Apolipoprotein M Inhibits Angiogenic and Inflammatory Response by Sphingosine 1-Phosphate on Retinal Pigment Epithelium Cells
Abstract
:1. Introduction
2. Results
2.1. Expression of Sphingosine 1-Phosphate (S1P) Receptors in Retinal Pigment Epithelium (RPE) Cells
2.2. S1P Upregulates the Expression and Secretion of Vascular Endothelial Growth Factor (VEGF) in RPE Cells
2.3. S1P Modulates Hypoxia Inducible Factor (HIF)-1α Protein Levels in RPE Cells
2.4. Apolipoprotein M (ApoM)/S1P Inhibits the Expression of Chemokines and Proangiogenic Factors Induced by S1P
2.5. ApoM/S1P Suppresses the Enhancement of Laser-Induced Choroidal Neovascularization (CNV) in Mice
3. Discussion
4. Materials and Methods
4.1. Culture of RPE Cells
4.2. Reagents
4.3. Preparation of S1P and ApoM-Bound S1P
4.4. Quantitative Real-Time Polymerase Chain Reaction (PCR)
4.5. Western Blotting
4.6. Enzyme-Linked Immunosorbent Assay (ELISA)
4.7. Murine Model of CNV
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Conflicts of Interest
References
- Sparrow, J.R.; Hicks, D.; Hamel, C.P. The retinal pigment epithelium in health and disease. Curr. Mol. Med. 2010, 10, 802–823. [Google Scholar] [CrossRef] [PubMed]
- Dornonville de la Cour, M. Ion transport in the retinal pigment epithelium. A study with double barrelled ion-selective microelectrodes. Acta Ophthalmol. Suppl. 1993, 209, 1–32. [Google Scholar]
- Liljekvist-Soltic, I.; Olofsson, J.; Johansson, K. Progenitor cell-derived factors enhance photoreceptor survival in rat retinal explants. Brain Res. 2008, 1227, 226–233. [Google Scholar] [CrossRef] [PubMed]
- Blaauwgeers, H.G.; Holtkamp, G.M.; Rutten, H.; Witmer, A.N.; Koolwijk, P.; Partanen, T.A.; Alitalo, K.; Kroon, M.E.; Kijlstra, A.; van Hinsbergh, V.W.; et al. Polarized vascular endothelial growth factor secretion by human retinal pigment epithelium and localization of vascular endothelial growth factor receptors on the inner choriocapillaris. Evidence for a trophic paracrine relation. Am. J. Pathol. 1999, 155, 421–428. [Google Scholar] [CrossRef]
- Holtkamp, G.M.; Kijlstra, A.; Peek, R.; de Vos, A.F. Retinal pigment epithelium-immune system interactions: Cytokine production and cytokine-induced changes. Prog. Retin. Eye Res. 2001, 20, 29–48. [Google Scholar] [CrossRef]
- Ferris, F.L., 3rd; Fine, S.L.; Hyman, L. Age-related macular degeneration and blindness due to neovascular maculopathy. Arch. Ophthalmol. 1984, 102, 1640–1642. [Google Scholar] [CrossRef] [PubMed]
- Klein, R.; Wang, Q.; Klein, B.E.; Moss, S.E.; Meuer, S.M. The relationship of age-related maculopathy, cataract, and glaucoma to visual acuity. Investig. Ophthalmol. Vis. Sci. 1995, 36, 182–191. [Google Scholar]
- Sarks, S.H. Ageing and degeneration in the macular region: A clinico-pathological study. Br. J. Ophthalmol. 1976, 60, 324–341. [Google Scholar] [CrossRef] [PubMed]
- Nowak, J.Z. Age-related macular degeneration (AMD): Pathogenesis and therapy. Pharmacol. Rep. 2006, 58, 353–363. [Google Scholar] [PubMed]
- Nagineni, C.N.; Kommineni, V.K.; Ganjbaksh, N.; Nagineni, K.K.; Hooks, J.J.; Detrick, B. Inflammatory cytokines induce expression of chemokines by human retinal cells: Role in chemokine receptor mediated age-related macular degeneration. Aging Dis. 2015, 6, 444–455. [Google Scholar] [CrossRef] [PubMed]
- Cabral, T.; Mello, L.G.M.; Lima, L.H.; Polido, J.; Regatieri, C.V.; Belfort, R., Jr.; Mahajan, V.B. Retinal and choroidal angiogenesis: A review of new targets. Int. J. Retin. Vitreous 2017, 3, 31. [Google Scholar] [CrossRef] [PubMed]
- Bressler, S.B. Introduction: Understanding the role of angiogenesis and antiangiogenic agents in age-related macular degeneration. Ophthalmology 2009, 116, S1–S7. [Google Scholar] [CrossRef] [PubMed]
- Heier, J.S.; Brown, D.M.; Chong, V.; Korobelnik, J.F.; Kaiser, P.K.; Nguyen, Q.D.; Kirchhof, B.; Ho, A.; Ogura, Y.; Yancopoulos, G.D.; et al. Intravitreal aflibercept (VEGF trap-eye) in wet age-related macular degeneration. Ophthalmology 2012, 119, 2537–2548. [Google Scholar] [CrossRef] [PubMed]
- Rosenfeld, P.J.; Brown, D.M.; Heier, J.S.; Boyer, D.S.; Kaiser, P.K.; Chung, C.Y.; Kim, R.Y. Ranibizumab for neovascular age-related macular degeneration. N. Engl. J. Med. 2006, 355, 1419–1431. [Google Scholar] [CrossRef] [PubMed]
- Schmidt-Erfurth, U.; Chong, V.; Loewenstein, A.; Larsen, M.; Souied, E.; Schlingemann, R.; Eldem, B.; Mones, J.; Richard, G.; Bandello, F. Guidelines for the management of neovascular age-related macular degeneration by the European society of retina specialists (EURETINA). Br. J. Ophthalmol. 2014, 98, 1144–1167. [Google Scholar] [CrossRef] [PubMed]
- Mintz-Hittner, H.A.; Kennedy, K.A.; Chuang, A.Z. Efficacy of intravitreal bevacizumab for stage 3+ retinopathy of prematurity. N. Engl. J. Med. 2011, 364, 603–615. [Google Scholar] [CrossRef] [PubMed]
- Massin, P.; Bandello, F.; Garweg, J.G.; Hansen, L.L.; Harding, S.P.; Larsen, M.; Mitchell, P.; Sharp, D.; Wolf-Schnurrbusch, U.E.; Gekkieva, M.; et al. Safety and efficacy of ranibizumab in diabetic macular edema (RESOLVE study): A 12-month, randomized, controlled, double-masked, multicenter phase II study. Diabetes Care 2010, 33, 2399–2405. [Google Scholar] [CrossRef] [PubMed]
- Stangos, A.N.; Gandhi, J.S.; Nair-Sahni, J.; Heimann, H.; Pournaras, C.J.; Harding, S.P. Polypoidal choroidal vasculopathy masquerading as neovascular age-related macular degeneration refractory to ranibizumab. Am. J. Ophthalmol. 2010, 150, 666–673. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Robredo, P.; Sancho, A.; Johnen, S.; Recalde, S.; Gama, N.; Thumann, G.; Groll, J.; Garcia-Layana, A. Current treatment limitations in age-related macular degeneration and future approaches based on cell therapy and tissue engineering. J. Ophthalmol. 2014, 2014, 510285. [Google Scholar] [CrossRef] [PubMed]
- Spiegel, S.; Milstien, S. Sphingosine-1-phosphate: An enigmatic signalling lipid. Nat. Rev. Mol. Cell Biol. 2003, 4, 397–407. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, T.; Hla, T. Structural and functional characteristics of S1P receptors. J. Cell. Biochem. 2004, 92, 913–922. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.F.; Zeng, Q.; Ozaki, H.; Wang, L.; Hand, A.R.; Hla, T.; Wang, E.; Lee, M.J. Dual roles of tight junction-associated protein, zonula occludens-1, in sphingosine 1-phosphate-mediated endothelial chemotaxis and barrier integrity. J. Biol. Chem. 2006, 281, 29190–29200. [Google Scholar] [CrossRef] [PubMed]
- Takabe, K.; Paugh, S.W.; Milstien, S.; Spiegel, S. “Inside-out” Signaling of sphingosine-1-phosphate: Therapeutic targets. Pharmacol. Rev. 2008, 60, 181–195. [Google Scholar] [CrossRef] [PubMed]
- Xie, B.; Shen, J.; Dong, A.; Rashid, A.; Stoller, G.; Campochiaro, P.A. Blockade of sphingosine-1-phosphate reduces macrophage influx and retinal and choroidal neovascularization. J. Cell. Physiol. 2009, 218, 192–198. [Google Scholar] [CrossRef] [PubMed]
- Aoki, S.; Yatomi, Y.; Ohta, M.; Osada, M.; Kazama, F.; Satoh, K.; Nakahara, K.; Ozaki, Y. Sphingosine 1-phosphate-related metabolism in the blood vessel. J. Biochem. 2005, 138, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Murata, N.; Sato, K.; Kon, J.; Tomura, H.; Yanagita, M.; Kuwabara, A.; Ui, M.; Okajima, F. Interaction of sphingosine 1-phosphate with plasma components, including lipoproteins, regulates the lipid receptor-mediated actions. Biochem. J. 2000, 352 Pt 3, 809–815. [Google Scholar] [CrossRef] [PubMed]
- Christoffersen, C.; Obinata, H.; Kumaraswamy, S.B.; Galvani, S.; Ahnstrom, J.; Sevvana, M.; Egerer-Sieber, C.; Muller, Y.A.; Hla, T.; Nielsen, L.B.; et al. Endothelium-protective sphingosine-1-phosphate provided by HDL-associated apolipoprotein M. Proc. Natl. Acad. Sci. USA 2011, 108, 9613–9618. [Google Scholar] [CrossRef] [PubMed]
- Xu, N.; Dahlback, B. A novel human apolipoprotein (APOM). J. Biol. Chem. 1999, 274, 31286–31290. [Google Scholar] [CrossRef] [PubMed]
- Christoffersen, C.; Jauhiainen, M.; Moser, M.; Porse, B.; Ehnholm, C.; Boesl, M.; Dahlback, B.; Nielsen, L.B. Effect of apolipoprotein m on high density lipoprotein metabolism and atherosclerosis in low density lipoprotein receptor knock-out mice. J. Biol. Chem. 2008, 283, 1839–1847. [Google Scholar] [CrossRef] [PubMed]
- Kurano, M.; Tsukamoto, K.; Ohkawa, R.; Hara, M.; Iino, J.; Kageyama, Y.; Ikeda, H.; Yatomi, Y. Liver involvement in sphingosine 1-phosphate dynamism revealed by adenoviral hepatic overexpression of apolipoprotein M. Atherosclerosis 2013, 229, 102–109. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, M.; Frej, C.; Holmer, A.; Guo, L.J.; Tran, S.; Dahlback, B. High-density lipoprotein-associated apolipoprotein m limits endothelial inflammation by delivering sphingosine-1-phosphate to the sphingosine-1-phosphate receptor 1. Arterioscler. Thromb. Vasc. Biol. 2017, 37, 118–129. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, M.; Okada, H.; Dahlback, B. HDL-associated ApoM is anti-apoptotic by delivering sphingosine 1-phosphate to S1P1 & S1P3 receptors on vascular endothelium. Lipids Health Dis 2017, 16, 36. [Google Scholar] [PubMed]
- Hait, N.C.; Oskeritzian, C.A.; Paugh, S.W.; Milstien, S.; Spiegel, S. Sphingosine kinases, sphingosine 1-phosphate, apoptosis and diseases. Biochim. Biophys. Acta 2006, 1758, 2016–2026. [Google Scholar] [CrossRef] [PubMed]
- Terao, R.; et al. Tokyo University: Tokyo, Japan, Data in preparation for submission. 2017.
- Qiao, Y.; Hu, R.; Wang, Q.; Qi, J.; Yang, Y.; Kijlstra, A.; Yang, P. Sphingosine 1-phosphate elicits proinflammatory responses in ARPE-19 cells. Investig. Ophthalmol. Vis. Sci. 2012, 53, 8200–8207. [Google Scholar] [CrossRef] [PubMed]
- Michaud, M.D.; Robitaille, G.A.; Gratton, J.P.; Richard, D.E. Sphingosine-1-phosphate: A novel nonhypoxic activator of hypoxia-inducible factor-1 in vascular cells. Arterioscler. Thromb. Vasc. Biol. 2009, 29, 902–908. [Google Scholar] [CrossRef] [PubMed]
- Hajny, S.; Christoffersen, C. A novel perspective on the ApoM-S1P axis, highlighting the metabolism of ApoM and its role in liver fibrosis and neuroinflammation. Int. J. Mol. Sci. 2017, 18, 1636. [Google Scholar] [CrossRef] [PubMed]
- Axler, O.; Ahnstrom, J.; Dahlbock, B. An elisa for apolipoprotein m reveals a strong correlation to total cholesterol in human plasma. J. Lipid Res. 2007, 48, 1772–1780. [Google Scholar] [CrossRef] [PubMed]
- Hla, T. Physiological and pathological actions of sphingosine 1-phosphate. Semin. Cell Dev. Biol. 2004, 15, 513–520. [Google Scholar] [CrossRef] [PubMed]
- Maines, L.W.; French, K.J.; Wolpert, E.B.; Antonetti, D.A.; Smith, C.D. Pharmacologic manipulation of sphingosine kinase in retinal endothelial cells: Implications for angiogenic ocular diseases. Investig. Ophthalmol. Vis. Sci. 2006, 47, 5022–5031. [Google Scholar] [CrossRef] [PubMed]
- Swaney, J.S.; Moreno, K.M.; Gentile, A.M.; Sabbadini, R.A.; Stoller, G.L. Sphingosine-1-phosphate (S1P) is a novel fibrotic mediator in the eye. Exp. Eye Res. 2008, 87, 367–375. [Google Scholar] [CrossRef] [PubMed]
- Egom, E.E.; Fitzgerald, R.; Canning, R.; Pharithi, R.B.; Murphy, C.; Maher, V. Determination of sphingosine-1-phosphate in human plasma using liquid chromatography coupled with Q-ToF mass spectrometry. Int. J. Mol. Sci. 2017, 18, 1800. [Google Scholar] [CrossRef] [PubMed]
- Skoura, A.; Sanchez, T.; Claffey, K.; Mandala, S.M.; Proia, R.L.; Hla, T. Essential role of sphingosine 1-phosphate receptor 2 in pathological angiogenesis of the mouse retina. J. Clin. Investig. 2007, 117, 2506–2516. [Google Scholar] [CrossRef] [PubMed]
- Endo, A.; Nagashima, K.; Kurose, H.; Mochizuki, S.; Matsuda, M.; Mochizuki, N. Sphingosine 1-phosphate induces membrane ruffling and increases motility of human umbilical vein endothelial cells via vascular endothelial growth factor receptor and CrkII. J. Biol. Chem. 2002, 277, 23747–23754. [Google Scholar] [CrossRef] [PubMed]
- Tanimoto, T.; Jin, Z.G.; Berk, B.C. Transactivation of vascular endothelial growth factor (VEGF) receptor Flk-1/KDR is involved in sphingosine 1-phosphate-stimulated phosphorylation of Akt and endothelial nitric-oxide synthase (eNOS). J. Biol. Chem. 2002, 277, 42997–43001. [Google Scholar] [CrossRef] [PubMed]
- Igarashi, J.; Erwin, P.A.; Dantas, A.P.; Chen, H.; Michel, T. VEGF induces S1P1 receptors in endothelial cells: Implications for cross-talk between sphingolipid and growth factor receptors. Proc. Natl. Acad. Sci. USA 2003, 100, 10664–10669. [Google Scholar] [CrossRef] [PubMed]
- Pitson, S.M.; Xia, P.; Leclercq, T.M.; Moretti, P.A.; Zebol, J.R.; Lynn, H.E.; Wattenberg, B.W.; Vadas, M.A. Phosphorylation-dependent translocation of sphingosine kinase to the plasma membrane drives its oncogenic signalling. J. Exp. Med. 2005, 201, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Coronado, C.G.; Guzman, A.; Rodriguez, A.; Mondragon, J.A.; Romano, M.C.; Gutierrez, C.G.; Rosales-Torres, A.M. Sphingosine-1-phosphate, regulated by FSH and VEGF, stimulates granulosa cell proliferation. Gen. Comp. Endocrinol. 2016, 236, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Chumanevich, A.; Wedman, P.; Oskeritzian, C.A. Sphingosine-1-phosphate/sphingosine-1-phosphate receptor 2 axis can promote mouse and human primary mast cell angiogenic potential through upregulation of vascular endothelial growth factor-a and matrix metalloproteinase-2. Mediat. Inflamm. 2016, 2016, 1503206. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, T.; Skoura, A.; Wu, M.T.; Casserly, B.; Harrington, E.O.; Hla, T. Induction of vascular permeability by the sphingosine-1-phosphate receptor-2 (S1P2R) and its downstream effectors ROCK and PTEN. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 1312–1318. [Google Scholar] [CrossRef] [PubMed]
- O’Sullivan, M.J.; Hirota, N.; Martin, J.G. Sphingosine 1-phosphate (S1P) induced interleukin-8 (IL-8) release is mediated by S1P receptor 2 and nuclear factor κb in beas-2b cells. PLoS ONE 2014, 9, e95566. [Google Scholar] [CrossRef] [PubMed]
- Dehne, N.; Brune, B. HIF-1 in the inflammatory microenvironment. Exp. Cell Res. 2009, 315, 1791–1797. [Google Scholar] [CrossRef] [PubMed]
- Li, G.Y.; Fan, B.; Wu, Y.Z.; Wang, X.R.; Wang, Y.H.; Wu, J.X. Changes of expression of HIF-1α in the human retinal pigment epithelium induced by hypoxia. Zhonghua Yan Ke Za Zhi 2005, 41, 312–316. [Google Scholar] [PubMed]
- Arjamaa, O.; Aaltonen, V.; Piippo, N.; Csont, T.; Petrovski, G.; Kaarniranta, K.; Kauppinen, A. Hypoxia and inflammation in the release of VEGF and interleukins from human retinal pigment epithelial cells. Graefes Arch. Clin. Exp. Ophthalmol. 2017. [Google Scholar] [CrossRef] [PubMed]
- Kalhori, V.; Kemppainen, K.; Asghar, M.Y.; Bergelin, N.; Jaakkola, P.; Tornquist, K. Sphingosine-1-phosphate as a regulator of hypoxia-induced factor-1α in thyroid follicular carcinoma cells. PLoS ONE 2013, 8, e66189. [Google Scholar] [CrossRef] [PubMed]
- Strieter, R.M.; Kunkel, S.L.; Elner, V.M.; Martonyi, C.L.; Koch, A.E.; Polverini, P.J.; Elner, S.G. Interleukin-8. A corneal factor that induces neovascularization. Am. J. Pathol. 1992, 141, 1279–1284. [Google Scholar] [PubMed]
- Wilkerson, B.A.; Grass, G.D.; Wing, S.B.; Argraves, W.S.; Argraves, K.M. Sphingosine 1-phosphate (S1P) carrier-dependent regulation of endothelial barrier: High density lipoprotein (HDL)-S1P prolongs endothelial barrier enhancement as compared with albumin-S1P via effects on levels, trafficking, and signaling of S1P1. J. Biol. Chem. 2012, 287, 44645–44653. [Google Scholar] [CrossRef] [PubMed]
- Blaho, V.A.; Galvani, S.; Engelbrecht, E.; Liu, C.; Swendeman, S.L.; Kono, M.; Proia, R.L.; Steinman, L.; Han, M.H.; Hla, T. HDL-bound sphingosine-1-phosphate restrains lymphopoiesis and neuroinflammation. Nature 2015, 523, 342–346. [Google Scholar] [CrossRef] [PubMed]
- Christensen, P.M.; Liu, C.H.; Swendeman, S.L.; Obinata, H.; Qvortrup, K.; Nielsen, L.B.; Hla, T.; di Lorenzo, A.; Christoffersen, C. Impaired endothelial barrier function in apolipoprotein m-deficient mice is dependent on sphingosine-1-phosphate receptor 1. FASEB J. 2016, 30, 2351–2359. [Google Scholar] [CrossRef] [PubMed]
- Lambert, V.; Lecomte, J.; Hansen, S.; Blacher, S.; Gonzalez, M.L.; Struman, I.; Sounni, N.E.; Rozet, E.; de Tullio, P.; Foidart, J.M.; et al. Laser-induced choroidal neovascularization model to study age-related macular degeneration in mice. Nat. Protoc. 2013, 8, 2197–2211. [Google Scholar] [CrossRef] [PubMed]
Oligos | Forward (5′–3′) | Reverse (3′–5′) |
---|---|---|
S1P1 | AAATTCCACCGACCCATGTA | AGTTATTGCTCCCGTTGTGG |
S1P2 | ACTGTCCTGCCTCTCTACGCC | GTCTTGAGCAGGGCTAGCGTC |
S1P3 | ACCATCGTGATCCTCTACGCAC | CTTGATTTACTTCTGCTTGGGTCG |
S1P4 | TGCTGAAGACGGTGCTGATG | CCCAGAGGTTGGAGCCAAAG |
S1P5 | AGGACCTTGTGGGTGATATAGAGGAC | CCCCTTCACCTTCTCTGGTTTTC |
IL-8 | ATGACTTCCAAGCTGGCCGTGGCT | TCTCAGCCCTCTTCAAAAACTTCTC |
VEGF | CCCTGATGAGATCGAGTACATCT | AGCAAGGCCCACAGGGATTT |
GAPDH | AATTCCATGGCACCGTCAAG | ATCGCCCCACTTGATTTTGG |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Terao, R.; Honjo, M.; Aihara, M. Apolipoprotein M Inhibits Angiogenic and Inflammatory Response by Sphingosine 1-Phosphate on Retinal Pigment Epithelium Cells. Int. J. Mol. Sci. 2018, 19, 112. https://doi.org/10.3390/ijms19010112
Terao R, Honjo M, Aihara M. Apolipoprotein M Inhibits Angiogenic and Inflammatory Response by Sphingosine 1-Phosphate on Retinal Pigment Epithelium Cells. International Journal of Molecular Sciences. 2018; 19(1):112. https://doi.org/10.3390/ijms19010112
Chicago/Turabian StyleTerao, Ryo, Megumi Honjo, and Makoto Aihara. 2018. "Apolipoprotein M Inhibits Angiogenic and Inflammatory Response by Sphingosine 1-Phosphate on Retinal Pigment Epithelium Cells" International Journal of Molecular Sciences 19, no. 1: 112. https://doi.org/10.3390/ijms19010112
APA StyleTerao, R., Honjo, M., & Aihara, M. (2018). Apolipoprotein M Inhibits Angiogenic and Inflammatory Response by Sphingosine 1-Phosphate on Retinal Pigment Epithelium Cells. International Journal of Molecular Sciences, 19(1), 112. https://doi.org/10.3390/ijms19010112