Influence of MTHFR Genetic Background on p16 and MGMT Methylation in Oral Squamous Cell Cancer
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Subjects
4.2. MTHFR Genotyping
4.3. DNA Methylation Detection
4.4. Statistical Analyses
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Gatta, G.; Botta, L.; Sanchez, M.J.; Anderson, L.A.; Pierannunzio, D.; Licitra, L. EUROCARE Working Group. Prognoses and improvement for head and neck cancers diagnosed in Europe in early 2000s: The EUROCARE-5 population-based study. Eur. J. Cancer 2015. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Jessri, M.; Rashidkhani, B.; Hajizadeh, B.; Jessri, M.; Gotay, C. Macronutrients, vitamins and minerals intake and risk of esophageal squamous cell carcinoma: A case-control study in Iran. Nutr. J. 2011, 10, 137. [Google Scholar] [CrossRef] [PubMed]
- Vigneswaran, N.; Williams, M.D. Epidemiologic trends in head and neck cancer and aids in diagnosis. Oral Maxillofac. Surg. Clin. N. Am. 2014, 26, 123–141. [Google Scholar] [CrossRef] [PubMed]
- Pannone, G.; Santoro, A.; Papagerakis, S.; lo Muzio, L.; de Rosa, G.; Bufo, P. The role of human papillomavirus in the pathogenesis of head & neck squamous cell carcinoma: An overview. Infect. Agent Cancer 2011, 6, 4. [Google Scholar] [PubMed]
- Jefferies, S.; Eeles, R.; Goldgar, D.; A’Hern, R.; Henk, J.M.; Gore, M. The role of genetic factors in predisposition to squamous cell cancer of the head and neck. Br. J. Cancer 1999, 79, 865–867. [Google Scholar] [CrossRef] [PubMed]
- Báez, A. Genetic and environmental factors in head and neck cancer genesis. J. Environ. Sci. Health C Environ. Carcinog. Ecotoxicol. Rev. 2008, 26, 174–200. [Google Scholar] [CrossRef] [PubMed]
- Gallus, S.; La Vecchia, C. Is there a link between diet and esophageal cancer? Nat. Clin. Pract. Gastroenterol. Hepatol. 2007, 4, 2–3. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.M.; Xu, B.; Rao, J.Y.; Shen, H.B.; Xue, H.C.; Jiang, Q.W. Diet habits, alcohol drinking, tobacco smoking, green tea drinking, and the risk of esophageal squamous cell carcinoma in the Chinese population. Eur. J. Gastroenterol. Hepatol. 2007, 19, 171–176. [Google Scholar] [CrossRef] [PubMed]
- Larsson, S.C.; Giovannucci, E.; Wolk, A. Folate intake, MTHFR polymorphisms, and risk of esophageal, gastric, and pancreatic cancer: A meta-analysis. Gastroenterology 2006, 131, 1271–1283. [Google Scholar] [CrossRef] [PubMed]
- Moore, L.D.; Le, T.; Fan, G. DNA methylation and its basic function. Neuropsychopharmacology 2013, 38, 23–38. [Google Scholar] [CrossRef] [PubMed]
- Momparler, R.L.; Bovenzi, V. DNA methylation and cancer. J. Cell. Physiol. 2000, 183, 145–154. [Google Scholar] [CrossRef]
- Sato, F.; Meltzer, S.J. CpG island hypermethylation in progression of esophageal and gastric cancer. Cancer 2006, 106, 483–493. [Google Scholar] [CrossRef] [PubMed]
- Schwann, B.; Rozen, R. Polymorphisms in the methylenetetrahydrofolatereductase gene: Clinical consequences. Am. J. Pharmacogenom. 2001, 1, 189–201. [Google Scholar] [CrossRef]
- Zhang, J.; Zotz, R.B.; Li, Y.; Wang, R.; Kiel, S.; Schulz, W.A.; Wen, D.; Chen, Z.; Zhang, L.; Wang, S.; et al. Methylenetetrahydrofolatereductase C677T polymorphism and predisposition towards esophageal squamous cell carcinoma in a German Caucasian and a northern Chinese population. J. Cancer Res. Clin. Oncol. 2004, 130, 574–580. [Google Scholar] [CrossRef] [PubMed]
- Frosst, P.; Blom, H.J.; Milos, R.; Goyette, P.; Sheppard, C.A.; Matthews, R.G.; Boers, G.J.; den Heijer, M.; Kluijtmans, L.A.; van den Heuvel, L.P.; et al. A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahydrofolatereductase. Nat. Genet. 1995, 10, 111–113. [Google Scholar] [CrossRef] [PubMed]
- Weisberg, I.; Tran, P.; Christensen, B.; Sibani, S.; Rozen, R. A second genetic polymorphism in methylenetetrahydrofolatereductase (MTHFR) associated with decreased enzyme activity. Mol. Genet. Metab. 1998, 64, 169–172. [Google Scholar] [CrossRef] [PubMed]
- Yamada, K.; Chen, Z.; Rozen, R.; Matthews, R.G. Effects of common polymorphisms on the properties of recombinant human methylenetetrahydrofolatereductase. Proc. Natl. Acad. Sci. USA 2001, 98, 14853–14858. [Google Scholar] [CrossRef] [PubMed]
- Weisberg, I.S.; Jacques, P.F.; Selhub, J.; Bostom, A.G.; Chen, Z.; Curtis Ellison, R.; Eckfeldt, J.H.; Rozen, R. The A1298C polymorphism in methylenetetrahydrofolatereductase (MTHFR): In vitro expression and association with homocysteine. Atherosclerosis 2001, 156, 409–415. [Google Scholar] [CrossRef]
- Saeedi, S.; Owji, A.; Ansari, M.; Ghafarpour, M.; Ebrahimi, A.; Fallah, M.S. MTHFR Gene polymorphisms and susceptibility to Migraine Attacks. Arch. Med. Lab. Sci. 2015, 1, 61–66. [Google Scholar]
- Wang, J.; Sasco, A.J.; Fu, C.; Xue, H.; Guo, G.; Hua, Z.; Zhou, Q.; Jiang, Q.; Xu, B. Aberrant DNA methylation of p16, MGMT, and hMLH1 genes in combination with MTHFR C677T genetic polymorphism in esophageal squamous cell carcinoma. Cancer Epidemiol. Biomark. Prev. 2008, 17, 118–125. [Google Scholar] [CrossRef] [PubMed]
- Stern, L.L.; Mason, J.B.; Selhub, J.; Choi, S.W. Genomic DNA hypomethylation, a characteristic of most cancers, is present in peripheral leukocytes of individuals who are homozygous for the C677T polymorphism in the methylenetetrahydrofolate reductase gene. Cancer Epidemiol. Biomark. Prev. 2000, 9, 849–853. [Google Scholar]
- Friso, S.; Choi, S.W.; Girelli, D.; Mason, J.B.; Dolnikowski, G.G.; Bagley, P.J.; Olivieri, O.; Jacques, P.F.; Rosenberg, I.H.; Corrocher, R.; et al. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status. Proc. Natl. Acad. Sci. USA 2002, 99, 5606–5611. [Google Scholar] [CrossRef] [PubMed]
- De Arruda, I.T.; Persuhn, D.C.; de Oliveira, N.F. The MTHFR C677T polymorphism and global DNA methylation in oral epithelial cells. Genet. Mol. Biol. 2013, 36, 490–493. [Google Scholar] [CrossRef] [PubMed]
- Xing, X.B.; Cai, W.B.; Luo, L.; Liu, L.S.; Shi, H.J.; Chen, M.H. The Prognostic Value of p16 Hypermethylation in Cancer: A Meta-Analysis. PLoS ONE 2013, 8, e66587. [Google Scholar] [CrossRef] [PubMed]
- Clarizia, A.D.; Bastos-Rodrigues, L.; Pena, H.B.; Anacleto, C.; Rossi, B.; Soares, F.A.; Lopes, A.; Rocha, J.C.; Caballero, O.; Camargo, A.; et al. Relationship of the methylenetetrahydrofolatereductase C677T polymorphism with microsatellite instability and promoter hypermethylation in sporadic colorectal cancer. Genet. Mol. Res. 2006, 5, 315–322. [Google Scholar] [PubMed]
- Laing, M.E.; Cummins, R.; O’Grady, A.; O’Kelly, P.; Kay, E.W.; Murphy, G.M. Aberrant DNA methylation associated with MTHFR C677T genetic polymorphism in cutaneous squamous cell carcinoma in renal transplant patients. Br. J. Dermatol. 2010, 163, 345–352. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Xie, H.; Wang, F.; Shen, H.; Wang, J. Diet folate, DNA methylation and genetic polymorphisms of MTHFR C677T in association with the prognosis of esophageal squamous cell carcinoma. BMC Cancer 2011, 11, 91. [Google Scholar] [CrossRef] [PubMed]
- Sutherland, J.E.; Costa, M. Epigenetics and the environment. Ann. N. Y. Acad. Sci. 2003, 983, 151–160. [Google Scholar] [CrossRef] [PubMed]
- Rodenhiser, D.; Mann, M. Epigenetics and human disease: Translating basic biology into clinical applications. CMAJ 2006, 174, 341–348. [Google Scholar] [CrossRef] [PubMed]
- Slattery, M.L.; Curtin, K.; Sweeney, C.; Levin, T.R.; Potter, J.; Wolff, R.K.; Albertsen, H.; Samowitz, W.S. Diet and lifestyle factor associations with CpG island methylator phenotype and BRAF mutations in colon cancer. Int. J. Cancer 2007, 120, 656–663. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Chen, J. One-carbon metabolism and breast cancer: An epidemiological perspective. J. Genet. Genom. 2009, 36, 203–214. [Google Scholar] [CrossRef]
- Luo, W.P.; Li, B.; Lin, F.Y.; Yan, B.; Du, Y.F.; Mo, X.F.; Wang, L.; Zhang, C.X. Joint effects of folate intake and one-carbon-metabolizing genetic polymorphisms on breast cancer risk: A case-control study in China. Sci. Rep. 2016, 6, 29555. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Yadav, U.; Rai, V. Methylenetetrahydrofolatereductase gene C677T polymorphism and breast cancer risk: Evidence for genetic susceptibility. Meta Gene 2015, 6, 72–84. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.J.; Xu, L.H.; Chen, Y.M.; Luo, L.; Tu, Q.F.; Mei, J. Methylenetetrahydrofolatereductase gene polymorphism in endometrial cancer: A systematic review and meta-analysis. Taiwan J. Obstet. Gynecol. 2015, 54, 546–550. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.M.; Deng, M.H.; Chen, W.; Zeng, X.T.; Luo, J. MTHFR C677T gene polymorphism and head and neck cancer risk: A meta-analysis based on 23 publications. Dis. Mark. 2015, 2015, 681313. [Google Scholar] [CrossRef] [PubMed]
- Vairaktaris, E.; Yapijakis, C.; Kessler, P.; Vylliotis, A.; Ries, J.; Wiltfang, J.; Vassiliou, S.; Derka, S.; Neukam, F.W. Methylenetetrahydrofolatereductase polymorphism and minor increase of risk for oral cancer. J. Cancer Res. Clin. Oncol. 2006, 132, 219–222. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, S.J.; Gridley, G.; Harty, L.C.; Diehl, S.R.; Brown, L.M.; Winn, D.M.; Bravo-Otero, E.; Hayes, R.B. Folate intake, serum homocysteine and methylenetetrahydrofolatereductase (MTHFR) C677T genotype are not associated with oral cancer risk in Puerto Rico. J. Nutr. 2002, 132, 762–767. [Google Scholar] [PubMed]
- Neumann, A.S.; Lyons, H.J.; Shen, H.; Liu, Z.; Shi, Q.; Sturgis, E.M.; Shete, S.; Spitz, M.R.; El-Naggar, A.; Hong, W.K.; et al. Methylenetetrahydrofolatereductase polymorphisms and risk of squamous cell carcinoma of the head and neck: A case-control analysis. Int. J. Cancer 2005, 115, 131–136. [Google Scholar] [CrossRef] [PubMed]
- Curtin, K.; Bigler, J.; Slattery, M.L.; Caan, B.; Potter, J.D.; Ulrich, C.M. MTHFR C677T and A1298C Polymorphisms: Diet, Estrogen, and Risk of Colon Cancer. Cancer Epidemiol. Biomark. Prev. 2004, 13, 285–292. [Google Scholar] [CrossRef]
- Smith, I.M.; Mydlarz, W.K.; Mithani, S.K.; Califano, J.A. DNA global hypomethylation in squamous cell head and neck cancer associated with smoking, alcohol consumption and stage. Int. J. Cancer 2007, 121, 1724–1728. [Google Scholar] [CrossRef] [PubMed]
- Furniss, C.S.; Marsit, C.J.; Houseman, E.A.; Eddy, K.; Kelsey, K.T. Line region hypomethylation is associated with lifestyle and differs by human papillomavirus status in head and neck squamous cell carcinomas. Cancer Epidemiol. Biomark. Prev. 2008, 17, 966–971. [Google Scholar] [CrossRef] [PubMed]
- Richards, K.L.; Zhang, B.; Baggerly, K.A.; Colella, S.; Lang, J.C.; Schuller, D.E.; Krahe, R. Genome-wide hypomethylation in head and neck cancer is more pronounced in HPV-negative tumors and is associated with genomic instability. PLoS ONE 2009, 4, e4941. [Google Scholar] [CrossRef] [PubMed]
- Hsiung, D.T.; Marsit, C.J.; Houseman, E.A.; Eddy, K.; Furniss, C.S.; McClean, M.D.; Kelsey, K.T. Global DNA methylation level in whole blood as a biomarker in head and neck squamous cell carcinoma. Cancer Epidemiol. Biomark. Prev. 2007, 16, 108–114. [Google Scholar] [CrossRef] [PubMed]
- Subbalekha, K.; Pimkhaokham, A.; Pavasant, P.; Chindavijak, S.; Phokaew, C.; Shuangshoti, S.; Matangkasombut, O.; Mutirangura, A. Detection of LINE-1s hypomethylation in oral rinses of oral squamous cell carcinoma patients. Oral Oncol. 2009, 45, 184–191. [Google Scholar] [CrossRef] [PubMed]
- Baba, Y.; Watanabe, M.; Baba, H. Review of the alterations in DNA methylation in esophageal squamous cell carcinoma. Surg. Today 2013, 43, 1355–1364. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Yan, W. Epigenetics of gastric cancer. Methods Mol. Biol. 2015, 1238, 783–799. [Google Scholar] [PubMed]
- Yan, W.; Guo, M. Epigenetics of colorectal cancer. Methods Mol. Biol. 2015, 1238, 405–424. [Google Scholar] [PubMed]
- Ma, K.; Cao, B.; Guo, M. The detective, prognostic, and predictive value of DNA methylation in human esophageal squamous cell carcinoma. Clin. Epigenet. 2016, 8, 43. [Google Scholar] [CrossRef] [PubMed]
- Christmann, M.; Tomicic, M.T.; Roos, W.P.; Kaina, B. Mechanisms of human DNA repair: An update. Toxicology 2003, 193, 3–34. [Google Scholar] [CrossRef]
- Baumann, S.; Keller, G.; Pühringer, F.; Napieralski, R.; Feith, M.; Langer, R.; Höfler, H.; Stein, H.J.; Sarbia, M. The prognostic impact of O6-methylguanine-DNA methyltransferase (MGMT) promotorhypermethylation in esophageal adenocarcinoma. Int. J. Cancer 2006, 119, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Xiong, H.L.; Liu, X.Q.; Sun, A.H.; He, Y.; Li, J.; Xia, Y. Aberrant DNA methylation of p16, MGMT, hMLH1 and hMSH2 genes in combination with the MTHFR C677T genetic polymorphism in gastric cancer. Asian Pac. J. Cancer Prev. 2013, 14, 3139–3142. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Huang, Z.J.; Duan, Y.Q.; Xiao, X.R.; Jiang, J.Q.; Zhang, R. Aberrant DNA methylation of P16, MGMT, and hMLH1 genes in combination with MTHFR C677T genetic polymorphism and folate intake in esophageal squamous cell carcinoma. Asian Pac. J. Cancer Prev. 2012, 13, 5303–5306. [Google Scholar] [CrossRef] [PubMed]
- Supic, G.; Jovic, N.; Kozomara, R.; Zeljic, K.; Magic, Z. Interaction between the MTHFR C677T polymorphism and alcohol—Impact on oral cancer risk and multiple DNA methylation of tumor-related genes. J. Dent. Res. 2011, 90, 65–70. [Google Scholar] [CrossRef] [PubMed]
- Bremnes, R.M.; Sirera, R.; Camps, C. Circulating tumour-derived DNA and RNA markers in blood: A tool for early detection, diagnostics, and follow-up? Lung Cancer 2005, 49, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Mikeska, T.; Craig, J.M. DNA methylation biomarkers: Cancer and beyond. Genes 2014, 5, 821–864. [Google Scholar] [CrossRef] [PubMed]
- Sotgia, S.; Carru, C.; Franconi, F.; Fiori, P.B.; Manca, S.; Pettinato, S.; Magliona, S.; Ginanneschi, R.; Deiana, L.; Zinellu, A. Rapid quantification of total genomic DNA methylation degree by short-end injection capillary zone electrophoresis. J. Chromatogr. A 2008, 1185, 145–150. [Google Scholar] [CrossRef] [PubMed]
Genotype | Cases (n = 58) (%) | Controls (n = 90) (%) | p |
---|---|---|---|
CC/AA | - | 21 (23.3) | <0.0001 |
CC/AC | - | 8 (8.8) | 0.019 |
CC/CC | 6 (10.3) | 8 (8.8) | 0.76 |
CT/AA | 14 (24) | 21 (23.3) | 0.9 |
CT/AC | 20 (34.5) | 17 (18.8) | 0.032 |
TT/AA | 18 (31) | 15 (16.6) | 0.04 |
Gene | Cases (n = 58) (%) | Controls (n = 90) (%) | p | Odds Ratio (95% CI) |
---|---|---|---|---|
p16 | 10 (17.2) | 5 (5.6) | 0.027 | 3.54 (1.143–10.97) |
MGMT | 16 (27.6) | 7 (7.8) | 0.002 | 4.52 (1.72–11.83) |
p16 + MGMT | 12 (20.7) | - | <0.0001 | 48.66 (2.82–840.7) |
MTHFR Genotype | |||
---|---|---|---|
Normal | Risk | p | |
p16 methylated | 0 (0%) | 22 (57.9%) | <0.0001 |
MGMT methylated | 6 (30%) | 22 (57.9%) | 0.056 |
Primer | Forward 5′ > 3′ | Reverse 5′ > 3′ | Tm (°C) |
---|---|---|---|
p16-UM | TTATTAGAGGGTGGGGTGGATTGT | CAACCCCAAACCACAACCATAA | 58 |
p16-M | TTATTAGAGGGTGGGGCGGATCGC | GACCCCGAACCGCGACCGTAA | 55 |
MGMT-UM | TTTGTGTTTTGATGTTTGTAGGTTTTTGT | AACTCCACACTCTTCCAAAAACAAAACA | 60 |
MGMT-M | TTTCGACGTTCGTAGGTTTTCGC | GCACTCTTCCGAAAACGAAACG | 60 |
© 2017 by the authors. Submitted for possible open access publication under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ferlazzo, N.; Currò, M.; Zinellu, A.; Caccamo, D.; Isola, G.; Ventura, V.; Carru, C.; Matarese, G.; Ientile, R. Influence of MTHFR Genetic Background on p16 and MGMT Methylation in Oral Squamous Cell Cancer. Int. J. Mol. Sci. 2017, 18, 724. https://doi.org/10.3390/ijms18040724
Ferlazzo N, Currò M, Zinellu A, Caccamo D, Isola G, Ventura V, Carru C, Matarese G, Ientile R. Influence of MTHFR Genetic Background on p16 and MGMT Methylation in Oral Squamous Cell Cancer. International Journal of Molecular Sciences. 2017; 18(4):724. https://doi.org/10.3390/ijms18040724
Chicago/Turabian StyleFerlazzo, Nadia, Monica Currò, Angelo Zinellu, Daniela Caccamo, Gaetano Isola, Valeria Ventura, Ciriaco Carru, Giovanni Matarese, and Riccardo Ientile. 2017. "Influence of MTHFR Genetic Background on p16 and MGMT Methylation in Oral Squamous Cell Cancer" International Journal of Molecular Sciences 18, no. 4: 724. https://doi.org/10.3390/ijms18040724
APA StyleFerlazzo, N., Currò, M., Zinellu, A., Caccamo, D., Isola, G., Ventura, V., Carru, C., Matarese, G., & Ientile, R. (2017). Influence of MTHFR Genetic Background on p16 and MGMT Methylation in Oral Squamous Cell Cancer. International Journal of Molecular Sciences, 18(4), 724. https://doi.org/10.3390/ijms18040724