First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications
Abstract
:1. Introduction
2. Results and Discussion
2.1. Genome Annotation and Base Composition
2.2. Protein-Coding Genes, Transfer RNA and Ribosomal RNA Genes
2.3. The Control Region
2.4. Phylogenetic Analyses
3. Materials and Methods
3.1. Sample Preparation and DNA Extraction
3.2. PCR Amplification and Sequencing
3.3. Mitogenome Assembly, Annotation and Analyses
3.4. Phylogenetic Analyses
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
| IGN | Intergenic Nucleotide |
| PCG | Protein-Coding Gene |
| tRNA | Transfer RNA |
| rRNA | Ribosomal RNA |
| CR | Control Region |
| SL | Stem-Loop |
| CSB | Conserved Sequence Block |
| BI | Bayesian inferences |
| ML | Maximum likelihood |
Appendix A
| Regions | Strategy | LA-PCR Primers (5′–3′) | Specific Primers (5′–3′) |
|---|---|---|---|
| cox1–cytb | Shotgun | COI-1F: GAAAATGGGGCTGGGACCG Cytb-1R: TTCGGGTTGAATATGAACAGGG | YP01200761-1F: AGAAGACCGACGAACGCC YP01200765-1F: CAGCAAAAGGCCCCCACG YP01200769-1F: CGGTTTACAGCAGCACTTCA YP01200786-1F: CCCTTTTAGACACCACCCTT YP01200797-1F: TACAGCTGGTAAAAATAGTTCAAA YP01200760-1R: TTCACACAAGCTGCACGAT YP01200772-1R: TGTTGGGAAGAGGAATCTAAGA YP01200773-1R: AACTGCCTGTGGGTATCGT YP01200783-1R: GCCGAAACCCCCCTCCTG YP01200786-2F: TTGCCATTCCAAACCCAT YP01200783-1F: TGCGTTTCGGCAAGGTAT YP01200797-1R: GGTTGATGCTACCCCTGG NJCJ-COI-3F: GATTTATGCCATCACGATACTCA NJCJ-COI-5F: ATGCTTTATCCCATTTTTCG NJCJ-Cytb-4R: TTTGGGTTGTGATGTTATTTCTT NJCJ-COI-5R: TGTTGGGGAAAGTCTTCTATGGA NJCJ-COI-6F: AAAAGCGGCATATCACTGTT NJCJ-Cytb-5R: TTGATTGCTTACTCTTCGGTTG NJCJ-COI-7F: ACCCCAATCAGCCTCCTAA NJCJ-Cytb-6R: GTTGTTTTTACATTGATTTCCTTT |
| Primer walking | COI-2F: GGTTGATGCTACCCCTGGACG COI-4F: TTGATTTCACCCAATATAGAACTAA Cytb-3R: GGGGATGTGTTATTTGGGTG Cytb-2R: GAAAGCTAAGTCAATATGGGCA Cytb-4F: GCCTAATGCCCCCTCACA COI-5R: TGTTGGGGAAAGTCTTCTATGGA | ||
| cytb–cox1 | Shotgun | Cytb-1F: TTCATCTCCTATTCCTTCACCAAA COI-1R: GTGATTGCTACGGCTCAAACGAA | YP01190217-1F: TGGTCGGGGTTGCTTTCT YP01190203-1R: ATAATTTCCCGATTTAAAGAGAG YP01190233-1R: TTCGTAAGCTACACCTTGACC YP01190202-1F: GGCACTTCTGCTCTTCCCG YP01190227-1F: AAAGTCTTCGATCTGTCAGTTGT YP01190213-2R: CGTAAGAAAAACAATGTTAATATA YP01190213-3R: ATATATTATATCTATATGGATATTATGTTT NJCJ-control-1F: TATGGTTCTATATGCAATTTCCTCCC YP01190213-1R: TAGAGAGAAGAGGGGTAAAAC |
References
- Cameron, S.L. Insect mitochondrial genomics: Implications for evolution and phylogeny. Annu. Rev. Entomol. 2014, 59, 95–117. [Google Scholar] [CrossRef] [PubMed]
- Simon, C.; Frati, F.; Beckenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef]
- Simon, C.; Buckley, T.R.; Frati, F.; Stewart, J.B.; Beckenbach, A.T. Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 2006, 37, 545–579. [Google Scholar] [CrossRef]
- Da Silva, N.M.; de Souza Dias, A.; da Silva Valente, V.L.; Valiati, V.H. Characterization of mitochondrial control region, two intergenic spacers and tRNAs of Zaprionus indianus (Diptera: Drosophilidae). Genetica 2009, 137, 325–332. [Google Scholar] [CrossRef] [PubMed]
- Wolstenholme, D.R. Animal mitochondrial DNA: Structure and evolution. Int. Rev. Cytol. 1992, 141, 173–216. [Google Scholar] [PubMed]
- Zhang, D.X.; Szymura, J.M.; Hewitt, G.M. Evolution and structure conservation of the control region of insect mitochondrial DNA. J. Mol. Evol. 1995, 40, 382–391. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.X.; Hewitt, G.M. Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochem. Syst. Ecol. 1997, 25, 99–120. [Google Scholar] [CrossRef]
- Beckenbach, A.T.; Stewart, J.B. Insect mitochondrial genomics 3: The complete mitochondrial genome sequences of representatives from two neuropteroid orders: A dobsonfly (order Megaloptera) and a giant lacewing and an owlfly (order Neuroptera). Genome 2009, 52, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Saito, S.; Tamura, K.; Aotsuka, T. Replication origin of mitochondrial DNA in insects. Genetics 2005, 171, 1695–1705. [Google Scholar] [CrossRef] [PubMed]
- Karr, J.R. Defining and measuring river health. Freshw. Biol. 1999, 41, 221–234. [Google Scholar] [CrossRef]
- Chen, Z.T.; Du, Y.Z. Comparison of the complete mitochondrial genome of the stonefly Sweltsa longistyla (Plecoptera: Chloroperlidae) with mitogenomes of three other stoneflies. Gene 2015, 558, 82–87. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.T.; Du, Y.Z. Complete mitochondrial genome of Capnia zijinshana (Plecoptera: Capniidae) and phylogenetic analysis among stoneflies. J. Asia Pac. Entomol. 2017, 20, 305–312. [Google Scholar] [CrossRef]
- Chen, Z.T.; Wu, H.Y.; Du, Y.Z. The nearly complete mitochondrial genome of a stonefly species, Styloperla sp. (Plecoptera: Styloperlidae). Mitochondrial DNA Part A 2016, 27, 2728–2729. [Google Scholar]
- Elbrecht, V.; Poettker, L.; John, U.; Leese, F. The complete mitochondrial genome of the stonefly Dinocras cephalotes (Plecoptera, Perlidae). Mitochondrial DNA 2015, 26, 469–470. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Wang, Y.; Liu, X.; Li, W.; Kang, Z.; Wang, K.; Li, X.; Yang, D. The complete mitochondrial genome and its remarkable secondary structure for a stonefly Acroneuria hainana Wu (Insecta: Plecoptera, Perlidae). Gene 2015, 557, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Stewart, J.B.; Beckenbach, A.T. Insect mitochondrial genomics 2: The complete mitochondrial genome sequence of a giant stonefly, Pteronarcys princeps, asymmetric directional mutation bias, and conserved plecopteran A+T-region elements. Genome 2006, 49, 815–824. [Google Scholar] [CrossRef] [PubMed]
- Qian, Y.H.; Wu, H.Y.; Ji, X.Y.; Yu, W.W.; Du, Y.Z. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae) and phylogenetic position of Plecoptera based on mitogenomes. PLoS ONE 2014, 9, e86328. [Google Scholar]
- Sproul, J.S.; Houston, D.D.; Nelson, C.R.; Evans, R.P.; Crandall, K.A.; Shiozawa, D.K. Climate oscillations, glacial refugia, and dispersal ability: Factors influencing the genetic structure of the least salmonfly, Pteronarcella badia (Plecoptera), in western North America. BMC Evol. Biol. 2015, 15, 279. [Google Scholar] [CrossRef] [PubMed]
- Vasco, E.; Florian, L. The mitochondrial genome of the Arizona Snowfly Mesocapnia arizonensis (Plecoptera, Capniidae). Mitochondrial DNA Part A 2016, 27, 3365–3366. [Google Scholar]
- Wu, H.Y.; Ji, X.Y.; Yu, W.W.; Du, Y.Z. Complete mitochondrial genome of the stonefly Cryptoperla stilifera Sivec (Plecoptera: Peltoperlidae) and the phylogeny of Polyneopteran insects. Gene 2014, 537, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Ding, S.; Yang, D. The complete mitochondrial genome of a stonefly species, Kamimuria chungnanshana Wu, 1948 (Plecoptera: Perlidae). Mitochondrial DNA Part A 2016, 27, 3810–3811. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Wang, Y.; Yang, D. The complete mitochondrial genome of a stonefly species, Togoperla sp. (Plecoptera: Perlidae). Mitochondrial DNA Part A 2016, 27, 1703–1704. [Google Scholar]
- Wang, Y.; Cao, J.; Li, W. The complete mitochondrial genome of the styloperlid stonefly species Styloperla spinicercia Wu (Insecta: Plecoptera) with family-level phylogenetic analyses of the Pteronarcyoidea. Zootaxa 2017, 4243, 125–138. [Google Scholar] [CrossRef]
- Zhou, C.; Tan, M.; Du, S.; Zhang, R.; Machida, R.; Zhou, X. The mitochondrial genome of the winter stonefly Apteroperla tikumana (Plecoptera, Capniidae). Mitochondrial DNA Part A 2016, 27, 3030–3032. [Google Scholar]
- Clary, D.O.; Wolstenholme, D.R. The ribosomal RNA genes of Drosophila mitochondrial DNA. Nucleic Acids Res. 1985, 13, 4029–4045. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.J.; Shi, M.; Chen, X.X.; Sharkey, M.J.; van Achterberg, C.; Ye, G.Y.; He, J.H. New views on strand asymmetry in insect mitochondrial genomes. PLoS ONE 2010, 5, e12708. [Google Scholar] [CrossRef] [PubMed]
- Ojala, D.; Montoya, J.; Attardi, G. tRNA punctuation model of RNA processing in human mitochondria. Nature 1981, 290, 470–474. [Google Scholar] [CrossRef] [PubMed]
- Garey, J.R.; Wolstenholme, D.R. Platyhelminth mitochondrial DNA: Evidence for early evolutionary origin of a tRNAserAGN that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons. J. Mol. Evol. 1989, 28, 374–387. [Google Scholar] [CrossRef] [PubMed]
- Abascal, F.; Posada, D.; Knight, R.D.; Zardoya, R. Parallel evolution of the genetic code in arthropod mitochondrial genomes. PLoS Biol. 2006, 4, 711–718. [Google Scholar] [CrossRef] [PubMed]
- Abascal, F.; Posada, D.; Zardoya, R. The evolution of the mitochondrial genetic code in arthropods revisited. Mitochondrial DNA 2012, 23, 84–91. [Google Scholar] [CrossRef] [PubMed]
- Crozier, R.H.; Crozier, Y.C. The mitochondrial genome of the honeybee Apis mellifera: Complete sequence and genome organization. Genetics 1993, 133, 97–117. [Google Scholar] [PubMed]
- Korkmaz, E.M.; Budak, M.; Ördek, M.N.; Başıbüyük, H.H. The complete mitogenomes of Calameuta filiformis (Eversmann, 1847) and Calameuta idolon (Rossi, 1794) (Hymenoptera: Cephidae): The remarkable features of the elongated A+T rich region in Cephini. Gene 2016, 576, 404–411. [Google Scholar] [CrossRef] [PubMed]
- Grant, J.R.; Stothard, P. The CGView Server: A comparative genomics tool for circular genomes. Nucleic Acids Res. 2008, 36, 181–184. [Google Scholar] [CrossRef] [PubMed]
- Bernt, M.; Donath, A.; Jühling, F.; Externbrinka, F.; Florentz, C.; Fritzsch, G.; Pützh, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef] [PubMed]
- Laslett, D.; Canbäck, B. ARWEN, a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 2008, 24, 172–175. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Perna, N.T.; Kocher, T.D. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 1995, 41, 353–358. [Google Scholar] [CrossRef] [PubMed]
- Markham, N.R.; Zuker, M. DINAMelt web server for nucleic acid melting prediction. Nucleic Acids Res. 2005, 33, W577–W581. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. ClustalW and ClustalX version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Huelsenbeck, J.P.; Ronquist, F. Mrbayes: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [PubMed]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
- Rambaut, A.; Drummond, A.J. Tracer Version 1.5 2009. Available online: http://tree.bio.ed.ac.uk/software/tracer (accessed on 15 April 2017).
- Rambaut, A.; Drummond, A.J. FigTree Version 1.4.0 2012. Available online: http://tree.bio.ed.ac.uk/software/figtree (accessed on 15 April 2017).







| Gene | Position (bp) | Size (bp) | Direction | Intergenic Nucleotides (IGN) | Anti- or Start/Stop Codons | AT% |
|---|---|---|---|---|---|---|
| trnIle (I) | 1–66 | 66 | Forward | 0 | GAT | 66.7 |
| trnGln (Q) | 64–132 | 69 | Reverse | −3 | TTG | 78.3 |
| trnMet (M) | 146–214 | 69 | Forward | 13 | CAT | 62.3 |
| nad2 | 215–1249 | 1035 | Forward | 0 | ATG/TAA | 70.8 |
| trnTrp (W) | 1259–1327 | 69 | Forward | 9 | TCA | 69.6 |
| trnCys (C) | 1320–1382 | 63 | Reverse | −8 | GCA | 68.3 |
| trnTyr (Y) | 1388–1453 | 66 | Reverse | 5 | GTA | 60.6 |
| cox1 | 1450–2983 | 1534 | Forward | −2 | CCG/T- | 64.1 |
| trnLeu2 (UUR) | 2986–3052 | 67 | Forward | 0 | TAA | 68.7 |
| cox2 | 3056–3743 | 688 | Forward | 3 | ATG/T- | 67.2 |
| trnLys (K) | 3745–3815 | 71 | Forward | 1 | CTT | 64.8 |
| trnAsp (D) | 3817–3885 | 69 | Forward | 1 | GTC | 73.9 |
| atp8 | 3886–4044 | 159 | Forward | 0 | ATT/TAA | 76.7 |
| atp6 | 4038–4715 | 678 | Forward | −7 | ATG/TAA | 67.7 |
| cox3 | 4715–5503 | 789 | Forward | −1 | ATG/TAA | 64.9 |
| trnGly (G) | 5504–5569 | 66 | Forward | 0 | TCC | 72.7 |
| nad3 | 5570–5923 | 354 | Forward | 0 | ATT/TAG | 72.0 |
| trnAla (A) | 5922–5985 | 64 | Forward | −2 | TGC | 70.3 |
| trnArg (R) | 5986–6049 | 64 | Forward | 0 | TCG | 64.1 |
| trnAsn (N) | 6052–6117 | 66 | Forward | 2 | GTT | 72.7 |
| trnSer1 (AGN) | 6118–6184 | 67 | Forward | 0 | GCT | 67.2 |
| trnGlu (E) | 6185–6250 | 66 | Forward | 0 | TTC | 90.9 |
| trnPhe (F) | 6249–6315 | 67 | Reverse | −2 | GAA | 67.2 |
| nad5 | 6316–8050 | 1735 | Reverse | 0 | ATG/T- | 70.7 |
| trnHis (H) | 8051–8117 | 67 | Reverse | 0 | GTG | 79.1 |
| nad4 | 8119–9459 | 1341 | Reverse | 1 | ATG/TAA | 71.5 |
| nad4l | 9453–9749 | 297 | Reverse | −7 | ATG/TAA | 74.7 |
| trnThr (T) | 9752–9817 | 66 | Forward | 2 | TGT | 80.3 |
| trnPro (P) | 9817–9882 | 66 | Reverse | −1 | TGG | 71.2 |
| nad6 | 9884–10408 | 525 | Forward | 1 | ATT/TAA | 73.3 |
| Cytb | 10408–11544 | 1137 | Forward | −1 | ATG/TAG | 66.8 |
| trnSer2 (UCN) | 11543–11612 | 70 | Forward | −2 | TGA | 74.3 |
| nad1 | 11644–12594 | 951 | Reverse | 31 | TTG/TAA | 69.4 |
| trnLeu1 (CUN) | 12596–12661 | 66 | Reverse | 1 | TAG | 75.8 |
| rrnL | 12664–13990 | 1327 | Reverse | 2 | 74.9 | |
| trnVal (V) | 13991–14061 | 71 | Reverse | 0 | TAC | 69.0 |
| rrnS | 14062–14851 | 790 | Reverse | 0 | 71.3 | |
| Control region | 14852–16602 | 1751 | 0 | 81.8 |
| Regions | Nucleotides Proportions (%) | AT Skew | GC Skew | |||||
|---|---|---|---|---|---|---|---|---|
| A | T | G | C | A+T | G+C | |||
| Whole genome | 37.2 | 34.0 | 11.8 | 17.0 | 71.2 | 28.8 | 0.04 | −0.18 |
| Protein coding genes | 35.7 | 33.3 | 12.9 | 18.1 | 69.0 | 31.0 | 0.03 | −0.17 |
| 1st codon position | 40.5 | 29.3 | 14.4 | 15.8 | 69.8 | 30.2 | 0.16 | −0.05 |
| 2nd codon position | 31.5 | 32.2 | 15.3 | 21.0 | 63.7 | 36.3 | −0.01 | −0.16 |
| 3rd codon position | 35.1 | 38.3 | 9.1 | 17.5 | 73.4 | 26.6 | −0.04 | −0.32 |
| Protein coding genes-J | 29.7 | 38.0 | 14.1 | 18.2 | 67.7 | 32.3 | −0.12 | −0.13 |
| 1st codon position | 30.5 | 35.0 | 17.6 | 16.9 | 65.5 | 34.5 | −0.07 | 0.02 |
| 2nd codon position | 26.4 | 40.5 | 12.5 | 20.6 | 66.9 | 33.1 | −0.21 | −0.24 |
| 3rd codon position | 32.2 | 38.5 | 12.2 | 17.1 | 70.7 | 29.3 | −0.09 | −0.17 |
| Protein coding genes-N | 45.3 | 25.6 | 11.1 | 18.0 | 70.9 | 29.1 | 0.28 | −0.24 |
| 1st codon position | 46.9 | 26.2 | 9.7 | 17.2 | 73.1 | 26.9 | 0.28 | −0.28 |
| 2nd codon position | 45.7 | 25.5 | 11.0 | 17.8 | 71.2 | 28.8 | 0.28 | −0.24 |
| 3rd codon position | 43.2 | 25.2 | 12.6 | 19.0 | 68.4 | 31.6 | 0.26 | −0.20 |
| tRNA genes | 36.8 | 34.6 | 12.8 | 15.8 | 71.4 | 28.6 | 0.03 | −0.10 |
| tRNA genes-J | 36.4 | 34.9 | 14.7 | 14.0 | 71.3 | 28.7 | 0.02 | 0.02 |
| tRNA genes-N | 37.7 | 33.8 | 9.1 | 19.4 | 71.5 | 28.5 | 0.05 | −0.36 |
| rRNA genes | 40.3 | 33.2 | 9.6 | 16.9 | 73.5 | 26.5 | 0.10 | −0.28 |
| Control region | 43.2 | 38.7 | 6.4 | 11.7 | 81.9 | 18.1 | 0.05 | −0.29 |
| Species | Mitogenome Size (bp) | Control Region Size (bp) | A+T Content of Control Region (%) | Accession Number |
|---|---|---|---|---|
| N. nankinensis | 16,602 | 1751 | 81.8 | KY940360 |
| C. zijinshana | 16,310 | 1513 | 62.0 | KX094942 |
| M. arizonensis | 14,921 | N/A | N/A | KP642637 |
| A. tikumana | 15,564 | N/A | N/A | KR604721 |
| Styloperla sp. | 15,416 | N/A | N/A | KR088971 |
| S. spinicercia | 16,129 | 1259 | 77.3 | KX845569 |
| Cryptoperla sp. | 15,633 | 777 | 80.2 | KC952026 |
| S. longistyla | 16,151 | 1107 | 80.1 | KM216826 |
| P. princeps | 16,004 | 1158 | 81.3 | AY687866 |
| P. badia | 15,586 | 687 | 68.9 | KU182360 |
| D. cephalotes | 15,666 | 711 | 74.5 | KF484757 |
| A. hainana | 15,804 | 899 | 73.3 | KM199685 |
| Togoperla sp. | 15,723 | 780 | 78.0 | KM409708 |
| K. wangi | 16,179 | 1251 | 78.2 | KC894944 |
| K. chungnanshana | 15,943 | 1062 | 79.1 | KT186102 |
| Peltoperla arcuata | N/A | 1072 | N/A | AY142073 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.-T.; Du, Y.-Z. First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications. Int. J. Mol. Sci. 2017, 18, 996. https://doi.org/10.3390/ijms18050996
Chen Z-T, Du Y-Z. First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications. International Journal of Molecular Sciences. 2017; 18(5):996. https://doi.org/10.3390/ijms18050996
Chicago/Turabian StyleChen, Zhi-Teng, and Yu-Zhou Du. 2017. "First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications" International Journal of Molecular Sciences 18, no. 5: 996. https://doi.org/10.3390/ijms18050996
APA StyleChen, Z.-T., & Du, Y.-Z. (2017). First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications. International Journal of Molecular Sciences, 18(5), 996. https://doi.org/10.3390/ijms18050996
