Identification and Characterization of Reference Genes for Normalizing Expression Data from Red Swamp Crawfish Procambarus clarkii
Abstract
:1. Introduction
2. Results
2.1. Primer Specificity and Amplification Efficiency
| Gene | Primer Sequence (5ʹ–3ʹ) | Length (bp) | PCR Efficiency (%) | Correlation Coefficient (R2) | Genbank Accession No. |
|---|---|---|---|---|---|
| ACTB | F: ATTGCAGACAGGATGCAGAA R: GAAAGGGAAGCCAAGATGG | 125 | 98.5 | 0.998 | KR135165 |
| GAPDH | F: GCCCAGAACATCATCCCATCT R:CGTCATCCTCAGTGTAACCCAAG | 235 | 96.0 | 0.997 | AB094145 |
| EF-1α | F: CCACAAAGGCAGGTGAAAAGG R: ATTGGGTGAACCAAGCAGGG | 110 | 100.6 | 0.998 | KR135166 |
| UB | F: TCCAGCCTCTCCTGCCTT R: CCTTCCTTATCCTGAATCTTTGCC | 172 | 103.6 | 0.997 | KR135167 |
| TUB | F: CCACTTCCCTCTCGTCACC R: AACAGCACGCCATGTACTTT | 155 | 103.5 | 0.992 | KR135168 |
| TBP | F: AAGGAAATACGCTCGGATTG R: CTGGCTGTGAGTGAGGACAA | 136 | 100.1 | 0.997 | KR135169 |
| EIF | F: GGAATAAGGGGACGAAGACC R: GCAAACACACGCTGGGAT | 126 | 98.9 | 0.997 | KR135170 |
| 18S | F: TCCGCATCACACTCACGT R: TGGAACCCTCTCCACAGG | 165 | 100.6 | 0.997 | KR135172 |
| Vg | F: CCAGAAGACGCCACAAGAA R: CAGAAGGCATCAGCCAATC | 170 | 99.4 | 0.999 | KR135171 |
| Pcna | F: AGAGGCGGACTGAAGAGG R: TTGATGGCATCCAGCACT | 133 | 100.6 | 0.995 | KR135173 |
2.2. Cycle Threshold (Ct) Values of Reference Genes

2.3. Stability Analysis of Reference Genes

| Rank | Method | |||||
|---|---|---|---|---|---|---|
| geNorm | NormFinder | BestKeeper | Comprehensive Ranking | |||
| Different tissues | 1 | EIF/18S | EIF | 18S | EIF | |
| 2 | 18S | EIF | 18S | |||
| 3 | UB | GAPDH | UB | UB | ||
| 4 | ACTB | UB | TUB | GAPDH | ||
| 5 | TBP | TUB | GAPDH | ACTB | ||
| 6 | TUB | ACTB | ACTB | TUB | ||
| 7 | GAPDH | TBP | TBP | TBP | ||
| 8 | EF-1α | EF-1α | EF-1α | EF-1α | ||
| Different ovarian developmental stages | 1 | TBP/EIF | TBP/EIF | TUB | TBP | |
| 2 | ACTB | EIF | ||||
| 3 | GAPDH | GAPDH | 18S | 18S | ||
| 4 | 18S | 18S | TBP | TUB/GAPDH | ||
| 5 | ACTB | ACTB | EIF | |||
| 6 | TUB | TUB | GAPDH | ACTB | ||
| 7 | UB | UB | UB | UB | ||
| 8 | EF-1α | EF-1α | EF-1α | EF-1α | ||

| Statistical Parameter | Reference Gene | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| ACTB | GAPDH | EF-1α | UB | TUB | TBP | EIF | 18S | ||
| Different tissues | GM [Ct] | 17.95 | 18.98 | 22.54 | 19.41 | 22.60 | 26.10 | 21.13 | 18.47 |
| AM [Ct] | 18.06 | 19.10 | 22.96 | 19.48 | 22.69 | 26.21 | 21.17 | 18.51 | |
| Min [Ct] | 15.43 | 15.36 | 16.31 | 16.84 | 19.50 | 21.86 | 19.44 | 16.49 | |
| Max [Ct] | 22.03 | 22.03 | 30.05 | 22.42 | 26.74 | 30.48 | 24.13 | 20.42 | |
| SD [±Ct] | 1.87 | 1.86 | 3.71 | 1.38 | 1.71 | 1.96 | 1.08 | 0.94 | |
| CV [%Ct] | 10.35 | 9.75 | 16.17 | 7.09 | 7.53 | 7.49 | 5.11 | 5.10 | |
| Different ovarian developmental stages | GM [Ct] | 15.96 | 17.33 | 27.21 | 20.14 | 20.89 | 21.74 | 19.70 | 18.65 |
| AM [Ct] | 15.97 | 17.36 | 27.37 | 20.18 | 20.90 | 21.75 | 19.72 | 18.66 | |
| Min [Ct] | 15.11 | 15.73 | 21.65 | 18.41 | 20.03 | 20.53 | 18.24 | 17.63 | |
| Max [Ct] | 16.94 | 18.84 | 30.04 | 22.32 | 21.52 | 22.78 | 20.97 | 19.41 | |
| SD [±Ct] | 0.47 | 0.90 | 2.29 | 0.94 | 0.33 | 0.64 | 0.74 | 0.51 | |
| CV [%Ct] | 2.95 | 5.18 | 8.38 | 4.66 | 1.56 | 2.95 | 3.77 | 2.74 | |

2.4. Validation of the Usefulness of the Selected Reference Genes


3. Discussion
4. Experimental Section
4.1. Crawfish Tissue Sample Collection
4.2. RNA Extraction and Reverse Transcription
4.3. Reference Gene Selection and Primer Design
| Abbreviation | Gene Name | Gene Function |
|---|---|---|
| ACTB | β-Actin | Cytoskeletal structural protein |
| GAPDH | Glyceraldehyde-3-phosphate Dehydrogenase | Oxidoreductase in glycolysis and gluconeogenesis |
| EF-1α | Elongation factor-1α | Protein biosynthesis |
| UB | Ubiquitin | Protein degradation |
| TUB | β-Tubulin | Cytoskeletal structural protein |
| TBP | TATA-binding protein | RNA polymerase transcription factor |
| EIF | Eukaryotic translation initiation factor 5A | Protein synthesis |
| 18S | 18S ribosomal RNA | Ribosome subunit |
4.4. Quantitative Real-Time PCR
4.5. Analysis of Gene Expression Stability
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Hobbs, H.H.; Huner, J.V. A review of global crayfish introductions with particular emphasis on two north American species (Decapoda, Cambaridae). Crustaceana 1989, 56, 299–316. [Google Scholar] [CrossRef]
- Huner, J.V.; Lindqvist, O.V.; Könönen, H. Comparison of morphology and edible tissues of two important commercial crayfishes, the noble crayfish, Astacus astacus Linné, and the red swamp crayfish, Procambarus clarkii (Girard) (Decapoda, Astacidae and Cambaridae). Aquaculture 1988, 68, 45–57. [Google Scholar] [CrossRef]
- Huner, J.V. Procambarus in north America and elsewhere. In Freshwater Crayfish: Biology, Management and Exploitation; Holdich, D.M., Lowery, R.S., Eds.; Croom Helm: London, UK, 1988. [Google Scholar]
- Yue, G.H.; Li, J.L.; Bai, Z.Y.; Wang, C.M.; Feng, F. Genetic diversity and population structure of the invasive alien red swamp crayfish. Biol. Invasions 2010, 12, 2697–2706. [Google Scholar] [CrossRef]
- Li, J.L.; Dong, Z.G.; Li, Y.S.; Wang, C.H. Invasive Aquatic Species in China; Shanghai Science and Technology Publisher: Shanghai, China, 2007. [Google Scholar]
- Bureau of Fisheries of Ministry of Agriculture, PRC. China Fishery Statistical Yearbook 2013; China Agriculture Press: Beijing, China, 2013.
- Food and Agriculture Organization of the United Nations. Fishery and Aquaculture Statistics Yearbook 2012; Food and Agriculture Department of the United Nations: Rome, Italy, 2014. [Google Scholar]
- Ando, H.; Makioka, T. Structure of the ovary and mode of oogenesis in a freshwater crayfish, Procambarus clarkii (Girard). Zool. Sci. 1998, 15, 893–901. [Google Scholar] [CrossRef]
- Quackenbush, S.L. Lobster Reproduction: A Review. Crustaceana 1994, 67, 82–94. [Google Scholar] [CrossRef]
- Sánchez, F.; Smitz, J. Molecular control of oogenesis. BBA-Mol. Basis Dis. 2012, 1822, 1896–1912. [Google Scholar] [CrossRef] [PubMed]
- Hudson, A.M.; Cooley, L. Methods for studying oogenesis. Methods 2014, 68, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Ravi, R.; Manisseri, M.K.; Sanil, N.K. Ovarian maturation and oogenesis in the blue swimmer crab, Portunus pelagicus (Decapoda: Portunidae). Acta Zool. 2013, 94, 291–299. [Google Scholar] [CrossRef]
- Bustin, S.A. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problems. J. Mol. Endocrinol. 2002, 29, 4021–4022. [Google Scholar] [CrossRef]
- Valasek, M.A.; Repa, J J. The power of real-time PCR. Adv. Physiol. Educ. 2005, 29, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Ginzinger, D.G. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 2002, 30, 503–512. [Google Scholar] [CrossRef]
- Thellin, O.; Zorzi, W.; Lakaye, B.; Borman, D.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping genes as internal standards: Use and limits. J. Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef]
- Shekhar, M.S.; Kiruthika, J.; Ponniah, A.G. Identification and expression analysis of differentially expressed genes from shrimp (Penaeus monodon) in response to low salinity stress. Fish Shellfish Immun. 2013, 35, 1957–1968. [Google Scholar] [CrossRef] [PubMed]
- Phinyo, M.; Visudtiphole, V.; Roytrakul, S.; Phaonakrop, N.; Jarayabhand, P.; Klinbunga, S. Characterization and expression of cell division cycle 2 (Cdc2) mRNA and protein during ovarian development of the giant tiger shrimp Penaeus monodon. Gen. Comp. Endocr. 2013, 193, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Gillen, C.M.; Wheatly, M.G. Molecular characterization of the sarcoplasmic calcium-binding protein (SCP) from crayfish Procambarus clarkii. Comp. Biochem. Phys. B 2006, 144, 477–487. [Google Scholar] [CrossRef] [PubMed]
- Underwood, D.J.; Cowley, J.A.; Sellars, M.J.; Barnes, A.C.; Hulten, M.C.W.V.; Johnson, K.N. Gill-associated virus and recombinant protein vaccination in Penaeus monodon. Aquaculture 2010, 308, 82–88. [Google Scholar] [CrossRef]
- Jelena, N.; Gordana, M.; Ivana, E.; Nikola, T. Gene expression studies: How to obtain accurate and reliable data by quantitative Real-Time RT-PCR. J. Med. Biochem. 2013, 32, 325–338. [Google Scholar]
- Gao, J.; Wang, X.W.; Zou, Z.H.; Jia, X.L.; Wang, Y.L.; Zhang, Z.P. Transcriptome analysis of the differences in gene expression between testis and ovary in green mud crab (Scylla paramamosain). BMC Genom. 2014, 15, 317–323. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.; Hu, Y.; Ma, Y.; Zhou, X.; Xu, Z.; Shui, Y.; Li, C.; Xu, P.; Sun, X. In-depth transcriptome analysis of the red swamp crayfish Procambarus clarkii. PLoS ONE 2014, 9, 110548. [Google Scholar] [CrossRef] [PubMed]
- Zou, Z.H.; Zhang, Z.P.; Wang, Y.L.; Han, K.H.; Fu, M.J.; Lin, P.; Jia, X.W. EST analysis on the gonad development related organs and microarray screen for differentially expressed genes in mature ovary and testis of Scylla paramamosain. Comp. Biochem. Phys. B 2011, 6, 150–157. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Wang, Q.; Jin, X.; Wang, Y.; Chen, L.; Liu, L. Transcriptome Profiling of Testis during Sexual Maturation Stages in Eriocheir sinensis Using Illumina Sequencing. PLoS ONE 2012, 7, 33735. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.C.; Xing, Z.J.; Lu, W.; Qian, Z.J.; Yu, H.W.; Li, J.L. Transcriptome analysis of red swamp crawfish Procambarus clarkii reveals genes involved in gonadal development. PLoS ONE 2014, 9, 105122. [Google Scholar] [CrossRef] [PubMed]
- D'haene, B.; Vandesompele, J.; Hellemans, J. Accurate and objective copy number profiling using real-time quantitative PCR. Methods 2010, 50, 262–270. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-pcr data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excelbased tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.H. The Quantitative Examination of Vitellogenin mRNA in the Marsupenaeus japonicus and Procambarus clarkii. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2014. [Google Scholar]
- Li, Y.Y.; Cai, S.L.; Liu, H. Quantitative analysis of vitellogenin mRNA expression in Litopenaeus vannamei and Macrobrachium rosenbergii. J. Fish. China 2012, 36, 1667–1674. [Google Scholar] [CrossRef]
- Prelich, G.; Tan, C.K.; Kostura, M.; Mathews, M.B.; So, A.G.; Downey, K.M.; Stillman, B. Functional identity of proliferating cell nuclear antigen and a DNA polymerase-auxiliary protein. Nature 1987, 326, 517–520. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.S.; Wang, B.; Li, F.H.; Jiang, H.; Xiang, J.H. Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis. Comp. Biochem. Phys. B 2008, 151, 225–229. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.P.; Shen, B.L.; Wang, Y.L.; Chen, Y.; Wang, G.D.; Lin, P.; Zou, Z.H. Molecular cloning of proliferating cell nuclear antigen and Its differential expression analysis in the developing ovary and testis of penaeid shrimp Marsupenaeus japonicus. DNA Cell Biol. 2010, 29, 163–170. [Google Scholar] [CrossRef] [PubMed]
- Muller, P.Y.; Janovjak, H.; Miserez, A.R.; Dobbie, Z. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 2002, 32, 1372–1379. [Google Scholar] [PubMed]
- Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.A.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.J.; Dai, Z.M.; Liu, J.; Yang, W.J. Actin gene in prawn, Macrobrachium rosenbergii, characteristics and differential tissue expression during embryonic development. Comp. Biochem. Phys. B 2005, 140, 599–605. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Li, X.P.; Chen, W.X.; Chen, J.Y.; Lu, W.J.; Chen, L.; Fu, D.W. Evaluation of New Reference Genes in Papaya for Accurate Transcript Normalization under Different Experimental Conditions. PLoS ONE 2012, 7, 44405. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.Y.; Qian, Y.; Li, X.; Ning, X.H.; Wang, J.; Zou, J.J.; Zhang, L.L.; Wang, S.; Hu, J.J.; Hu, X.L. Identification of reference genes for qRT-PCR analysis in Yesso Scallop Patinopecten yessoensis. PLoS ONE 2013, 8, 75609. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Guo, W.; Gao, Y.; Tang, R.; Li, D.P. Reference gene selection for real-time RT-PCR normalization in rice field eel (Monopterus albus) during gonad development. Fish Physiol. Biochem. 2014, 40, 1721–1730. [Google Scholar] [CrossRef] [PubMed]
- Qin, F.; Wang, L.H.; Liu, S.Z.; Wang, Z.Z. Characterization of reference genes in rare minnow, Gobiocypris rarus, in early postembryonic development and in response to edcs treatment. Acta Ichthyol. Piscat. 2013, 43, 127–138. [Google Scholar] [CrossRef]
- Leelatanawit, R.; Klanchui, A.; Uawisetwathana, U.; Karoonuthaisiri, N. Validation of reference genes for real-time PCR of reproductive system in the black tiger shrimp. PLoS ONE 2012, 7, 52677. [Google Scholar] [CrossRef] [PubMed]
- Dhar, A.K.; Bowers, R.M.; Licon, K.S.; Veazey, G.; Read, B. Validation of reference genes for quantitative measurement of immune gene expression in shrimp. Mol. Immunol. 2009, 46, 1688–1695. [Google Scholar] [CrossRef] [PubMed]
- Subramoniam, T. Mechanisms and control of vitellogenesis in crustaceans. Fish. Sci. 2011, 77, 1–21. [Google Scholar] [CrossRef]
- Gong, Z.K.; Wang, S.J.; Huang, Y.Q.; Zhao, R.Q.; Zhu, Q.F.; Lin, W.Z. Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development. Mol. Genet. Genom. 2014, 289, 1157–1169. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zhao, W.X. Structural changes of mandibular organ during the 0vary developing cycle in crayfish. J. Shanghai Fish. Univ. 1999, 8, 12–18. [Google Scholar]
- Chang, C.F.; Lee, F.Y.; Huang, Y.S.; Hong, T.H. Purification and characterization of the female-specific protein (vitellogenin) in mature female hemolymph of the prawn, Penaeus monodon. Invertebr. Reprod. Dev. 2011, 25, 185–191. [Google Scholar] [CrossRef]
- Singh, V.K.; Mangalam, A.K.; Dwivedi, S.; Naik, S. Primer premier: Program for design of degenerate primers from a protein sequence. Biotechniques 1998, 24, 318–319. [Google Scholar] [PubMed]
- Wass, J.A. SigmaPlot 11: Now with total sigmastat integration. J. Sci. Comput. 2009, 26, 21. [Google Scholar]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, H.; Qian, Z.; Lu, W.; Ding, H.; Yu, H.; Wang, H.; Li, J. Identification and Characterization of Reference Genes for Normalizing Expression Data from Red Swamp Crawfish Procambarus clarkii. Int. J. Mol. Sci. 2015, 16, 21591-21605. https://doi.org/10.3390/ijms160921591
Jiang H, Qian Z, Lu W, Ding H, Yu H, Wang H, Li J. Identification and Characterization of Reference Genes for Normalizing Expression Data from Red Swamp Crawfish Procambarus clarkii. International Journal of Molecular Sciences. 2015; 16(9):21591-21605. https://doi.org/10.3390/ijms160921591
Chicago/Turabian StyleJiang, Hucheng, Zhaojun Qian, Wei Lu, Huaiyu Ding, Hongwei Yu, Hui Wang, and Jiale Li. 2015. "Identification and Characterization of Reference Genes for Normalizing Expression Data from Red Swamp Crawfish Procambarus clarkii" International Journal of Molecular Sciences 16, no. 9: 21591-21605. https://doi.org/10.3390/ijms160921591
APA StyleJiang, H., Qian, Z., Lu, W., Ding, H., Yu, H., Wang, H., & Li, J. (2015). Identification and Characterization of Reference Genes for Normalizing Expression Data from Red Swamp Crawfish Procambarus clarkii. International Journal of Molecular Sciences, 16(9), 21591-21605. https://doi.org/10.3390/ijms160921591
