Comparative Proteomic and Physiological Analysis Reveals the Variation Mechanisms of Leaf Coloration and Carbon Fixation in a Xantha Mutant of Ginkgo biloba L.
Abstract
:1. Introduction
2. Results
2.1. Chlorophyll Concentration, Chloroplast Ultrastructure and Photosynthesis Performance
2.2. 2-DE Analysis and Identification of Differentially Accumulated Proteins
2.3. Functional Categorization of Identified Proteins
2.4. Protein-Protein Interaction Analysis
2.5. Gene Expression Analysis by qRT-PCR
3. Discussion
3.1. Photosynthesis and Anatomical Characteristics
3.2. Proteins Involved in Photosynthesis and Carbon Fixation
3.3. Proteins Involved in Cellular Processes
3.4. Proteins Involved in Carbohydrate Metabolism
3.5. Proteins Involved in Protein Metabolism
3.6. Proteins Involved in Other Metabolic Pathways
4. Materials and Methods
4.1. Plant Materials
4.2. Pigment Determination and Photosynthetic Characteristics
4.3. Transmission Electron Microscopy Analysis
4.4. Isolation of Chloroplasts
4.5. Protein Extraction and Quantification
4.6. 2-D Electrophoresis and Gel Imaging Analysis
4.7. Protein Digestion and MALDI-TOF-TOF Analysis
4.8. RNA Extraction and qRT-PCR Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Eckhardt, U.; Grimm, B.; Hörtensteiner, S. Recent advances in chlorophyll biosynthesis and breakdown in higher plants. Plant Mol. Biol. 2004, 56, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, K.; Fujii, S.; Sasaki, D.; Baba, S.; Ohta, H.; Masuda, T.; Wada, H. Transcriptional regulation of thylakoid galactolipid biosynthesis coordinated with chlorophyll biosynthesis during the development of chloroplasts in Arabidopsis. Front. Plant Sci. 2014, 5. [Google Scholar] [CrossRef] [PubMed]
- Fromme, P.; Melkozernov, A.; Jordan, P.; Krauss, N. Structure and function of photosystem I: Interaction with its soluble electron carriers and external antenna systems. FEBS Lett. 2003, 555, 40–44. [Google Scholar] [CrossRef]
- Grimm, B. Novel insights in the control of tetrapyrrole metabolism of higher plants. Curr. Opin. Plant Biol. 1998, 1, 245–250. [Google Scholar] [CrossRef]
- Hörtensteiner, S.; Kräutler, B. Chlorophyll breakdown in higher plants. Biochim. Biophys. Acta 2011, 1807, 977–988. [Google Scholar] [CrossRef] [PubMed]
- Nagata, N.; Tanaka, R.; Satoh, S.; Tanaka, A. Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of prochlorococcus species. Plant Cell 2005, 17, 233–240. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.H.; Hur, J.; Ryu, C.H.; Choi, Y.; Chung, Y.Y.; Miyao, A.; Hirochika, H.; An, G. Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol. 2003, 44, 463–472. [Google Scholar] [CrossRef] [PubMed]
- Manjaya, J. Genetic improvement of soybean variety VLS-2 through induced mutations. Small 2009, 38, 106–109. [Google Scholar]
- Singh, R.; Ikehashi, H. Monogenic male-sterility in rice: Induction, identification and inheritance. Crop Sci. 1981, 21, 286–289. [Google Scholar] [CrossRef]
- Falbel, T.G.; Meehl, J.B.; Staehelin, L.A. Severity of mutant phenotype in a series of chlorophyll-deficient wheat mutants depends on light intensity and the severity of the block in chlorophyll synthesis. Plant Physiol. 1996, 112, 821–832. [Google Scholar] [CrossRef] [PubMed]
- Greene, B.A.; Staehelin, L.A.; Melis, A. Compensatory alterations in the photochemical apparatus of a photoregulatory, chlorophyll b-deficient mutant of maize. Plant Physiol. 1988, 87, 365–370. [Google Scholar] [CrossRef] [PubMed]
- Runge, S.; van Cleve, B.; Lebedev, N.; Armstrong, G.; Apel, K. Isolation and classification of chlorophyll-deficient xantha mutants of Arabidopsis thaliana. Planta 1995, 197, 490–500. [Google Scholar] [CrossRef] [PubMed]
- Terry, M.J.; Kendrick, R.E. Feedback inhibition of chlorophyll synthesis in the phytochrome chromophore-deficient aurea and yellow-green-2 mutants of tomato. Plant Physiol. 1999, 119, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Zhang, X.; He, B.; Diao, L.; Sheng, S.; Wang, J.; Guo, X.; Su, N.; Wang, L.; Jiang, L. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol. 2007, 145, 29–40. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Zhu, F.-Y.; Gao, X.; Sun, Y.; Li, S.; Tao, Y.; Lo, C.; Liu, H. Young leaf chlorosis 2 encodes the stroma-localized heme oxygenase 2 which is required for normal tetrapyrrole biosynthesis in rice. Planta 2014, 240, 701–712. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Fu, Y.; Hu, G.; Si, H.; Zhu, L.; Wu, C.; Sun, Z. Identification and fine mapping of a thermo-sensitive chlorophyll deficient mutant in rice (Oryza sativa L.). Planta 2007, 226, 785–795. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.T.; Li, J.; Yoo, J.H.; Yoo, S.C.; Cho, S.H.; Koh, H.J.; Seo, H.S.; Paek, N.C. Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development. Plant Mol. Biol. 2006, 62, 325–337. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Gong, Z.Y.; Yang, Z.F.; Yuan, Y.; Zhu, J.Y.; Wang, M.; Yuan, F.H.; Wu, S.J.; Wang, Z.Q.; Yi, C.D. Mutation of the light-induced yellow leaf 1 gene, which encodes a geranylgeranyl reductase, affects chlorophyll biosynthesis and light sensitivity in rice. PLoS ONE 2013, 8, e75299. [Google Scholar] [CrossRef] [PubMed]
- Miura, E.; Kato, Y.; Matsushima, R.; Albrecht, V.; Laalami, S.; Sakamoto, W. The balance between protein synthesis and degradation in chloroplasts determines leaf variegation in Arabidopsis yellow variegated mutants. Plant Cell 2007, 19, 1313–1328. [Google Scholar] [CrossRef] [PubMed]
- Sakamoto, W.; Zaltsman, A.; Adam, Z.; Takahashi, Y. Coordinated regulation and complex formation of YELLOW VARIEGATED1 and YELLOW VARIEGATED2, chloroplastic FtsH metalloproteases involved in the repair cycle of photosystem II in arabidopsis thylakoid membranes. Plant Cell 2003, 15, 2843–2855. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka-Nishimura, M.; Nanba, D.; Takaki, T.; Ohba, C.; Tsumura, N.; Morita, N.; Sakamoto, H.; Murata, K.; Yamamoto, Y. Quality control of photosystem II: Direct imaging of the changes in the thylakoid structure and distribution of FtsH proteases in spinach chloroplasts under light stress. Plant Cell Physiol. 2014, 55, 1255–1265. [Google Scholar] [CrossRef] [PubMed]
- Tomanek, L. Environmental proteomics: Changes in the proteome of marine organisms in response to environmental stress, pollutants, infection, symbiosis, and development. Annu. Rev. Mar. Sci. 2011, 3, 373–399. [Google Scholar] [CrossRef] [PubMed]
- Wittmann-Liebold, B.; Graack, H.R.; Pohl, T. Two-dimensional gel electrophoresis as tool for proteomics studies in combination with protein identification by mass spectrometry. Proteomics 2006, 6, 4688–4703. [Google Scholar] [CrossRef] [PubMed]
- Canovas, F.M.; Dumas-Gaudot, E.; Recorbet, G.; Jorrin, J.; Mock, H.P.; Rossignol, M. Plant proteome analysis. Proteomics 2004, 4, 285–298. [Google Scholar] [CrossRef] [PubMed]
- Fan, P.; Feng, J.; Jiang, P.; Chen, X.; Bao, H.; Nie, L.; Jiang, D.; Lv, S.; Kuang, T.; Li, Y. Coordination of carbon fixation and nitrogen metabolism in Salicornia europaea under salinity: Comparative proteomic analysis on chloroplast proteins. Proteomics 2011, 11, 4346–4367. [Google Scholar] [CrossRef] [PubMed]
- Joyard, J.; Ferro, M.; Masselon, C.; Seigneurin-Berny, D.; Salvi, D.; Garin, J.; Rolland, N. Chloroplast proteomics and the compartmentation of plastidial isoprenoid biosynthetic pathways. Mol. Plant 2009, 2, 1154–1180. [Google Scholar] [CrossRef] [PubMed]
- Taylor, N.L.; Tan, Y.F.; Jacoby, R.P.; Millar, A.H. Abiotic environmental stress induced changes in the Arabidopsis thaliana chloroplast, mitochondria and peroxisome proteomes. J. Proteom. 2009, 72, 367–378. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhang, W.; Xie, Y.; Lu, W.; Zhang, R. Comparative proteomics of thylakoid membrane from a chlorophyll b-less rice mutant and its wild type. Plant Sci. 2007, 173, 397–407. [Google Scholar] [CrossRef]
- Wang, L.; Cao, H.; Chen, C.; Yue, C.; Hao, X.; Yang, Y.; Wang, X. Complementary transcriptomic and proteomic analyses of a chlorophyll-deficient tea plant cultivar reveal multiple metabolic pathway changes. J. Proteom. 2016, 130, 160–169. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wu, X.X.; Zhang, Z.; Gao, Z.H. Comparative proteomic analysis of floral color variegation in peach. Biochem. Biophys. Res. Commun. 2015, 464, 1101–1106. [Google Scholar] [CrossRef] [PubMed]
- Shen, G.A.; Pang, Y.Z.; Wu, W.S.; Liao, Z.H.; Zhao, L.X.; Sun, X.F.; Tang, K.X. Cloning and characterization of a root-specific expressing gene encoding 3-hydroxy-3-methylglutaryl coenzyme a reductase from Ginkgo biloba. Mol. Biol. Rep. 2006, 33, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Raveh, E.; Wang, N.; Nobel, P.S. Gas exchange and metabolite fluctuations in green and yellow bands of variegated leaves of the monocotyledonous cam species Agave americana. Physiol. Plant. 1998, 103, 99–106. [Google Scholar] [CrossRef]
- Wu, Z.; Zhang, X.; Wang, J.; Wan, J. Leaf chloroplast ultrastructure and photosynthetic properties of a chlorophyll-deficient mutant of rice. Photosynthetica 2014, 52, 217–222. [Google Scholar] [CrossRef]
- Gitelson, A.A.; Gritz, Y.; Merzlyak, M.N. Relationships between leaf chlorophyll content and spectral reflectance and algorithms for non-destructive chlorophyll assessment in higher plant leaves. J. Plant Physiol. 2003, 160, 271–282. [Google Scholar] [CrossRef] [PubMed]
- Von Wettstein, D.; Gough, S.; Kannangara, C.G. Chlorophyll biosynthesis. Plant Cell 1995, 7, 1039–1057. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.X.; Zeng, X.H.; Chen, Y.L.; Yang, Z.H.; Qi, L.P.; Pu, Y.Y.; Yi, B.; Wen, J.; Ma, C.Z.; Shen, J.X. Genetic characterisation and fine mapping of a chlorophyll-deficient mutant (Bnac. ygl) in Brassica napus. Mol. Breed. 2014, 34, 603–614. [Google Scholar] [CrossRef]
- Peremarti, A.; Marè, C.; Aprile, A.; Roncaglia, E.; Cattivelli, L.; Villegas, D.; Royo, C. Transcriptomic and proteomic analyses of a pale-green durum wheat mutant shows variations in photosystem components and metabolic deficiencies under drought stress. BMC Genom. 2014, 15. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.S.; Wu, D.X.; Shen, S.Q.; Sun, J.W.; Shu, Q.Y. High photosynthetic efficiency of a rice (Oryza sativa L.) xantha mutant. Photosynthetica 2006, 44, 316–319. [Google Scholar] [CrossRef]
- Hideg, É.; Kós, P.B.; Schreiber, U. Imaging of NPQ and ROS formation in tobacco leaves: Heat inactivation of the water-water cycle prevents down-regulation of PSII. Plant Cell Physiol. 2008, 49, 1879–1886. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.J.; Zhang, J.Z.; Zhao, Q.; Liu, Y.L.; Chen, S.X.; Guo, H.L.; Shi, L.; Dai, S.J. Proteomic analysis reveals the leaf color regulation mechanism in chimera Hosta “gold standard” leaves. Int. J. Mol. Sci. 2016, 17. [Google Scholar] [CrossRef] [PubMed]
- Yuan, M.; Xu, M.Y.; Yuan, S.; Chen, Y.E.; Du, J.B.; Xu, F.; Zhang, Z.W.; Guo, Z.C.; Zhao, Z.Y.; Lin, H.H. Light regulation to chlorophyll synthesis and plastid development of the chlorophyll-less golden-leaf privet. J. Integr. Plant Biol. 2010, 52, 809–816. [Google Scholar] [CrossRef] [PubMed]
- Plücken, H.; Müller, B.; Grohmann, D.; Westhoff, P.; Eichacker, L.A. The HCF136 protein is essential for assembly of the photosystem II reaction center in Arabidopsis thaliana. FEBS Lett. 2002, 532, 85–90. [Google Scholar] [CrossRef]
- Spreitzer, R.J.; Salvucci, M.E. Rubisco: Structure, regulatory interactions, and possibilities for a better enzyme. Plant Biol. 2002, 53, 449–475. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.F.; Wang, J.Q.; Cao, M.L.; Zhao, K.; Shao, J.M.; Lei, T.T.; Yin, J.N.; Hill, G.G.; Xu, N.Z.; Liu, S.Q. Proteomic changes in rice leaves during development of field-grown rice plants. Proteomics 2005, 5, 961–972. [Google Scholar] [CrossRef] [PubMed]
- Carmo-Silva, A.E.; Salvucci, M.E. The activity of rubisco’s molecular chaperone, rubisco activase, in leaf extracts. Photosynth. Res. 2011, 108, 143–155. [Google Scholar] [CrossRef] [PubMed]
- Kumatani, T.; Sakurai-Ozato, N.; Miyawaki, N.; Yokota, E.; Shimmen, T.; Terashima, I.; Takagi, S. Possible association of actin filaments with chloroplasts of spinach mesophyll cells in vivo and in vitro. Protoplasma 2006, 229, 45–52. [Google Scholar] [CrossRef] [PubMed]
- Ostersetzer, O.; Adam, Z. Light-stimulated degradation of an unassembled Rieske FeS protein by a thylakoid-bound protease: The possible role of the FtsH protease. Plant Cell 1997, 9, 957–965. [Google Scholar] [CrossRef] [PubMed]
- Zaltsman, A.; Feder, A.; Adam, Z. Developmental and light effects on the accumulation of FtsH protease in Arabidopsis chloroplasts-implications for thylakoid formation and photosystem II maintenance. Plant J. 2005, 42, 609–617. [Google Scholar] [CrossRef] [PubMed]
- Zaltsman, A.; Ori, N.; Adam, Z. Two types of FtsH protease subunits are required for chloroplast biogenesis and photosystem ii repair in Arabidopsis. Plant Cell 2005, 17, 2782–2790. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.J.; Zhu, Y.; Ma, Z.X.; Sun, Y.; Quan, Q.; Li, P.; Hu, P.Z.; Shi, T.L.; Lo, C.; Chu, I.K. Proteomic evidence for genetic epistasis: ClpR4 mutations switch leaf variegation to virescence in Arabidopsis. Plant J. 2013, 76, 943–956. [Google Scholar] [CrossRef] [PubMed]
- Adam, Z.; Rudella, A.; van Wijk, K.J. Recent advances in the study of Clp, FtsH and other proteases located in chloroplasts. Curr. Opin. Plant Biol. 2006, 9, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Rasool, K.; Khan, M.; Aldawood, A.; Tufail, M.; Mukhtar, M.; Takeda, M. Optimization of protein isolation from date palm plants and its utilization in differential proteomics associated with red palm weevil infestation. Pak. J. Agric. Sci. 2014, 51, 907–917. [Google Scholar]
- Karuppanapandian, T.; Moon, J.C.; Kim, C.; Manoharan, K.; Kim, W. Reactive oxygen species in plants: Their generation, signal transduction, and scavenging mechanisms. Aust. J. Crop Sci. 2011, 5, 709–725. [Google Scholar]
- Asada, K. Ascorbate peroxidase—A hydrogen peroxide-scavenging enzyme in plants. Physiol. Plant. 1992, 85, 235–241. [Google Scholar] [CrossRef]
- Van Breusegem, F.; Slooten, L.; Stassart, J.-M.; Moens, T.; Botterman, J.; Van Montagu, M.; Inzé, D. Overproduction of Arabidopsis thaliana FeSOD confers oxidative stress tolerance to transgenic maize. Plant Cell Physiol. 1999, 40, 515–523. [Google Scholar] [CrossRef] [PubMed]
- Fries, M.; Jung, H.-I.; Perham, R.N. Reaction mechanism of the heterotetrameric (α2β2) E1 component of 2-oxo acid dehydrogenase multienzyme complexes. Biochemistry 2003, 42, 6996–7002. [Google Scholar] [CrossRef] [PubMed]
- Soo, P.C.; Horng, Y.T.; Lai, M.J.; Wei, J.R.; Hsieh, S.C.; Chang, Y.L.; Tsai, Y.H.; Lai, H.C. Pirin regulates pyruvate catabolism by interacting with the pyruvate dehydrogenase E1 subunit and modulating pyruvate dehydrogenase activity. J. Bacteriol. 2007, 189, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Funkhouser, E.A.; Loewus, F.A. Purification of myo-inositol 1-phosphate synthase from rice cell culture by affinity chromatography. Plant Physiol. 1975, 56, 786–790. [Google Scholar] [CrossRef] [PubMed]
- Abreu, E.F.; Aragão, F.J. Isolation and characterization of a myo-inositol-1-phosphate synthase gene from yellow passion fruit (Passiflora edulis f. flavicarpa) expressed during seed development and environmental stress. Ann. Bot. 2007, 99, 285–292. [Google Scholar] [PubMed]
- Tiessen, A.; Hendriks, J.H.; Stitt, M.; Branscheid, A.; Gibon, Y.; Farré, E.M.; Geigenberger, P. Starch synthesis in potato tubers is regulated by post-translational redox modification of ADP-glucose pyrophosphorylase a novel regulatory mechanism linking starch synthesis to the sucrose supply. Plant Cell 2002, 14, 2191–2213. [Google Scholar] [CrossRef] [PubMed]
- Visser, R.; Somhorst, I.; Kuipers, G.; Ruys, N.; Feenstra, W.; Jacobsen, E. Inhibition of the expression of the gene for granule-bound starch synthase in potato by antisense constructs. Mol. Gen. Genet. 1991, 225, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Pogson, B.J.; Albrecht, V. Genetic dissection of chloroplast biogenesis and development: An overview. Plant Physiol. 2011, 155, 1545–1551. [Google Scholar] [CrossRef] [PubMed]
- Park, M.H. The post-translational synthesis of a polyamine-derived amino acid, hypusine, in the eukaryotic translation initiation factor 5A (eIF5A). J. Biochem. 2006, 139, 161–169. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.G.; Selmer, M.; Dunham, C.M.; Weixlbaumer, A.; Kelley, A.C.; Ramakrishnan, V. The structure of the ribosome with elongation factor G trapped in the posttranslocational state. Science 2009, 326, 694–699. [Google Scholar] [CrossRef] [PubMed]
- Albrecht, V.; Ingenfeld, A.; Apel, K. Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: The impact of chloroplast elongation factor G on chloroplast development and plant vitality. Plant Mol. Biol. 2006, 60, 507–518. [Google Scholar] [CrossRef] [PubMed]
- Vierling, E. The roles of heat shock proteins in plants. Annu. Rev. Plant Biol. 1991, 42, 579–620. [Google Scholar] [CrossRef]
- Wang, W.X.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef] [PubMed]
- Miflin, B.J.; Habash, D.Z. The role of glutamine synthetase and glutamate dehydrogenase in nitrogen assimilation and possibilities for improvement in the nitrogen utilization of crops. J. Exp. Bot. 2002, 53, 979–987. [Google Scholar] [CrossRef] [PubMed]
- Hidaka, Y.; Shimamoto, S. Folding of peptides and proteins: Role of disulfide bonds, recent developments. Biomol. Concepts 2013, 4, 597–604. [Google Scholar] [CrossRef] [PubMed]
- Kasukabe, Y.; He, L.; Nada, K.; Misawa, S.; Ihara, I.; Tachibana, S. Overexpression of spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates the expression of various stress-regulated genes in transgenic Arabidopsis thaliana. Plant Cell Physiol. 2004, 45, 712–722. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, L.; Alhagdow, M.; Nunes-Nesi, A.; Quemener, B.; Guillon, F.; Bouchet, B.; Faurobert, M.; Gouble, B.; Page, D.; Garcia, V. GDP-d-mannose 3, 5-epimerase (GME) plays a key role at the intersection of ascorbate and non-cellulosic cell-wall biosynthesis in tomato. Plant J. 2009, 60, 499–508. [Google Scholar] [CrossRef] [PubMed]
- Grimm, B. Primary structure of a key enzyme in plant tetrapyrrole synthesis: Glutamate 1-semialdehyde aminotransferase. Proc. Natl. Acad. Sci. USA 1990, 87, 4169–4173. [Google Scholar] [CrossRef] [PubMed]
- Ahsan, N.; Nanjo, Y.; Sawada, H.; Kohno, Y.; Komatsu, S. Ozone stress-induced proteomic changes in leaf total soluble and chloroplast proteins of soybean reveal that carbon allocation is involved in adaptation in the early developmental stage. Proteomics 2010, 10, 2605–2619. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Pan, D.; Li, J.; Tan, F.; Hoffmann-Benning, S.; Liang, W.; Chen, W. Proteomic analysis of changes in the Kandelia candel chloroplast proteins reveals pathways associated with salt tolerance. Plant Sci. 2015, 231, 159–172. [Google Scholar] [CrossRef] [PubMed]
- Behrens, C.; Blume, C.; Senkler, M.; Eubel, H.; Peterhänsel, C.; Braun, H.-P. The “protein complex proteome” of chloroplasts in Arabidopsis thaliana. J. Proteom. 2013, 91, 73–83. [Google Scholar] [CrossRef] [PubMed]
- Van Wijk, KJ.; Baginsky, S. Plastid proteomics in higher plants: Current state and future goals. Plant Physiol. 2011, 155, 1578–1588. [Google Scholar] [CrossRef] [PubMed]
- Liska, AJ.; Shevchenko, A. Expanding the organismal scope of proteomics: Cross-species protein identification by mass spectrometry and its implications. Proteomics 2003, 3, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Carpentier, S.C.; Panis, B.; Vertommen, A.; Swennen, R.; Sergeant, K.; Renaut, J.; Laukens, K.; Witters, E.; Samyn, B.; Devreese, B. Proteome analysis of non-model plants: A challenging but powerful approach. Mass Spectrom. Rev. 2008, 27, 354–377. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Huang, J.; Wang, R. Change law of hyperspectral data in related with chlorophyll and carotenoid in rice at different developmental stages. Rice Sci. 2004, 11, 274–282. [Google Scholar]
- Xu, S.; Chen, W.; Huang, Y.; He, X. Responses of growth, photosynthesis and VOC emissions of Pinus tabulaeformis Carr. Exposure to elevated CO2 and/or elevated O3 in an urban area. Bull. Environ. Contam. Toxicol. 2012, 88, 443–448. [Google Scholar] [CrossRef] [PubMed]
- Diekmann, K.; Hodkinson, T.R.; Fricke, E.; Barth, S. An optimized chloroplast DNA extraction protocol for grasses (Poaceae) proves suitable for whole plastid genome sequencing and SNP detection. PLoS ONE 2008, 3, e2813. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, P.; Wang, X.; Kuang, T.; Li, Y. An efficient method for the extraction of chloroplast proteins compatible for 2-DE and MS analysis. Electrophoresis 2009, 30, 3024–3033. [Google Scholar] [CrossRef] [PubMed]
- Xiong, H.; Shen, H.; Zhang, L.; Zhang, Y.; Guo, X.; Wang, P.; Duan, P.; Ji, C.; Zhong, L.; Zhang, F.; et al. Comparative proteomic analysis for assessment of the ecological significance of maize and peanut intercropping. J. Proteom. 2013, 78, 447–460. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Ma, H.; Song, L.; Huang, Z.; Yang, Y.; Wang, S.; Wang, Z.; Tong, J.; Gu, W.; Ma, H.; Xiao, L. Comparative proteomic analysis reveals molecular mechanism of seedling roots of different salt tolerant soybean genotypes in responses to salinity stress. EuPA Open Proteom. 2014, 4, 40–57. [Google Scholar] [CrossRef]
- Horton, P.; Park, KJ.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.; Nakai, K. Wolf PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Cheng, H.; Cai, R.; Li, L.L.; Chang, J.; Zhu, J.; Zhang, F.X.; Chen, L.J.; Wang, Y.; Cheng, S.H. Molecular cloning and function analysis of an anthocyanidin synthase gene from Ginkgo biloba, and its expression in abiotic stress responses. Mol. Cells 2008, 26, 536–547. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Spot No.a | Accession No. (GI) b | Protein Name c | Species c | Exp kD/pI d | Theor kD/pI e | Score f | SC g | MP h | FC i | E j | Sub-CL k |
---|---|---|---|---|---|---|---|---|---|---|---|
Amino acid metabolism | |||||||||||
9708 | gi|356508448 | 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase-like | Glycine max | 66.2/6.88 | 89.1/6.41 | 59 | 4% | 2 | 1.80 | T | Chlo |
4026 | gi|563247 | Acetolactate synthase precursor | Xanthium sp. | 33.9/5.64 | 70.8/7.03 | 91 | 5% | 2 | 0.33 | C | Chlo |
0129 | gi|2493895 | Cysteine synthase | Citrullus lanatus | 35.1/4.78 | 34.5/6.25 | 79 | 7% | 2 | 2.06 | T | Cyto |
4115 | gi|99698 | Glutamate-ammonia ligase | Arabidopsis thaliana | 36.8/5.62 | 40.9/5.40 | 225 | 8% | 2 | 1.68 | T | Cyto |
2048 | gi|225432496 | Glutamine synthetase leaf isozyme, chloroplastic | Vitis vinifera | 34.1/5.26 | 48.3/7.57 | 114 | 4% | 1 | 0.18 | C | Chlo |
3048 | gi|121334 | Glutamine synthetase PR-1 | Phaseolus vulgaris | 25.1/5.44 | 39.3/5.78 | 117 | 4% | 2 | 0.28 | C | Cyto |
1049 | gi|357144704 | Glycerate dehydrogenase-like | Brachypodium distachyon | 19.9/4.61 | 42.2/6.68 | 64 | 5% | 1 | 5.37 | C | Chlo |
2046 | gi|288063 | Ketol-acid reductoisomerase | Arabidopsis thaliana | 33.6/5.29 | 64.3/6.55 | 112 | 5% | 2 | 0.18 | C | Chlo |
1054 | gi|1709006 | S-adenosylmethionine synthase 3 | Actinidia chinensis | 31.3/5.13 | 39.8/6.20 | 185 | 13% | 3 | 0.19 | C | Cyto |
2116 | gi|356505256 | S-adenosylmethionine synthase 3-like isoform 1 | Glycine max | 34.8/5.21 | 43.2/6.13 | 312 | 14% | 4 | 1.53 | T | Cyto |
5032 | gi|2821961 | Spermidine synthase | Arabidopsis thaliana | 33.3/5.81 | 32.7/4.97 | 82 | 11% | 3 | 2.03 | C | Chlo |
Biosynthesis of secondary metabolites | |||||||||||
2132 | gi|53830379 | Anthocyanidin reductase | Ginkgo biloba | 37.8/5.02 | 37.6/5.63 | 89 | 4% | 2 | 0.17 | C | Chlo |
2218 | gi|356566889 | LOW QUALITY PROTEIN: (+)-neomenthol dehydrogenase-like | Glycine max | 39.1/5.15 | 57.9/7.49 | 55 | 2% | 2 | 1.51 | T | Cyto |
1048 | gi|225380888 | GDP-d-mannose-3′,5′-epimerase | Malus domestica | 21.2/4.71 | 42.9/6.25 | 79 | 8% | 2 | 2.31 | C | Cyto |
2239 | gi|1170029 | Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic | Hordeum vulgare | 31.1/5.07 | 49.7/6.39 | 148 | 11% | 4 | 0.10 | C | Chlo |
Carbohydrate/Energy metabolism | |||||||||||
5031 | gi|344190186 | Enolase | Corylus heterophylla | 20.4/5.88 | 49.4/5.62 | 119 | 7% | 2 | 12.43 | C | Chlo |
2137 | gi|15221107 | Enolase 1 | Arabidopsis thaliana | 36.2/5.15 | 51.8/5.79 | 119 | 6% | 2 | 0.61 | C | Chlo |
7023 | gi|2982328 | Pyruvate dehydrogenase E1 β subunit | Picea mariana | 32.4/6.49 | 32.0/5.73 | 66 | 5% | 2 | 0.32 | C | Chlo |
4022 | gi|111660950 | ADP-glucose pyrophosphorylase small subunit | Citrus sinensis | 19.2/5.62 | 57.3/6.73 | 171 | 7% | 3 | 2.31 | C | Chlo |
3841 | gi|228210 | Granule-bound starch synthase | Solanum tuberosum | 80.9/5.32 | 67.1/6.92 | 138 | 2% | 1 | 0.32 | C | Chlo |
3049 | gi|15223331 | Granule-bound starch synthase 1 | Arabidopsis thaliana | 24.4/5.34 | 67.5/8.76 | 175 | 5% | 2 | 0.31 | C | Chlo |
0740 | gi|17939849 | Mitochondrial F1 ATP synthase β subunit | Arabidopsis thaliana | 66.3/4.82 | 63.6/6.52 | 308 | 13% | 5 | 1.80 | C | Cyto |
2133 | gi|351767989 | Myo-inositol-1-phosphate synthase | Triticum aestivum | 39.1/5.08 | 56.3/5.64 | 67 | 4% | 2 | 0.30 | C | Cyto |
1025 | gi|115440691 | Os01g0817700 | Oryza sativa Japonica Group | 35.2/4.66 | 61.0/5.42 | 134 | 4% | 3 | 0.62 | T | Cyto |
4029 | gi|356567630 | 2-methylene-furan-3-one reductase | Glycine max | 34.1/5.64 | 42.0/8.96 | 337 | 10% | 4 | 0.11 | C | Chlo |
3056 | gi|255544584 | phosphoglycerate kinase, chloroplastic | Glycine max | 35.1/5.23 | 50.1/8.74 | 293 | 13% | 4 | 0.12 | C | Chlo |
3051 | gi|1172159 | Starch synthase | Ipomoea batatas | 21.8/5.48 | 67.9/7.47 | 171 | 13% | 5 | 0.26 | C | Chlo |
Carbon fixation in photosynthetic organisms | |||||||||||
0218 | gi|118175929 | Chloroplast sedoheptulose-1,7-bisphosphatase | Morus alba var. multicaulis | 43.2/4.73 | 42.8/6.06 | 92 | 7% | 2 | 0.63 | C | Chlo |
2129 | gi|120664 | Glyceraldehyde-3-phosphate dehydrogenase B, chloroplastic | Spinacia oleracea | 35.4/5.11 | 48.6/6.72 | 140 | 6% | 2 | 0.58 | C | Chlo |
3050 | gi|15223484 | Phosphoglycerate kinase | Arabidopsis thaliana | 23.7/5.32 | 50.0/8.27 | 398 | 12% | 5 | 0.62 | C | Chlo |
2522 | gi|132000 | Ribulose bisphosphate carboxylase large chain | Nicotiana acuminata | 53.2/5.09 | 53.4/6.41 | 322 | 6% | 3 | 0.64 | T | Cyto |
3047 | gi|1006698 | Rubisco subunit binding protein, β subunit | Pseudotsuga menziesii | 19.2/5.31 | 9.7/4.37 | 151 | 18% | 1 | 9.31 | C | Chlo |
1024 | gi|161777955 | Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit | Luculia pinceana | 42.8/4.89 | 52.2/6.17 | 171 | 7% | 2 | 3.16 | T | Chlo |
2216 | gi|161777955 | Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit | Luculia pinceana | 40.8/5.18 | 52.2/6.17 | 238 | 7% | 3 | 2.10 | T | Chlo |
2047 | gi|12098 | Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit | Afrocarpus falcatus | 34.9/5.29 | 53.1/5.91 | 121 | 3% | 2 | 0.21 | C | Chlo |
0223 | gi|337263422 | Chloroplast rubisco activase | Ophiopogon japonicus | 40.5/4.46 | 48.0/6.04 | 87 | 3% | 1 | 5.05 | C | Chlo |
0021 | gi|10720249 | Rubisco activase | Vigna radiata var. radiata | 33.4/4.51 | 48.0/7.57 | 177 | 13% | 4 | 1.79 | T | Chlo |
5144 | gi|4261547 | Rubisco activase | Spinacia oleracea | 40.6/6.06 | 47.8/7.67 | 141 | 3% | 1 | 2.08 | C | Chlo |
2627 | gi|170129 | Rubisco activase precursor | Spinacia oleracea | 59.1/5.03 | 51.7/6.28 | 171 | 5% | 2 | 0.61 | T | Chlo |
2646 | gi|170129 | Rubisco activase precursor | Spinacia oleracea | 55.2/5.22 | 51.7/6.28 | 93 | 3% | 1 | 0.20 | C | Chlo |
2651 | gi|170129 | Rubisco activase precursor | Spinacia oleracea | 55.2/5.32 | 51.7/6.28 | 167 | 5% | 2 | 0.25 | C | Chlo |
0561 | gi|170129 | Rubisco activase precursor | Spinacia oleracea | 52.8/4.86 | 51.7/6.28 | 160 | 5% | 2 | 7.04 | C | Chlo |
1122 | gi|255541252 | Transketolase, putative | Ricinus communis | 38.8/5.01 | 81.6/6.52 | 199 | 8% | 5 | 1.55 | T | Chlo |
Cellular process | |||||||||||
2339 | gi|20329 | Actin | Oryza sativa Indica Group | 44.2/5.09 | 42.2/5.72 | 81 | 4% | 1 | 0.48 | C | Cyto |
8221 | gi|227069391 | Actin 4 | Picea abies | 41.2/6.59 | 41.9/5.31 | 298 | 16% | 4 | 2.29 | T | Cyto |
3940 | gi|399213 | ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplastic | Solanum lycopersicum | 110.2/5.35 | 102.4/5.86 | 207 | 4% | 3 | 0.29 | C | Chlo |
3939 | gi|399213 | ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplastic | Solanum lycopersicum | 110.2/5.34 | 102.4/5.86 | 230 | 8% | 5 | 0.41 | C | Chlo |
4031 | gi|42561751 | ATP-dependent zinc metalloprotease FtsH 8 | Arabidopsis thaliana | 24.8/5.51 | 73.3/5.72 | 202 | 11% | 6 | 0.33 | C | Chlo |
2240 | gi|2492515 | ATP-dependent zinc metalloprotease FtsH, chloroplastic | Capsicum annuum | 30.2/5.29 | 71.2/6.55 | 131 | 11% | 4 | 0.41 | C | Chlo |
2130 | gi|728744 | Auxin-induced protein PCNT115 | Nicotiana tabacum | 35.2/5.03 | 34.3/7.10 | 120 | 9% | 3 | 0.35 | C | Nucl |
3055 | gi|6692685 | F12K11.22 | Arabidopsis thaliana | 30.2/5.42 | 71.0/5.81 | 248 | 12% | 6 | 0.16 | C | Chlo |
Lipid metabolism | |||||||||||
3026 | gi|210110834 | β-hydroxyacyl-ACP dehydrase 1 | Arachis hypogaea | 24.3/5.31 | 24.1/9.10 | 112 | 12% | 3 | 0.27 | T | Chlo |
0137 | gi|29367475 | Fibrillin-like protein | Oryza sativa Japonica Group | 35.3/4.65 | 33.9/5.04 | 126 | 6% | 3 | 2.02 | T | Chlo |
0322 | gi|339697596 | Stearoyl-ACP desaturase | Ginkgo biloba | 44.6/4.55 | 47.2/6.14 | 157 | 14% | 4 | 1.83 | C | Chlo |
Photosynthesis | |||||||||||
2134 | gi|380356155 | ATP synthase CF1 α chain (chloroplast) | Ginkgo biloba | 38.2/5.13 | 55.8/5.02 | 440 | 18% | 8 | 0.25 | C | Chlo |
3514 | gi|3913118 | ATP synthase subunit β, chloroplastic | Picea abies | 53.3/5.12 | 52.6/5.18 | 224 | 10% | 3 | 0.65 | T | Chlo |
2649 | gi|3913118 | ATP synthase subunit β, chloroplastic | Picea abies | 55.3/5.29 | 52.6/5.18 | 523 | 20% | 6 | 0.39 | C | Chlo |
6151 | gi|119904 | Nicotinamide adenine dinucleotide phosphate (NADP) reductase, leaf isozyme, chloroplastic | Pisum sativum | 37.4/6.09 | 40.5/8.56 | 119 | 6% | 1 | 4.41 | C | Chlo |
6152 | gi|119904 | NADP reductase, leaf isozyme, chloroplastic | Pisum sativum | 37.5/6.11 | 40.5/8.56 | 146 | 6% | 1 | 8.67 | C | Chlo |
1052 | gi|131390 | Oxygen-evolving enhancer protein 2, chloroplastic | Pisum sativum | 29.8/4.81 | 28.2/8.29 | 158 | 18% | 3 | 1.79 | C | Chlo |
1118 | gi|225423755 | Photosystem II stability/assembly factor HCF136, chloroplastic | Vitis vinifera | 36.1/5.09 | 44.5/6.92 | 370 | 19% | 6 | 0.50 | C | Chlo |
3024 | gi|351726724 | Rieske iron-sulphur protein precursor | Glycine max | 24.8/5.23 | 24.5/9.01 | 95 | 18% | 3 | 2.37 | T | Chlo |
Protein metabolism | |||||||||||
0641 | gi|15222729 | Chaperonin 60 subunit β 1 | Arabidopsis thaliana | 57.9/4.79 | 64.2/6.21 | 57 | 2% | 1 | 1.94 | C | Chlo |
6020 | gi|123601 | Heat shock 70 kDa protein | Glycine max | 31.3/5.71 | 71.3/5.37 | 415 | 10% | 6 | 2.49 | T | Cyto |
5033 | gi|585273 | Heat shock 70 kDa protein | Solanum tuberosum | 33.4/6.02 | 73.3/6.37 | 190 | 3% | 2 | 7.63 | C | Mito |
3719 | gi|357112870 | Heat shock cognate 70 kDa protein 2-like | Brachypodium distachyon | 66.7/5.45 | 71.6/5.09 | 259 | 10% | 5 | 1.51 | T | Cyto |
0846 | gi|357112870 | Heat shock cognate 70 kDa protein 2-like | Brachypodium distachyon | 70.2/4.49 | 71.6/5.09 | 355 | 11% | 6 | 2.26 | C | Cyto |
2628 | gi|24637539 | Heat shock protein 60 | Prunus dulcis | 58.8/5.04 | 58.1/5.26 | 102 | 5% | 2 | 0.66 | T | Cyto |
2848 | gi|166919370 | Chloroplast heat shock protein 70-1 | Ipomoea nil | 81.3/5.18 | 74.5/5.14 | 497 | 9% | 5 | 0.48 | C | Chlo |
2045 | gi|124245039 | Chloroplast heat shock protein 70 (HSP70) | Cucumis sativus | 35.1/5.26 | 75.5/5.18 | 721 | 16% | 10 | 0.34 | C | Chlo |
0039 | gi|242076604 | Hypothetical protein SORBIDRAFT_06g023840 | Sorghum bicolour | 19.3/4.55 | 85.3/5.42 | 151 | 8% | 4 | 7.75 | C | Chlo |
3023 | gi|224084924 | Proteasome subunit β type 3-2 family protein | Populus trichocarpa | 27.2/5.23 | 23.1/5.18 | 215 | 17% | 3 | 2.41 | T | Cyto |
0038 | gi|255576477 | Plastid-specific 30S ribosomal protein 3, chloroplast precursor | Ricinus communis | 19.8/4.41 | 20.4/7.79 | 116 | 11% | 3 | 4.20 | C | Chlo |
2042 | gi|13094963 | Initiation factor eIF5-A | Manihot esculenta | 18.5/5.09 | 17.8/5.60 | 73 | 10% | 2 | 0.54 | C | Nucl |
1119 | gi|402753 | Translation elongation factor EF-G | Glycine max | 37.1/5.12 | 77.9/5.04 | 69 | 4% | 2 | 0.35 | C | Chlo |
2135 | gi|218312 | chloroplast elongation factor TuB (EF-TuB) | Nicotiana sylvestris | 37.4/5.16 | 46.8/5.70 | 240 | 10% | 3 | 0.05 | C | Chlo |
Redox homeostasis | |||||||||||
4015 | gi|224091909 | 2-cys peroxiredoxin | Populus trichocarpa | 32.5/5.35 | 28.9/6.84 | 191 | 19% | 6 | 0.09 | T | Chlo |
1051 | gi|220898265 | Ascorbate peroxidase | Ginkgo biloba | 29.1/4.77 | 27.7/5.81 | 118 | 11% | 2 | 2.38 | C | Chlo |
0040 | gi|294861514 | Cytosolic ascorbate peroxidase 2 | Rubia cordifolia | 18.4/4.49 | 16.8/5.34 | 135 | 15% | 1 | 5.36 | C | Cyto |
0041 | gi|220898261 | FeSOD | Ginkgo biloba | 25.2/4.68 | 27.2/6.76 | 312 | 38% | 5 | 1.94 | C | Chlo |
1028 | gi|373842096 | Peroxiredoxin | Tamarix hispida | 19.8/4.74 | 17.6/6.08 | 83 | 10% | 1 | 0.43 | T | Cyto |
5015 | gi|45643751 | Copper-zinc superoxide dismutase | Citrullus lanatus | 20.2/5.75 | 15.1/5.05 | 120 | 17% | 2 | 1.53 | T | Cyto |
Unclassified | |||||||||||
2128 | gi|242079005 | Hypothetical protein SORBIDRAFT_07g019320 | Sorghum bicolour | 35.5/5.09 | 46.7/4.83 | 195 | 8% | 2 | 0.33 | C | Chlo |
4014 | gi|297720697 | Os01g0915900 | Oryza sativa Japonica Group | 26.6/5.74 | 28.3/8.75 | 57 | 8% | 1 | 1.71 | T | Nucl |
5019 | gi|224143607 | Predicted protein | Populus trichocarpa | 32.1/5.71 | 31.8/5.26 | 262 | 18% | 4 | 1.53 | T | Chlo |
6117 | gi|224080984 | Predicted protein | Populus trichocarpa | 34.9/5.62 | 42.5/5.69 | 113 | 15% | 5 | 0.66 | T | Chlo |
1227 | gi|116791600 | Unknown | Picea sitchensis | 40.9/5.05 | 21.0/8.48 | 143 | 7% | 2 | 1.51 | T | Cyto |
1327 | gi|116787373 | Unknown | Picea sitchensis | 44.9/4.86 | 65.8/5.69 | 159 | 7% | 3 | 0.63 | C | Chlo |
0642 | gi|148909901 | Unknown | Picea sitchensis | 57.6/4.59 | 63.4/5.12 | 118 | 5% | 2 | 2.29 | C | Chlo |
Gene | Primer Forward Sequence (5′–3′) | Primer Reverse Sequence (5′–3′) |
---|---|---|
GAPDH | GGTGCCAAAAAGGTGGTCAT | CAACAACGAACATGGGAGCAT |
SPDS | ACATCTTCCACTTTGCTCTATTCCA | CGAGGGTCTTCATAGCCTACTGC |
HSP70 | ACTCAGAAGGGGCACGAACA | AAATCGCCTTCCTATCAACCG |
PSRP3 | TCATTGCCCACTTCATCCGC | CGCTCACTTCCTCTTCTGCTGC |
atpA | TTATTGGGGACAGGCAGACCG | GGAGCGAGATATTGTAATGTAGCG |
GSA | TGGCATCACTCCAGACCTTACA | GCAACCATCTCCATTATCTCCC |
CD4B | AAGGCAGCCACAAATAGAACGG | CAAGACCCTCAGCAATAGCCG |
EF-Tu | ATTTCCTGGAGACGATGTGCC | TCAGTCTGTCTCCGAGGAATGG |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Yu, W.; Wang, G.; Cao, F.; Cai, J.; Wang, H. Comparative Proteomic and Physiological Analysis Reveals the Variation Mechanisms of Leaf Coloration and Carbon Fixation in a Xantha Mutant of Ginkgo biloba L. Int. J. Mol. Sci. 2016, 17, 1794. https://doi.org/10.3390/ijms17111794
Liu X, Yu W, Wang G, Cao F, Cai J, Wang H. Comparative Proteomic and Physiological Analysis Reveals the Variation Mechanisms of Leaf Coloration and Carbon Fixation in a Xantha Mutant of Ginkgo biloba L. International Journal of Molecular Sciences. 2016; 17(11):1794. https://doi.org/10.3390/ijms17111794
Chicago/Turabian StyleLiu, Xinliang, Wanwen Yu, Guibin Wang, Fuliang Cao, Jinfeng Cai, and Huanli Wang. 2016. "Comparative Proteomic and Physiological Analysis Reveals the Variation Mechanisms of Leaf Coloration and Carbon Fixation in a Xantha Mutant of Ginkgo biloba L." International Journal of Molecular Sciences 17, no. 11: 1794. https://doi.org/10.3390/ijms17111794
APA StyleLiu, X., Yu, W., Wang, G., Cao, F., Cai, J., & Wang, H. (2016). Comparative Proteomic and Physiological Analysis Reveals the Variation Mechanisms of Leaf Coloration and Carbon Fixation in a Xantha Mutant of Ginkgo biloba L. International Journal of Molecular Sciences, 17(11), 1794. https://doi.org/10.3390/ijms17111794