Expression Profiling of Autophagy Genes BxATG1 and BxATG8 under Biotic and Abiotic Stresses in Pine Wood Nematode Bursaphelenchus xylophilus
Abstract
:1. Introduction
2. Results
2.1. Effect of Rapamycin on B. xylophilus Feeding Rate and Reproduction on Fungal Mats
2.2. Expression Level of Autophagy Genes BxATG1 and BxATG8 in B. xylophilus after Treated with Rapamycin
2.3. Response and Expression of B. xylophilus Autophagy Genes BxATG1 and BxATG8 at Temperature Changes
2.4. Expression Level of B. xylophilus Autophagy Genes BxATG1 and BxATG8 under Oxidative Stress
2.5. Expression Level of B. xylophilus Autophagy Genes BxATG1 and BxATG8 after Pine Trees Inoculated with B. xylophilus
2.6. Virulence of Pine Wood Nematode (PWN) after RNAi
3. Discussion
4. Materials and Methods
4.1. PWN Growth Conditions and Experimental Organisms
4.2. Preparation of Autophagy Inducer
4.3. Analysis of Feeding and Reproduction of PWN after Autophagy Induction
4.4. RNA Extraction and cDNA Synthesis of PWN
4.5. Quantitative Reverse Transcription PCR (qRT-PCR)
4.6. Analysis of Expression Level of BxATG1 and BxATG8 When Temperature Changes
4.7. Analysis of Expression Level of BxATG1 and BxATG8 in Oxidative Stress
4.8. Analysis of Expression Level of BxATG1 and BxATG8 after Pine Was Inoculated with B. xylophilus
4.9. BxATG1 and BxATG8 Interference Using Double-Stranded RNA
4.10. Evaluation of Virulence of PWN after RNAi
4.11. Statistical Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Mamiya, Y. History of pine wilt disease in Japan. J. Nematol. 1988, 20, 219–226. [Google Scholar] [PubMed]
- Mota, M.M.; Futai, K.; Vieira, P. Pine wilt disease and the pinewood nematode, Bursaphelenchus xylophilus. In Integrated Management and Biocontrol of Vegetable and Grain Crops Nematodes; Springer: New York, NY, USA, 2009; pp. 253–274. [Google Scholar]
- Robertson, L.; Arcos, S.C.; Escuer, M.; Merino, R.S.; Esparrago, G.; Abelleira, A.; Navas, A. Incidence of the pine wood nematode Bursaphelenchus xylophilus Steiner & Buhrer, 1934 (Nickle, 1970) in Spain. Nematology 2011, 13, 755–757. [Google Scholar]
- Yang, B.J.; Pan, H.Y.; Tang, J.; Wang, Y.Y.; Wang, L.F. Pine Wood Nematode Disease; China Forestry Publishing House: Beijing, China, 2003; pp. 45–48. [Google Scholar]
- Zhang, K.; Liang, J.Y.; Dong, H.; Zhang, X.Y. Research advances of pine wood nematode disease in China. World For. Res. 2010, 23, 59–63. [Google Scholar]
- Wang, S.L.; Cao, F.X.; Wang, M.; Qian, W.Q. Research Advance of Bursaphelenchus xylophilus Genes. J. Cent. South Univ. For. Technol. 2009, 29, 195–198. [Google Scholar]
- Reggiori, F.; Klionsky, D.J. Autophagy in the eukaryotic cell. Eukaryot. Cell 2002, 1, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L. Cloning and Functional Analysis of MgATG3, MgATG4 and MgATG7 Gene in Magnaporthe grisea. Master’s Thesis, ZheJiang University, Zhejiang, China, 2007. [Google Scholar]
- Liu, X.; Lu, J.; Lin, F. Autophagy during conidiation, conidial germination and turgor generation in Magnaporthe grisea. Autophagy 2007, 3, 472–473. [Google Scholar] [CrossRef] [PubMed]
- Dong, B.; Liu, X.H.; Lu, J.P. MgAtg9 trafficking in Magnaporthe oryzae. Autophagy 2009, 5, 946–953. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.M.; Liu, X.G.; Shi, H.B. MoMon1 is required for vacuolar assembly, conidiogenesis and pathogenicity in the rice blast fungus Magnaporthe oryzae. Res. Microbiol. 2013, 164, 300–309. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J.; Cregg, J.M.; Dunn, W.A., Jr.; Emr, S.D.; Sakai, Y.; Sandoval, I.V.; Sibirny, A.; Subramani, S.; Thumm, M.; Veenhuis, M.; et al. A unified nomenelature for yeast autophagy-related genes. Dev. Cell 2003, 5, 539–545. [Google Scholar] [CrossRef]
- Meléndez, A.; TaUóczy, Z.; Seaman, M.; Eskelinen, E.L.; Hall, D.H.; Levine, B. Autophagy genes are essential for dauer development and life-span extension in C. elegans. Science 2003, 301, 1387–1391. [Google Scholar] [CrossRef] [PubMed]
- Guo, B. Genome-Wide Screen to Identify Regulators of Autophagy Activity in C. elegans. Ph.D. Thesis, China Agricultural University, Beijing, China, 2014. [Google Scholar]
- Gao, H.; Li, Y.Y.; Huang, R.; Wu, S.Y. Application progress of model organisms C. elegans in the study of autophagy-related diseases. J. Parasit. Biol. 2015, 7, 669–671. [Google Scholar]
- Zhang, H. The Function of C. elegans ATG-16 Homolog in the Autophagy Pathway. Ph.D. Thesis, China Agricultural University, Beijing, China, 2014. [Google Scholar]
- Sarkar, S. Regulation of autophagy by mTOR-dependent and mTOR-independent pathways: Autophagy dysfunction in neurodegenerative diseases and therapeutic application of autophagy enhancers. Biochem. Soc. Trans. 2013, 41, 1103–1130. [Google Scholar] [CrossRef] [PubMed]
- Shpilka, T.; Weidberg, H.; Pietrokovski, S.; Elazar, Z. Atg8: An autophagy-related ubiquitin-like protein family. Genome Biol. 2011, 12, 226. [Google Scholar] [CrossRef] [PubMed]
- Loewith, R.; Jacinto, E.; Wullschleger, S.; Lorberg, A.; Crespo, J.L.; Bonenfant, D.; Oppliger, W.; Jenoe, P.; Hall, M.N. Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol. Cell 2002, 10, 457–468. [Google Scholar] [CrossRef]
- Caccamo, A.; Majumder, S.; Richardson, A.; Strong, R.; Oddo, S. Molecular interplay between mammalian target of rapamycin (mTOR), amyloid-β, and tau effects on cognitive impairments. J. Biol. Chem. 2010, 285, 13107–13120. [Google Scholar] [CrossRef] [PubMed]
- Deng, L.N.; Wu, X.Q.; Ye, J.R.; Xue, Q. Identification of autophagy in the pine wood nematode Bursaphelenchus xylophilus and the molecular characterization and functional analysis of two novel autophagy-related genes, BxATG1 and BxATG8. Int. J. Mol. Sci. 2016, 17, 297. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.H.; Lu, J.P.; Zhang, L.; Dong, B.; Min, H.; Lin, F.C. Involvement of a Magnaporthe grisea serine/threonine kinase gene, MgATG1, in appressorium turgor and pathogenesis. Eukaryot. Cell 2007, 6, 997–1005. [Google Scholar] [CrossRef] [PubMed]
- Bryant, B.; Raikhel, A.S. Programmed autophagy in the fat body of Aedesaegypti is required to maintain egg maturation cycles. PLoS ONE 2011, 6, e25502. [Google Scholar] [CrossRef] [PubMed]
- Asakura, M.; Ninomiya, S.; Sugimoto, M.; Oku, M.; Yamashita, S.I.; Okuno, T.; Sakai, Y.; Takano, Y. Atg26-mediated pexophagy is required for host invasion by the plant pathogenic fungus Colletotrichum orbiculare. Plant Cell 2009, 21, 1291–1304. [Google Scholar] [CrossRef] [PubMed]
- Boya, R.; Reggiori, R.; Codogno, P. Emerging regulation and functions of autophagy. Nat. Cell Biol. 2013, 15, 713–720. [Google Scholar] [CrossRef] [PubMed]
- Ma, K.X.; Xi, X.Z. The mechanism and function of autophagy. Biol. Teach. 2011, 36, 2–4. [Google Scholar]
- Li, M. Regulation of mTOR Signaling by Reactive Oxygen Species and Its Mechanisms. Ph.D. Thesis, Southern Medical University, Guangzhou, China, 2009. [Google Scholar]
- Scherz-Shouval, R.; Shvets, E.; Fass, E.; Shorer, H.; Gil, L.; Elazar, Z. Reactive oxygen species are essential for autophagy and specifically regulate the activity of Atg4. EMBO J. 2007, 26, 1749–1760. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wu, X.Q.; Ying, C.X.; He, L.X.; Ye, J.R. The difference of progenitive power and superoxide anion production in Bursaphelenchus xylophilus and B. mucronatus. J. Nanjing For. Univ. 2009, 33, 5–8. [Google Scholar]
- Yu, L.Z.; Wu, X.Q.; Ye, J.R.; Zhang, S.N. Relationships between nitric oxide response signal and external factors during the early interaction between Pinus thunbergii and Bursaphelenchus xylophilus. Chin. J. Appl. Ecol. 2013, 24, 646–652. [Google Scholar]
- Yu, L.Z.; Wang, C.; Lu, M. The Role of ROS signaling molecules in plant disease resistance response. Shanxi For. Sci. Technol. 2015, 2, 70–72. [Google Scholar]
- Yang, Z.; Klionsky, D.J. An overview of the molecular mechanism of autophagy. Curr. Top. Microbiol. Immunol. 2009, 335, 1–32. [Google Scholar] [PubMed]
- Khalfan, W.A.; Klionsky, D.J. Molecular machinery required for autophagy and the cytoplasm to vacuole targeting (Cvt) pathway in S. cerevisiae. Curr. Opin. Cell Biol. 2002, 14, 468–475. [Google Scholar] [CrossRef]
- Suzuki, K. Selective autophagy in budding yeast. Cell Death Differ. 2013, 20, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Mizushima, N. Autophagy: Process and function. Genes Dev. 2007, 21, 2861–2873. [Google Scholar] [CrossRef] [PubMed]
- Espada, M.; Silva, A.C.; van den Akker, S.E.; Cock, P.J.; Mota, M.; Jones, J.T. Identification and characterization of parasitism genes from the pinewood nematode Bursaphelenchus xylophilus reveals a multilayered detoxification strategy. Mol. Plant Pathol. 2016, 17, 286–295. [Google Scholar] [CrossRef] [PubMed]
- Kariola, T.; Brader, G.; Li, J.; Palva, E.T. Chlorophyllase L, a damage control enzyme, affects the balance between defense pathways in plants. Plant Cell 2005, 17, 282–294. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.Z.; Wu, X.Q.; Ye, J.R.; Zhang, S.N.; Wang, C. NOS-like-mediated nitric oxide is involved in Pinus thunbergii response to the invasion of Bursaphelenchus xylophilus. Plant Cell Rep. 2012, 31, 1813–1821. [Google Scholar] [CrossRef] [PubMed]
- Shinya, R.; Morisaka, H.; Takeuchi, Y.; Ueda, M.; Futai, K. Comparison of the surface coat proteins of the pine wood nematode appeared during host pine infection and in vitro culture by a proteomic approach. Phytopathology 2010, 100, 1289–1297. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J. The molecular machinery of autophagy: Unanswered questions. J. Cell Sci. 2005, 118, 7–18. [Google Scholar] [CrossRef] [PubMed]
- Wesley, S.V.; Helliwell, C.A.; Smith, N.A.; Wang, M.B.; Rouse, D.T.; Liu, Q.; Gooding, P.S.; Singh, S.P.; Abbott, D.; Stoutjesdijk, P.A.; et al. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 2001, 27, 581–590. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.H.; Wang, H.I.; Lu, H.C.; Chen, C.E.; Chen, H.H.; Yeh, H.H.; Tang, C.Y. An efficient RNA interference screening strategy for gene functional analysis. BMC Genom. 2012, 13, 491. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.B.; Lu, Q.; Liang, J.; Zhang, X.Y. Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference. Genet. Mol. Res. 2011, 10, 1931–1941. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.S.; Koh, Y.H.; Moon, Y.S.; Lee, S.H. Molecular properties of a venom allergen-like protein suggest a parasitic function in the pinewood nematode Bursaphelenchus xylophilus. Int. J Parasitol. 2012, 42, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.Y.; Dai, S.M.; Xiao, L.; Xie, B.Y. Influence of cellulase gene knockdown by dsRNA interference on the development and reproduction of the pine wood nematode Bursaphelenchus xylophilus. Nematology 2010, 12, 225–233. [Google Scholar] [CrossRef]
- Xu, X.L.; Wu, X.Q.; Ye, J.R.; Huang, L. Molecular characterization and functional analysis of three pathogenesis-related Cytochrome P450 genes from Bursaphelenchus xylophilus (Tylenchida: Aphelenchoidoidea). Int. J. Mol. Sci. 2015, 16, 5216–5234. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Y.; Wu, X.Q.; Zhou, A.D. Bacterial diversity and community structure in the pine wood nematode Bursaphelenchus xylophilus and B. mucronatus with different virulence by high-throughput sequencing of the 16S rDNA. PLoS ONE 2015, 10, e0137386. [Google Scholar] [CrossRef] [PubMed]
- Viglierchio, D.R.; Schmitt, R.V. On the methodology of nematode extraction from field samples: Baermann funnel modifications. J. Nematol. 1983, 15, 438–444. [Google Scholar] [PubMed]
- Jiang, L.L. The Effects of Rapamycin on Autophagy and Renal Interstitial Fibrosis of UUO Rats. Master’s Thesis, Hebei Medical University, Hebei, China, 2014. [Google Scholar]
- Li, J.B.; Deng, Y.J.; Zhang, X.P. Influence of rapamycin on autophagy and apoptosis of two lepidopteran cell lines. Chin. Bull. Entomol. 2009, 46, 383–388. [Google Scholar]
- Livak, K.; Schmittgen, D. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.H.; Ye, J.R.; Negi, S.; Xu, X.L.; Wang, Z.L.; Ji, J.Y. Pathogenicity of aseptic Bursaphelenchus xylophilus. PLoS ONE 2012, 7, e38095. [Google Scholar] [CrossRef] [PubMed]
- Urwin, P.E.; Lilley, C.J.; Atkinson, H.J. Ingestion of double-stranded RNA by preparasitic juvenile cystnematodes leads to RNA interference. Mol. Plant Microbe Interact. 2002, 15, 747–752. [Google Scholar] [CrossRef] [PubMed]










| Nematodes | Infection Rates | Disease Severity Indices | Days of Symptoms Appeared (d) | Days of P. Thunbergii Wilted (d) | ||||
|---|---|---|---|---|---|---|---|---|
| 14th day | 20th day | 30th day | 14th day | 20th day | 30th day | |||
| nematodes soaked in ddH2O | 50 | 100 | 100 | 12.5 | 50 | 100 | 12 | 28 |
| nematodes soaked in dsGFP | 50 | 100 | 100 | 12.5 | 50 | 100 | 12 | 29 |
| nematodes soaked in dsBxATG1 | 0 | 50 | 100 | 0 | 12.5 | 56.3 | 17 | 45 |
| nematodes soaked in dsBxATG8 | 0 | 75 | 100 | 0 | 18.8 | 87.5 | 16 | 38 |
| Name of Primers | Sequence (5′–3′) |
|---|---|
| BxATG1-T7I-F | TAATACGACTCACTATAGGGAAGGCAGAAATCGGACA |
| BxATG1-I-R | AATCGGCTCATGGAAAA |
| BxATG1-I-F | AAGGCAGAAATCGGACA |
| BxATG1-T7I-R | TAATACGACTCACTATAGGGAATCGGCTCATGGAAAA |
| BxATG8-T7I-F | TAATACGACTCACTATAGGGAACCCAAGTTTGAGACCT |
| BxATG8-I-R | TAATACGACTCACTATAGGGAAAGGAGAAGAACTTTTCAC |
| BxATG8-I-F | CTGTTACAAACTCAAGAAGG |
| BxATG8-T7I-R | AAAGGAGAAGAACTTTTCAC |
| GFP-T7I-F | TAATACGACTCACTATAGGGCTGTTACAAACTCAAGAAGG |
| GFP-I-R | CGAAAACACTACAATAAGA |
| GFP-I-F | AACCCAAGTTTGAGACCT |
| GFP-T7I-R | TAATACGACTCACTATAGGG CGAAAACACTACAATAAGA |
| Actin F | GCAACACGGAGTTCGTTGTAGA |
| Actin R | GTATCGTCACCAACTGGGATGA |
| qBxATG1-F | AGAGTGTTGGGTGAGGGA |
| qBxATG1-R | CTCGGCATTGGTACATTATA |
| qBxATG8-F | GTCAACGATGTCATTCCCCA |
| qBxATG8-R | AACTGATCACTCTTCGGCGG |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, F.; Deng, L.-N.; Wu, X.-Q.; Liu, H.-B.; Ye, J.-R. Expression Profiling of Autophagy Genes BxATG1 and BxATG8 under Biotic and Abiotic Stresses in Pine Wood Nematode Bursaphelenchus xylophilus. Int. J. Mol. Sci. 2017, 18, 2639. https://doi.org/10.3390/ijms18122639
Wu F, Deng L-N, Wu X-Q, Liu H-B, Ye J-R. Expression Profiling of Autophagy Genes BxATG1 and BxATG8 under Biotic and Abiotic Stresses in Pine Wood Nematode Bursaphelenchus xylophilus. International Journal of Molecular Sciences. 2017; 18(12):2639. https://doi.org/10.3390/ijms18122639
Chicago/Turabian StyleWu, Fan, Li-Na Deng, Xiao-Qin Wu, Hong-Bin Liu, and Jian-Ren Ye. 2017. "Expression Profiling of Autophagy Genes BxATG1 and BxATG8 under Biotic and Abiotic Stresses in Pine Wood Nematode Bursaphelenchus xylophilus" International Journal of Molecular Sciences 18, no. 12: 2639. https://doi.org/10.3390/ijms18122639
APA StyleWu, F., Deng, L.-N., Wu, X.-Q., Liu, H.-B., & Ye, J.-R. (2017). Expression Profiling of Autophagy Genes BxATG1 and BxATG8 under Biotic and Abiotic Stresses in Pine Wood Nematode Bursaphelenchus xylophilus. International Journal of Molecular Sciences, 18(12), 2639. https://doi.org/10.3390/ijms18122639
