Characterization of miR-206 Promoter and Its Association with Birthweight in Chicken
Abstract
:1. Introduction
2. Results
2.1. The Identification of the Promoter Region of gga-miR-206
2.2. MyoD up-Regulates the Transcriptional Activity of gga-miR-206 in Vitro
2.3. MyoD Induces Muscle-Specific miR-206 Expression in Fibroblast and Myoblast Cells
2.4. Polymorphisms in the Promoter Region of gga-miR-206
2.5. The Mutation G-419C Affects the miR-206’s Promoter Activity
2.6. Genetic Effects of Variants in the Promoter Region of miR-206 on the Birth Weight
2.7. miR-206 Partly Induced Myogenesis by Myog and MCK
3. Discussion
4. Experimental Section
4.1. Ethics Statement
4.2. Animals
4.3. Cell Culture
4.4. RNA Extraction and RT-PCR
4.5. Real Time RT-PCR
4.6. Over-Expressing miR-206 and MyoD in Vitro
4.7. SNP Identification
4.8. Luciferase Reporter Assay for miR-206 Promoter Activity
4.9. Association Analysis and Statistical Analysis
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Didiano, D.; Hobert, O. Molecular architecture of a miRNA-regulated 3′ UTR. RNA 2008, 14, 1297–317. [Google Scholar] [CrossRef] [PubMed]
- Fang, Z.; Rajewsky, N. The impact of miRNA target sites in coding sequences and in 3′ UTRs. PLoS ONE 2011, 6, e18067. [Google Scholar] [CrossRef] [PubMed]
- Gu, W.; Wang, X.; Zhai, C.; Zhou, T.; Xie, X. Biological basis of miRNA action when their targets are located in human protein coding region. PLoS ONE 2013, 8, e63403. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Wong, A.K.; Tizard, M.L.; Moore, R.J.; Lefevre, C. miRNA_Targets: A database for miRNA target predictions in coding and non-coding regions of mRNAs. Genomics 2012, 100, 352–356. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, A.; Griffiths-Jones, S.; Ashurst, J.L.; Bradley, A. Identification of mammalian microRNA host genes and transcription units. Genome Res. 2004, 14, 1902–1910. [Google Scholar] [CrossRef] [PubMed]
- Ambros, V. The functions of animal microRNAs. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Kim, M.; Han, J.; Yeom, K.H.; Lee, S.; Baek, S.H.; Kim, V.N. MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 2004, 23, 4051–4060. [Google Scholar] [CrossRef] [PubMed]
- Haramati, S.; Chapnik, E.; Sztainberg, Y.; Eilam, R.; Zwang, R.; Gershoni, N.; McGlinn, E.; Heiser, P.W.; Wills, A.M.; Wirguin, I.; et al. miRNA malfunction causes spinal motor neuron disease. Proc. Natl. Acad. Sci. USA 2010, 107, 13111–13116. [Google Scholar] [CrossRef] [PubMed]
- Leidinger, P.; Backes, C.; Deutscher, S.; Schmitt, K.; Mueller, S.C.; Frese, K.; Haas, J.; Ruprecht, K.; Paul, F.; Stahler, C.; et al. A blood based 12-miRNA signature of Alzheimer disease patients. Genome Biol. 2013, 14, R78. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.L.; Chen, H.Y.; Chang, G.C.; Chen, C.Y.; Chen, H.W.; Singh, S.; Cheng, C.L.; Yu, C.J.; Lee, Y.C.; Chen, H.S.; et al. MicroRNA signature predicts survival and relapse in lung cancer. Cancer Cell 2008, 13, 48–57. [Google Scholar] [CrossRef] [PubMed]
- Van Rooij, E.; Liu, N.; Olson, E.N. MicroRNAs flex their muscles. Trends Genet. 2008, 24, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Sempere, L.F.; Freemantle, S.; Pitha-Rowe, I.; Moss, E.; Dmitrovsky, E.; Ambros, V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004, 5, R13. [Google Scholar] [CrossRef] [PubMed]
- Townley-Tilson, W.H.; Callis, T.E.; Wang, D. MicroRNAs 1, 133, and 206: Critical factors of skeletal and cardiac muscle development, function, and disease. Int. J. Biochem. Cell Biol. 2010, 42, 1252–1255. [Google Scholar] [CrossRef] [PubMed]
- Anderson, C.; Catoe, H.; Werner, R. miR-206 regulates connexin43 expression during skeletal muscle development. Nucleic Acids Res. 2006, 34, 5863–5871. [Google Scholar] [CrossRef] [PubMed]
- Baskerville, S.; Bartel, D.P. Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. RNA 2005, 11, 241–247. [Google Scholar] [CrossRef] [PubMed]
- Takada, S.; Berezikov, E.; Yamashita, Y.; Lagos-Quintana, M.; Kloosterman, W.P.; Enomoto, M.; Hatanaka, H.; Fujiwara, S.; Watanabe, H.; Soda, M.; et al. Mouse microRNA profiles determined with a new and sensitive cloning method. Nucleic Acids Res. 2006, 34, e115. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.A.; Shon, Y.H.; Lim, J.O.; Yoo, J.J.; Shin, H.I.; Park, E.K. MYOD mediates skeletal myogenic differentiation of human amniotic fluid stem cells and regeneration of muscle injury. Stem Cell Res. Ther. 2013, 4, 147. [Google Scholar] [CrossRef] [PubMed]
- Yutaka, A. TFSEARCH Search Result. Available online: http://www.cbrc.jp/htbin/nph-tfsearch (accessed on 10 May 2015).
- Li, T.; Wu, R.; Zhang, Y.; Zhu, D. A systematic analysis of the skeletal muscle miRNA transcriptome of chicken varieties with divergent skeletal muscle growth identifies novel miRNAs and differentially expressed miRNAs. BMC Genom. 2011, 12, 186. [Google Scholar] [CrossRef] [PubMed]
- Gagan, J.; Dey, B.K.; Layer, R.; Yan, Z.; Dutta, A. Notch3 and Mef2c proteins are mutually antagonistic via MKP1 protein and miR-1/206 microRNAs in differentiating myoblasts. J. Biol. Chem. 2012, 287, 40360–40370. [Google Scholar] [CrossRef] [PubMed]
- Soleimani, V.D.; Yin, H.; Jahani-Asl, A.; Ming, H.; Kockx, C.E.; van Ijcken, W.F.; Grosveld, F.; Rudnicki, M.A. Snail regulates MyoD binding-site occupancy to direct enhancer switching and differentiation-specific transcription in myogenesis. Mol. Cell 2012, 47, 457–468. [Google Scholar] [CrossRef] [PubMed]
- Williams, A.H.; Valdez, G.; Moresi, V.; Qi, X.; McAnally, J.; Elliott, J.L.; Bassel-Duby, R.; Sanes, J.R.; Olson, E.N. MicroRNA-206 delays ALS progression and promotes regeneration of neuromuscular synapses in mice. Science 2009, 326, 1549–1554. [Google Scholar] [CrossRef] [PubMed]
- Yuasa, K.; Hagiwara, Y.; Ando, M.; Nakamura, A.; Takeda, S.; Hijikata, T. MicroRNA-206 is highly expressed in newly formed muscle fibers: Implications regarding potential for muscle regeneration and maturation in muscular dystrophy. Cell Struct. Funct. 2008, 33, 163–169. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wang, T.; Su, Y.; Li, W.; Frame, L.T.; Ai, G. Recombinant adenoviral microRNA-206 induces myogenesis in C2C12 cells. Med. Sci. Monit. 2011, 17, BR364–BR371. [Google Scholar] [CrossRef] [PubMed]
- Andreote, A.P.; Rosario, M.F.; Ledur, M.C.; Jorge, E.C.; Sonstegard, T.S.; Matukumalli, L.; Coutinho, L.L. Identification and characterization of microRNAs expressed in chicken skeletal muscle. Genet. Mol. Res. 2014, 13, 1465–1479. [Google Scholar] [CrossRef] [PubMed]
- Goljanek-Whysall, K.; Sweetman, D.; Abu-Elmagd, M.; Chapnik, E.; Dalmay, T.; Hornstein, E.; Munsterberg, A. MicroRNA regulation of the paired-box transcription factor Pax3 confers robustness to developmental timing of myogenesis. Proc. Natl. Acad. Sci. USA 2011, 108, 11936–11941. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.; Kim, J.; Willert, T.; Klein-Rodewald, T.; Garcia-Dominguez, M.; Mosqueira, M.; Fink, R.; Esposito, I.; Hofbauer, L.C.; Charnay, P.; et al. Ebf factors and MyoD cooperate to regulate muscle relaxation via Atp2a1. Nat. Commun. 2014, 5, 3793. [Google Scholar] [CrossRef] [PubMed]
- Shklover, J.; Weisman-Shomer, P.; Yafe, A.; Fry, M. Quadruplex structures of muscle gene promoter sequences enhance in vivo MyoD-dependent gene expression. Nucleic Acids Res. 2010, 38, 2369–2377. [Google Scholar] [CrossRef] [PubMed]
- Davis, R.L.; Weintraub, H.; Lassar, A.B. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 1987, 51, 987–1000. [Google Scholar] [CrossRef]
- Macquarrie, K.L.; Yao, Z.; Young, J.M.; Cao, Y.; Tapscott, S.J. miR-206 integrates multiple components of differentiation pathways to control the transition from growth to differentiation in rhabdomyosarcoma cells. Skeletal Muscle 2012, 2, 7. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Nelson, B.R.; Bezprozvannaya, S.; Shelton, J.M.; Richardson, J.A.; Bassel-Duby, R.; Olson, E.N. Requirement of MEF2A, C, and D for skeletal muscle regeneration. Proc. Natl. Acad. Sci. USA 2014, 111, 4109–4114. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Fan, C.; Topol, S.E.; Topol, E.J.; Wang, Q. Mutation of MEF2A in an inherited disorder with features of coronary artery disease. Science 2003, 302, 1578–1581. [Google Scholar] [CrossRef] [PubMed]
- Kolodziejska, K.M.; Noyan-Ashraf, M.H.; Nagy, A.; Bacon, A.; Frampton, J.; Xin, H.B.; Kotlikoff, M.I.; Husain, M. c-Myb-dependent smooth muscle cell differentiation. Circ. Res. 2008, 102, 554–561. [Google Scholar] [CrossRef] [PubMed]
- Penner, G.; Gang, G.; Sun, X.Y.; Wray, C.; Hasselgren, P.O. C/EBP DNA-binding activity is upregulated by a glucocorticoid-dependent mechanism in septic muscle. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 282, R439–R444. [Google Scholar] [CrossRef] [PubMed]
- Simons, M.; Edelman, E.R.; DeKeyser, J.L.; Langer, R.; Rosenberg, R.D. Antisense c-Myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo. Nature 1992, 359, 67–70. [Google Scholar] [CrossRef] [PubMed]
- Tapscott, S.J.; Davis, R.L.; Thayer, M.J.; Cheng, P.F.; Weintraub, H.; Lassar, A.B. MyoD1: A nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science 1988, 242, 405–411. [Google Scholar] [CrossRef] [PubMed]
- Sweetman, D.; Goljanek, K.; Rathjen, T.; Oustanina, S.; Braun, T.; Dalmay, T.; Munsterberg, A. Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. Dev. Biol. 2008, 321, 491–499. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.; Nie, Q.; Lamont, S.J.; Zhang, X. Variation in sequence and expression of the avian FTO, and association with glucose metabolism, body weight, fatness and body composition in chickens. Int. J. Obes. 2012, 36, 1054–1061. [Google Scholar] [CrossRef] [PubMed]
Maker | Position | Chr Location | Type | Sequences |
---|---|---|---|---|
SNP1 | −1020 bp | 107215055 | AT | AACCAAAATGACTGGGTGTGA |
SNP2 | −964 bp | 107214999 | CG | AGTTGCGAAACAGAAAGTTTCT |
SNP3 | −908 bp | 107214943 | AG | GGTAGGATGAAGAATCCCATG |
SNP4 | −804 bp | 107214839 | GT | TGGGACCTCTGGGTCCATCTG |
SNP5 | −713 bp | 107214748 | CG | AGAAGAGATACTCCACTACCT |
SNP6 | −674 bp | 107214709 | CA | ATGAAGAAGACACAGGAGATA |
SNP7 | −615 bp | 107214650 | GA | TGGTTGCAATGCATCAGGTTA |
SNP8 | −607 bp | 107214642 | CT | ATGCATCAGGCTAACTTCCCT |
SNP9 | −569 bp | 107214604 | CT | AAGACATTTCCACTTAGGACA |
SNP10 | −515 bp | 107214550 | GT | ACTCCAACCGGTTTTTTCCCA |
SNP11 | −470 bp | 107214505 | AT | ATCTCCAGCAACCCTGAGTGT |
SNP12 | −454 bp | 107214489 | CT | AGTGTAGCTGTCCCATCAAGA |
SNP13 | −419 bp | 107214454 | GC | CAAACCAGGTGCTCCAGTAGA |
SNP14 | −390 bp | 107214425 | CG | AAGGGAGGGACAGTGGTGCCA |
SNP15 | −356 bp | 107214391 | TC | CCAATTGACCTAAGCTTGACC |
SNP16 | −327 bp | 107214362 | GT | GGCAAAGAGAGGGACAAGAGG |
SNP17 | −244 bp | 107214279 | GA | GAACCAGACCGGGCTCCAGTG |
SNP18 | −145 bp | 107214180 | AG | CTTCCTGATCAGGACATTTGT |
SNP19 | −140 bp | 107214175 | GA | TGATCGGGACGTTTGTACCAA |
SNP20 | −120 bp | 107214155 | CT | ATAATAATAACATTTTGGTGT |
SNP21 | −114 bp | 107214149 | GA | ATAATATTTTGGTGTTCCTGC |
SNP22 | −83 bp | 107214118 | AG | AGGAGAAAGCAGATCACCAGC |
SNP23 | −32 bp | 107214067 | CT | TCTCCAGGAGCGCCCAGAGGT |
SNPs | Position | Mutation | Birthweight (Least Squares Mean, g) | p Value | ||
---|---|---|---|---|---|---|
SNP7 | −615 bp | G/A | 30.1424 (GG/66) | 31.7435 (GA/23) | 29.4868 (AA/189) | 0.0035 |
SNP10 | −515 bp | G/T | 29.5055 (GG/183) | 30.8324 (GT/34) | 30.2292 (TT/72) | 0.0355 |
SNP11 | −470 bp | A/T | 31.0194 (AA/36) | 30.9600 (AT/15) | 29.6075 (TT/240) | 0.0232 |
SNP12 | −454 bp | C/T | 30.1040 (CC/151) | 30.5220 (CT/41) | 29.2430 (TT/100) | 0.1726 |
SNP13 | −419 bp | G/C | 30.8111 (CC/36) | 29.1286 (CG/27) | 29.0522 (GG/249) | 0.0229 |
SNP15 | −356 bp | T/C | 30.1899 (TT/69) | 31.0147 (TC/34) | 29.5439 (CC/189) | 0.0138 |
SNP17 | −244 bp | G/A | 30.5969 (GG/129) | 30.555 (AG/40) | 28.8797 (AA/123) | 0.1202 |
SNP18 | −145 bp | A/G | 31.0194 (AA/36) | 31.25 (AG/16) | 29.6203 (GG/241) | 0.0163 |
SNP19 | −140 bp | G/A | 31.0194 (AA/36) | 31.25 (AG/16) | 29.6203 (GG/241) | 0.0163 |
SNP20 | −120 bp | C/T | 28.9643 (CC/126) | 30.5429 (CT/42) | 30.6032 (TT/126) | 0.2140 |
SNP21 | −114 bp | G/A | 31.0194 (AA/36) | 31.25 (AG/16) | 29.6203 (GG/241) | 0.0163 |
Primer Name | Primer Sequences (5′→3′) | Accession Number | Product Size (bp) | Tm (°C) | Notes |
---|---|---|---|---|---|
miR206-pro-F1 | ggggtaccggcatcaccttgctaccctaaa | NR_031431.1 | 1592 | 65 | pGL-vector |
miR206-pro-R1 | ccgctcgagagaggcagcatttctcctcatc | ||||
miR206-pro-F2 | ggggtaccgcccatttccttcaacctttcc | NR_031431.1 | 1121 | 65 | pGL-vector |
miR206-pro-R2 | ccgctcgagagaggcagcatttctcctcatc | ||||
miR206GT-F | cataaatcgtggaacaacgcataa | NR_031431.1 | 1198 | 62 | SNP |
miR206GT-R | gcagtagctggaagcagaggac | ||||
myoD-F2 | ggggtaccactccgacgttcccagtc | NM_204214.2 | 1213 | 62 | pcDNA-MyoD |
myoD-R2 | cggaattccaggttccctattctccaaa | ||||
MyoD-F | ggaaggaggaaacctgagtga | NM_204214.2 | 129 | 60 | qPCR |
MyoD-R | ctggacctgcctttatagcac | ||||
MYOG-F | cggaggctgaagaaggtgaa | NM_204184.1 | 219 | 60 | |
MYOG-R | cggtcctctgcctggtcat | ||||
MHC-F | ctcctcacgctttggtaa | NM_001319304 | 218 | 60 | |
MHC-R | tgatagtcgtatgggttggt | ||||
MCK-F | ctgggcttctcggaggtgga | NM_205507.1 | 109 | 60 | |
MCK-R | cgtctatgggctggttctgct | ||||
TMEM8C-F | atcgaccttcatcatgtttgg | NM_001318457.1 | 161 | 60 | |
TMEM8C-R | ttgtctggatacagccctttc | ||||
gga-miR-206 | tggaatgtaaggaagtgtgtgg | NR_031431.1 | 65 | 58 | |
U6-qiagen-F | cgatacagagaagattagcatgg cccctgc | EU240275 | 109 | 58 | |
β-Actin-F | ctcccccatgccatcctccgtctg | NM_205518.1 | 179 | 60 | |
β-Actin-R | gctgtggccatctcctgctc |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, X.; Lin, H.; Abdalla, B.A.; Nie, Q. Characterization of miR-206 Promoter and Its Association with Birthweight in Chicken. Int. J. Mol. Sci. 2016, 17, 559. https://doi.org/10.3390/ijms17040559
Jia X, Lin H, Abdalla BA, Nie Q. Characterization of miR-206 Promoter and Its Association with Birthweight in Chicken. International Journal of Molecular Sciences. 2016; 17(4):559. https://doi.org/10.3390/ijms17040559
Chicago/Turabian StyleJia, Xinzheng, Huiran Lin, Bahareldin Ali Abdalla, and Qinghua Nie. 2016. "Characterization of miR-206 Promoter and Its Association with Birthweight in Chicken" International Journal of Molecular Sciences 17, no. 4: 559. https://doi.org/10.3390/ijms17040559
APA StyleJia, X., Lin, H., Abdalla, B. A., & Nie, Q. (2016). Characterization of miR-206 Promoter and Its Association with Birthweight in Chicken. International Journal of Molecular Sciences, 17(4), 559. https://doi.org/10.3390/ijms17040559