analysis of cancer stem cells. PLoS ONE 2016, 11, e0149481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pikor, L.; Thu, K.; Vucic, E.; Lam, W. The detection and implication of genome instability in cancer. Cancer Metastasis Rev. 2013, 32, 341–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walker, N.J. A technique whose time has come. Science 2002, 296, 557–559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patanè, S.; Avnet, S.; Coltella, N.; Costa, B.; Sponza, S.; Olivero, M.; Vigna, E.; Naldini, L.; Baldini, N.; Ferracini, R.; et al. MET overexpression turns human primary osteoblasts into osteosarcomas. Cancer Res. 2006, 66, 4750–4757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morita, T.; Nagaki, T.; Fukuda, I.; Okumura, K. Clastogenicity of low pH to various cultured mammalian cells. Mutat. Res. 1992, 268, 297–305. [Google Scholar] [CrossRef] [Scilit]
- Kuehne, A.; Hildebrand, J.; Soehle, J.; Wenck, H.; Terstegen, L.; Gallinat, S.; Knott, A.; Winnefeld, M.; Zamboni, N. An integrative metabolomics and transcriptomics study to identify metabolic alterations in aged skin of humans in vivo. BMC Genom. 2017, 18, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kowalewska, M.; Danska-Bidzinska, A.; Bakula-Zalewska, E.; Bidzinski, M. Identification of suitable reference genes for gene expression measurement in uterine sarcoma and carcinosarcoma tumors. Clin. Biochem. 2012, 45, 368–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bustin, S.; Huggett, J. qPCR primer design revisited. Biomol. Detect. Quantif. 2017, 14, 19–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selvey, S.; Thompson, E.W.; Matthaei, K.; Lea, R.A.; Irving, M.G.; Griffiths, L.R. β-Actin—An unsuitable internal control for RT-PCR. Mol. Cell. Probes 2001, 15, 307–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Jonge, H.J.; Fehrmann, R.S.; de Bont, E.S.; Hofstra, R.M.; Gerbens, F.; Kamps, W.A.; de Vries, E.G.; van der Zee, A.G.; te Meerman, G.J.; ter Elst, A. Evidence based selection of housekeeping genes. PLoS ONE 2007, 2, e898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chomczynski, P.; Sacchi, N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: Twenty-something years on. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Symbol | Gene Name | Accession No. | Forward Primer 5′-3′ | Reverse Primer 5′-3′ | Amplicon Size (nt) |
|---|---|---|---|---|---|
| 18S rRNA | 18S ribosomal RNA | X03205.1 | gcaattattccccatgaacg | gggacttaatcaacgcaagc | 68 |
| ACTB | Actin β | NM_001101.2 | ccaccgcgagaagatga | ccagaggcgtacagggatag | 97 |
| B2M | β-2-Microglobulin | NM_004048.2 | ttctggcctggaggctatc | tcaggaaatttgactttccattc | 86 |
| G6PD | Glucose-6-phosphate dehydrogenase | M24470.1|M24470 | gaagggccacatcatctctg | atctgctccagttccaaagg | 76 |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | NM_002046.3 | agccacatcgctcagacac | gcccaatacgaccaaatcc | 66 |
| GUSB | β-Glucuronidase | M15182.1|M15182 | cgccctgcctatctgtattc | tccccacagggagtgtgtag | 91 |
| HMBS | Hydroxymethylbilane synthase | NM_000190.3 | tgtggtgggaaccagctc | tgttgaggtttccccgaat | 92 |
| HPRT1 | Hypoxanthine phosphoribosyltransferase 1 | M31642.1|M31642 | tgaccttgatttattttgcatacc | cgagcaagacgttcagtcct | 102 |
| PGK1 | Phosphoglycerate kinase 1 | NM_000291.3 | ggagaacctccgctttcat | gctggctcggctttaacc | 78 |
| PPIA | Peptidylprolyl isomerase A | NM_021130.3 | atgctggacccaacacaaat | tctttcactttgccaaacacc | 97 |
| RPL13a | Ribosomal protein L13a | NM_012423.3 | caagcggatgaacaccaac | tgtggggcagcatacctc | 95 |
| SDHA | Succinate dehydrogenase complex, subunit A | NM_004168.2 | ggacctggttgtctttggtc | ccagcgtttggtttaattgg | 93 |
| TBP | TATA-binding protein | NM_001172085.1 | ttgggttttccagctaagttct | ccaggaaataactctggctca | 140 |
| TUBB | Tubulin, β class I | NM_178014.2 | ataccttgaggcgagcaaaa | tcactgatcacctcccagaac | 113 |
| YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide | NM_003406.3 | ccgttacttggctgaggttg | tgcttgttgtgactgatcgac | 67 |
| Gene | Ct Value at pH 6.5 and 7.4 (Mean ± SD) | Ct Value at pH 6.5 (Mean ± SD) | Ct Value at pH 7.4 (Mean ± SD) | ΔCt Value (Difference of Mean ± SD Pooled) |
|---|---|---|---|---|
| 18S rRNA | 9.64 ± 0.91 | 9.48 ± 0.80 | 9.79 ± 1.04 | −0.32 ± 0.18 |
| ACTB | 20.47 ± 1.38 | 20.35 ± 1.10 | 20.58 ± 1.68 | −0.24 ± 0.30 |
| B2M | 20.75 ± 1.25 | 20.15 ± 0.89 | 21.35 ± 1.30 | −1.20 ± 0.49 |
| G6PD | 30.39 ± 1.55 | 30.48 ± 1.76 | 30.31 ± 1.39 | 0.17 ± 0.21 |
| GAPDH | 20.79 ± 0.77 | 20.95 ± 0.71 | 20.63 ± 0.84 | 0.32 ± 0.15 |
| GUSB | 30.23 ± 1.27 | 30.07 ± 1.41 | 30.39 ± 1.16 | −0.33 ± 0.21 |
| HMBS | 27.34 ± 1.41 | 27.54 ± 1.43 | 27.14 ± 1.45 | 0.40 ± 0.29 |
| HPRT1 | 26.95 ± 1.60 | 26.93 ± 1.75 | 26.96 ± 1.54 | −0.04 ± 0.21 |
| PGK1 | 22.41 ± 1.33 | 22.43 ± 1.39 | 22.39 ± 1.35 | 0.04 ± 0.16 |
| PPIA | 21.08 ± 1.35 | 21.41 ± 1.25 | 20.75 ± 1.43 | 0.66 ± 0.32 |
| RPL13a | 20.12 ± 1.02 | 20.28 ± 1.05 | 19.97 ± 1.03 | 0.30 ± 0.18 |
| SDHA | 25.04 ± 1.58 | 24.84 ± 1.84 | 25.24 ± 1.36 | −0.40 ± 0.27 |
| TBP | 27.59 ± 2.68 | 26.87 ± 3.06 | 28.31 ± 2.19 | −1.43 ± 0.81 |
| TUBB | 22.72 ± 1.59 | 23.22 ± 1.65 | 22.23 ± 1.44 | 1.00 ± 0.46 |
| YWHAZ | 23.12 ± 1.07 | 23.39 ± 0.94 | 22.85 ± 1.17 | 0.54 ± 0.27 |
| Gene | NormFinder | GeNorm | BestKeeper | ΔCt | Coefficient of Variation | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Stability Value | Rank | M Value | Rank | ST.DEV [+/− CP] | Rank | ST.DEV | Rank | CV | Rank | |
| YWHAZ | 0.265 | 1 | 0.518 | 1 | 0.776 | 4 | 1.076 | 1 | 0.040 | 2 |
| RPL13a | 0.389 | 2 | 0.756 | 5 | 0.924 | 6 | 1.203 | 5 | 0.052 | 6 |
| PPIA | 0.398 | 3 | 0.682 | 4 | 0.969 | 7 | 1.164 | 4 | 0.058 | 9 |
| 18S rRNA | 0.401 | 4 | 0.518 | 1 | 0.604 | 2 | 1.144 | 3 | 0.084 | 14 |
| GUSB | 0.431 | 5 | 0.802 | 6 | 1.166 | 9 | 1.142 | 2 | 0.047 | 4 |
| ACTB | 0.461 | 6 | 0.861 | 8 | 0.872 | 5 | 1.330 | 10 | 0.054 | 7 |
| HMBS | 0.471 | 7 | 0.826 | 7 | 1.242 | 10 | 1.205 | 6 | 0.052 | 5 |
| GAPDH | 0.519 | 8 | 0.589 | 3 | 0.537 | 1 | 1.260 | 7 | 0.034 | 1 |
| PGK1 | 0.533 | 9 | 0.991 | 11 | 0.988 | 8 | 1.276 | 8 | 0.062 | 10 |
| HPRT1 | 0.570 | 10 | 0.911 | 9 | 1.397 | 13 | 1.287 | 9 | 0.065 | 11 |
| TUBB | 0.578 | 11 | 0.953 | 10 | 1.345 | 12 | 1.332 | 11 | 0.071 | 12 |
| SDHA | 0.655 | 12 | 1.085 | 13 | 1.338 | 11 | 1.461 | 12 | 0.074 | 13 |
| B2M | 0.697 | 13 | 1.039 | 12 | 0.680 | 3 | 1.467 | 13 | 0.044 | 3 |
| G6PD | 0.874 | 14 | 1.162 | 14 | 1.493 | 14 | 1.757 | 14 | 0.058 | 8 |
| TBP | 1.205 | 15 | 1.406 | 15 | 2.223 | 15 | 2.991 | 15 | 0.114 | 15 |
| Gene | NormFinder | GeNorm | BestKeeper | ΔCt | Coefficient of Variation | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Stability Value | Rank | M Value | Rank | ST.DEV [+/− CP] | Rank | ST.DEV | Rank | CV | Rank | |
| YWHAZ | 0.329 | 1 | 0.660 | 3 | 0.885 | 4 | 0.938 | 1 | 0.051 | 4 |
| TUBB | 0.336 | 2 | 0. 836 | 8 | 1.109 | 11 | 0.967 | 2 | 0.065 | 11 |
| ACTB | 0.413 | 3 | 0.771 | 5 | 1.298 | 14 | 0.994 | 3 | 0.082 | 14 |
| PPIA | 0.444 | 4 | 0.716 | 4 | 1.018 | 7 | 1.032 | 4 | 0.069 | 12 |
| SDHA | 0.458 | 5 | 0.914 | 11 | 1.081 | 10 | 1.043 | 6 | 0.054 | 7 |
| RPL13a | 0.462 | 6 | 0.620 | 1/2 | 0.670 | 2 | 1.072 | 9 | 0.052 | 5 |
| GUSB | 0.469 | 7 | 0.815 | 7 | 1.002 | 5 | 1.047 | 7 | 0.038 | 1 |
| HPRT1 | 0.493 | 8 | 0.796 | 6 | 1.261 | 13 | 1.042 | 5 | 0.057 | 8 |
| 18S rRNA | 0.494 | 9 | 0.882 | 10 | 0.828 | 3 | 1.079 | 10 | 0.106 | 15 |
| B2M | 0.509 | 10 | 0.620 | 2/1 | 1.038 | 9 | 1.047 | 8 | 0.061 | 10 |
| PGK1 | 0.510 | 11 | 0.939 | 12 | 1.034 | 8 | 1.118 | 12 | 0.060 | 9 |
| HMBS | 0.520 | 12 | 0.962 | 13 | 1.169 | 12 | 1.184 | 13 | 0.053 | 6 |
| GAPDH | 0.557 | 13 | 0.862 | 9 | 0.658 | 1 | 1.117 | 11 | 0.040 | 2 |
| G6PD | 0.691 | 14 | 1.026 | 14 | 1.015 | 6 | 1.438 | 14 | 0.046 | 3 |
| TBP | 0.748 | 15 | 1.130 | 15 | 1.362 | 15 | 1.805 | 15 | 0.077 | 13 |
| Gene | NormFinder | GeNorm | BestKeeper | ΔCt | Coefficient of Variation | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Stability Value | Rank | M Value | Rank | ST.DEV [+/− CP] | Rank | ST.DEV | Rank | CV | Rank | |
| YWHAZ | 0.335 | 1 | 0.861 | 6 | 0.880 | 4 | 1.072 | 1 | 0.046 | 3 |
| 18S rRNA | 0.441 | 2 | 0.914 | 8 | 0.719 | 2 | 1.158 | 3 | 0.095 | 14 |
| GUSB | 0.455 | 3 | 0.686 | 1/2 | 1.102 | 9 | 1.136 | 2 | 0.042 | 2 |
| PPIA | 0.463 | 4 | 0.787 | 4 | 1.032 | 7 | 1.171 | 5 | 0.064 | 11 |
| ACTB | 0.469 | 5 | 0.937 | 9 | 1.097 | 8 | 1.211 | 7 | 0.068 | 12 |
| RPL13a | 0.473 | 6 | 0.838 | 5 | 0.796 | 3 | 1.167 | 4 | 0.051 | 4 |
| PGK1 | 0.528 | 7 | 1.006 | 11 | 1.011 | 6 | 1.218 | 8 | 0.059 | 8 |
| HPRT1 | 0.535 | 8 | 0.694 | 3 | 1.329 | 13 | 1.189 | 6 | 0.059 | 7 |
| TUBB | 0.550 | 9 | 0.973 | 10 | 1.343 | 14 | 1.292 | 11 | 0.070 | 13 |
| GAPDH | 0.556 | 10 | 0.890 | 7 | 0.638 | 1 | 1.220 | 9 | 0.037 | 1 |
| HMBS | 0.565 | 11 | 0.686 | 1/2 | 1.228 | 10 | 1.226 | 10 | 0.051 | 6 |
| SDHA | 0.598 | 12 | 1.038 | 12 | 1.241 | 11 | 1.301 | 12 | 0.063 | 10 |
| B2M | 0.649 | 13 | 1.084 | 13 | 0.890 | 5 | 1.452 | 13 | 0.061 | 9 |
| G6PD | 0.794 | 14 | 1.144 | 14 | 1.264 | 12 | 1.598 | 14 | 0.051 | 5 |
| TBP | 0.965 | 15 | 1.330 | 15 | 1.683 | 15 | 2.537 | 15 | 0.097 | 15 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lemma, S.; Avnet, S.; Meade, M.J.; Chano, T.; Baldini, N. Validation of Suitable Housekeeping Genes for the Normalization of mRNA Expression for Studying Tumor Acidosis. Int. J. Mol. Sci. 2018, 19, 2930. https://doi.org/10.3390/ijms19102930
Lemma S, Avnet S, Meade MJ, Chano T, Baldini N. Validation of Suitable Housekeeping Genes for the Normalization of mRNA Expression for Studying Tumor Acidosis. International Journal of Molecular Sciences. 2018; 19(10):2930. https://doi.org/10.3390/ijms19102930
Chicago/Turabian StyleLemma, Silvia, Sofia Avnet, Michael Joseph Meade, Tokuhiro Chano, and Nicola Baldini. 2018. "Validation of Suitable Housekeeping Genes for the Normalization of mRNA Expression for Studying Tumor Acidosis" International Journal of Molecular Sciences 19, no. 10: 2930. https://doi.org/10.3390/ijms19102930
APA StyleLemma, S., Avnet, S., Meade, M. J., Chano, T., & Baldini, N. (2018). Validation of Suitable Housekeeping Genes for the Normalization of mRNA Expression for Studying Tumor Acidosis. International Journal of Molecular Sciences, 19(10), 2930. https://doi.org/10.3390/ijms19102930

