Effect of APE1 T2197G (Asp148Glu) Polymorphism on APE1, XRCC1, PARP1 and OGG1 Expression in Patients with Colorectal Cancer
Abstract
:1. Introduction
2. Results
2.1. Patient Population
Characteristic | Number of Patients (%) | |
---|---|---|
Gender | Male | 23/49 (47%) |
Female | 26/49 (53%) | |
Age | 41–62 years | 14/49 (29%) |
>63 years | 35/49 (71%) | |
Location | Colon | 17 (35%) |
Rectum | 32 (65%) | |
Invasion | No | 17 (35%) |
Yes | 32 (65%) | |
TNM Classification | I and II | 19 (39%) |
III and IV | 30 (61%) | |
Genotype | TT | 13/49 (27%) |
TG | 26/49 (53%) | |
GG | 10/49 (20%) |
2.2. APE1 Genotyping and Expression
Characteristic | APE1 | |||
---|---|---|---|---|
TT | TG | GG | ||
Age | 41–62 years | 22% | 51% | 27% |
>63 years | 33% | 56% | 11% | |
Location | Colon | 16% | 68% | 16% |
Rectum | 40% | 45% | 15% | |
Invasion | No | 21% | 51% | 28% |
Yes | 29% | 58% | 13% | |
TNM Classification | I and II | 40% | 20% | 40% |
III and IV | 28% | 62% | 10% |
Characteristic | APE1 | OGG1 | PARP-1 | XRCC1 | |
---|---|---|---|---|---|
Fold induction | Tumor/normal | 0.83 ± 0.13 | 0.28 ± 0.12 ‡ | 1.35 ± 0.12 | 2.54 ± 1.06 ‡ |
Location | Colon | 1.09 ± 0.38 | 0.31 ± 0.07 | 1.70 ± 0.31 | 2.25 ± 1.63 |
Rectum | 0.48 ± 0.02 * | 0.17 ± 0.02 * | 0.82 ± 0.06 * | 2.37 ± 0.68 | |
Invasion | Yes | 0.73 ± 0.20 | 0.24 ± 0.04 | 1.22 ± 0.49 | 2.59 ± 0.96 |
No | 0.71 ± 0.10 | 0.29 ± 0.09 | 0.89 ± 0.06 | 2.47 ± 0.60 | |
TNM Classification | I and II | 1.31 ± 0.24 | 0.49 ± 0.12 | 1.98 ± 0.35 | 3.18 ± 1.26 |
III and IV | 0.61 ± 0.09 * | 0.16 ± 0.08 * | 0.90 ± 0.10 * | 2.29 ± 0.50 | |
APE1 Genotype | TT | 1.24 ± 0.25 | 3.35 ± 1.43 | 1.81 ± 0.36 | 0.45 ± 0.10 |
TG | 1.02 ± 0.10 | 3.19 ± 1.01 | 1.82 ± 0.50 | 0.43 ± 0.15 | |
GG | 0.39 ± 0.09 φφ | 1.72 ± 0.40 φ | 0.50 ± 0.10 φφ | 0.31 ± 0.09 |
3. Discussion
4. Experimental Section
4.1. Patients
4.2. RNA Extraction and Real-Time PCR
Gene | Sequence (5'–3') |
---|---|
APE1 | CTGCTCTTGGAATGTGGATG |
TTTGGTCTCTTGAAGGCACA | |
PARP1 | TAGCTGATGGCATGGTGTTC |
GACGTCCCCAGTGCAGTAAT | |
OGG1 | CCTGTGGGGACCTTATGCT |
CCTTTGGAACCCTTTCTGC | |
XRCC1 | GTTCCAGCAGTGAGGAGGAT |
GTGGGCTTGGTTTTGGTCT | |
18S | CGCGGTTCTATTTTGTTGGT |
CGGTCCAAGAATTTCACCTC |
4.3. DNA Extraction and APE1 Asp148Glu Polymorphism
4.4. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Jemal, A.; Bray, F.; Center, M.M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA Cancer J. Clin. 2011, 61, 69–90. [Google Scholar] [PubMed]
- Cummings, O.W. Pathology of the adenoma-carcinoma sequence: From aberrant crypt focus to invasive carcinoma. Semin. Gastrointest. Dis. 2000, 11, 229–237. [Google Scholar] [PubMed]
- Fearon, E.R.; Vogelstein, B. A genetic model for colorectal tumorigenesis. Cell 1990, 61, 759–767. [Google Scholar]
- Shin, A.; Lee, K.M.; Ahn, B.; Park, C.G.; Noh, S.K.; Park, D.Y.; Ahn, S.H.; Yoo, K.Y.; Kang, D. Genotype-phenotype relationship between DNA repair gene genetic polymorphisms and DNA repair capacity. Asian Pac. J. Cancer Prev. 2008, 9, 501–505. [Google Scholar] [PubMed]
- Peterson, C.L.; Cote, J. Cellular machineries for chromosomal DNA repair. Genes Dev. 2004, 18, 602–616. [Google Scholar] [PubMed]
- Jagannathan, I.; Cole, H.A.; Hayes, J.J. Base excision repair in nucleosome substrates. Chromosome Res. 2006, 14, 27–37. [Google Scholar] [PubMed]
- Potter, J.D. Colorectal cancer: Molecules and populations. J. Natl. Cancer Inst. 1999, 91, 916–932. [Google Scholar] [PubMed]
- Slyskova, J.; Korenkova, V.; Collins, A.R.; Prochazka, P.; Vodickova, L.; Svec, J.; Lipska, L.; Levy, M.; Schneiderova, M.; Liska, V.; et al. Functional, genetic, and epigenetic aspects of base and nucleotide excision repair in colorectal carcinomas. Clin. Cancer Res. 2012, 18, 5878–5887. [Google Scholar]
- Schreiber, V.; Dantzer, F.; Ame, J.C.; de Murcia, G. Poly(ADP-ribose): Novel functions for an old molecule. Nat. Rev. Mol. Cell Biol. 2006, 7, 517–528. [Google Scholar] [PubMed]
- Grube, K.; Burkle, A. Poly(ADP-ribose) polymerase activity in mononuclear leukocytes of 13 mammalian species correlates with species-specific life span. Proc. Natl. Acad. Sci. USA 1992, 89, 11759–11763. [Google Scholar] [PubMed]
- Nosho, K.; Yamamoto, H.; Mikami, M.; Taniguchi, H.; Takahashi, T.; Adachi, Y.; Imamura, A.; Imai, K.; Shinomura, Y. Overexpression of poly(ADP-ribose) polymerase-1 (PARP-1) in the early stage of colorectal carcinogenesis. Eur. J. Cancer 2006, 42, 2374–2381. [Google Scholar] [PubMed]
- Solier, S.; Zhang, Y.W.; Ballestrero, A.; Pommier, Y.; Zoppoli, G. DNA damage response pathways and cell cycle checkpoints in colorectal cancer: Current concepts and future perspectives for targeted treatment. Curr. Cancer Drug Targets 2012, 12, 356–371. [Google Scholar] [PubMed]
- Whitehouse, C.J.; Taylor, R.M.; Thistlethwaite, A.; Zhang, H.; Karimi-Busheri, F.; Lasko, D.D.; Weinfeld, M.; Caldecott, K.W. XRCC1 stimulates human polynucleotide kinase activity at damaged DNA termini and accelerates DNA single-strand break repair. Cell 2001, 104, 107–117. [Google Scholar] [PubMed]
- Yu, J.; Mallon, M.A.; Zhang, W.; Freimuth, R.R.; Marsh, S.; Watson, M.A.; Goodfellow, P.J.; McLeod, H.L. DNA repair pathway profiling and microsatellite instability in colorectal cancer. Clin. Cancer Res. 2006, 12, 5104–5111. [Google Scholar] [PubMed]
- Cheng, K.C.; Cahill, D.S.; Kasai, H.; Nishimura, S.; Loeb, L.A. 8-hydroxyguanine, an abundant form of oxidative DNA damage, causes G----T and A----C substitutions. J. Biol. Chem. 1992, 267, 166–172. [Google Scholar] [PubMed]
- Paz-Elizur, T.; Sevilya, Z.; Leitner-Dagan, Y.; Elinger, D.; Roisman, L.C.; Livneh, Z. DNA repair of oxidative DNA damage in human carcinogenesis: Potential application for cancer risk assessment and prevention. Cancer Lett. 2008, 266, 60–72. [Google Scholar] [PubMed]
- Xanthoudakis, S.; Miao, G.; Wang, F.; Pan, Y.C.; Curran, T. Redox activation of fos-jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J. 1992, 11, 3323–3335. [Google Scholar] [PubMed]
- Moreno, V.; Gemignani, F.; Landi, S.; Gioia-Patricola, L.; Chabrier, A.; Blanco, I.; Gonzalez, S.; Guino, E.; Capella, G.; Canzian, F. Polymorphisms in genes of nucleotide and base excision repair: Risk and prognosis of colorectal cancer. Clin. Cancer Res. 2006, 12, 2101–2108. [Google Scholar] [PubMed]
- Pardini, B.; Naccarati, A.; Novotny, J.; Smerhovsky, Z.; Vodickova, L.; Polakova, V.; Hanova, M.; Slyskova, J.; Tulupova, E.; Kumar, R.; et al. DNA repair genetic polymorphisms and risk of colorectal cancer in the czech republic. Mutat. Res. 2008, 638, 146–153. [Google Scholar]
- Kasahara, M.; Osawa, K.; Yoshida, K.; Miyaishi, A.; Osawa, Y.; Inoue, N.; Tsutou, A.; Tabuchi, Y.; Tanaka, K.; Yamamoto, M.; et al. Association of mutyh gln324his and apex1 asp148glu with colorectal cancer and smoking in a japanese population. J. Exp. Clin. Cancer Res. 2008, 27, 49. [Google Scholar]
- Fisseler-Eckhoff, A. New TNM classification of malignant lung tumors 2009 from a pathology perspective. Pathologe 2009, 30, 193–199. [Google Scholar] [PubMed]
- Debunne, H.; Ceelen, W. Mucinous differentiation in colorectal cancer: Molecular, histological and clinical aspects. Acta Chir. Belg. 2013, 113, 385–390. [Google Scholar] [PubMed]
- Barresi, V.; Bonetti, L.R.; Ieni, A.; Branca, G.; Baron, L.; Tuccari, G. Histologic grading based on counting poorly differentiated clusters in preoperative biopsy predicts nodal involvement and ptnm stage in colorectal cancer patients. Hum. Pathol. 2014, 45, 268–275. [Google Scholar] [PubMed]
- Xi, T.; Jones, I.M.; Mohrenweiser, H.W. Many amino acid substitution variants identified in DNA repair genes during human population screenings are predicted to impact protein function. Genomics 2004, 83, 970–979. [Google Scholar] [PubMed]
- Jelonek, K.; Gdowicz-Klosok, A.; Pietrowska, M.; Borkowska, M.; Korfanty, J.; Rzeszowska-Wolny, J.; Widlak, P. Association between single-nucleotide polymorphisms of selected genes involved in the response to DNA damage and risk of colon, head and neck, and breast cancers in a polish population. J. Appl. Genet. 2010, 51, 343–352. [Google Scholar] [PubMed]
- Li, Y.; Li, S.; Wu, Z.; Hu, F.; Zhu, L.; Zhao, X.; Cui, B.; Dong, X.; Tian, S.; Wang, F.; et al. Polymorphisms in genes of APE1, PARP1, and XRCC1: Risk and prognosis of colorectal cancer in a northeast chinese population. Med. Oncol. 2013, 30, 505. [Google Scholar]
- Canbay, E.; Cakmakoglu, B.; Zeybek, U.; Sozen, S.; Cacina, C.; Gulluoglu, M.; Balik, E.; Bulut, T.; Yamaner, S.; Bugra, D. Association of ape1 and hogg1 polymorphisms with colorectal cancer risk in a turkish population. Curr. Med. Res. Opin. 2011, 27, 1295–1302. [Google Scholar] [PubMed]
- Silva-Fernandes, I.J.; da Silva, T.A.; Agnez-Lima, L.F.; Ferreira, M.V.; Rabenhorst, S.H. Helicobacter pylori genotype and polymorphisms in DNA repair enzymes: Where do they correlate in gastric cancer? J. Surg. Oncol. 2012, 106, 448–455. [Google Scholar] [CrossRef]
- Zhou, W.; Liu, G.; Miller, D.P.; Thurston, S.W.; Xu, L.L.; Wain, J.C.; Lynch, T.J.; Su, L.; Christiani, D.C. Gene-environment interaction for the ERCC2 polymorphisms and cumulative cigarette smoking exposure in lung cancer. Cancer Res. 2002, 62, 1377–1381. [Google Scholar] [PubMed]
- Sturgis, E.M.; Castillo, E.J.; Li, L.; Zheng, R.; Eicher, S.A.; Clayman, G.L.; Strom, S.S.; Spitz, M.R.; Wei, Q. Polymorphisms of DNA repair gene XRCC1 in squamous cell carcinoma of the head and neck. Carcinogenesis 1999, 20, 2125–2129. [Google Scholar] [PubMed]
- Hadi, M.Z.; Coleman, M.A.; Fidelis, K.; Mohrenweiser, H.W.; Wilson, D.M., 3rd. Functional characterization of ape1 variants identified in the human population. Nucleic Acids Res. 2000, 28, 3871–3879. [Google Scholar] [PubMed]
- Yu, H.; Zhao, H.; Wang, L.E.; Liu, Z.; Li, D.; Wei, Q. Correlation between base-excision repair gene polymorphisms and levels of in vitro bpde-induced DNA adducts in cultured peripheral blood lymphocytes. PLoS One 2012, 7. [Google Scholar] [CrossRef] [PubMed]
- Obtulowicz, T.; Swoboda, M.; Speina, E.; Gackowski, D.; Rozalski, R.; Siomek, A.; Janik, J.; Janowska, B.; Ciesla, J.M.; Jawien, A.; et al. Oxidative stress and 8-oxoguanine repair are enhanced in colon adenoma and carcinoma patients. Mutagenesis 2010, 25, 463–471. [Google Scholar]
- Saebo, M.; Skjelbred, C.F.; Nexo, B.A.; Wallin, H.; Hansteen, I.L.; Vogel, U.; Kure, E.H. Increased mrna expression levels of ERCC1, OGG1 and rai in colorectal adenomas and carcinomas. BMC Cancer 2006, 6, 208. [Google Scholar] [PubMed]
- Sulzyc-Bielicka, V.; Domagala, P.; Hybiak, J.; Majewicz-Broda, A.; Safranow, K.; Domagala, W. Colorectal cancers differ in respect of PARP-1 protein expression. Pol. J. Pathol. 2012, 63, 87–92. [Google Scholar] [PubMed]
- Tudek, B.; Speina, E. Oxidatively damaged DNA and its repair in colon carcinogenesis. Mutat. Res. 2012, 736, 82–92. [Google Scholar] [PubMed]
- Murakami, T.; Fujimoto, M.; Ohtsuki, M.; Nakagawa, H. Expression profiling of cancer-related genes in human keratinocytes following non-lethal ultraviolet b irradiation. J. Dermatol. Sci. 2001, 27, 121–129. [Google Scholar] [PubMed]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Santos, J.C.; Funck, A.; Silva-Fernandes, I.J.L.; Rabenhorst, S.H.B.; Martinez, C.A.R.; Ribeiro, M.L. Effect of APE1 T2197G (Asp148Glu) Polymorphism on APE1, XRCC1, PARP1 and OGG1 Expression in Patients with Colorectal Cancer. Int. J. Mol. Sci. 2014, 15, 17333-17343. https://doi.org/10.3390/ijms151017333
Santos JC, Funck A, Silva-Fernandes IJL, Rabenhorst SHB, Martinez CAR, Ribeiro ML. Effect of APE1 T2197G (Asp148Glu) Polymorphism on APE1, XRCC1, PARP1 and OGG1 Expression in Patients with Colorectal Cancer. International Journal of Molecular Sciences. 2014; 15(10):17333-17343. https://doi.org/10.3390/ijms151017333
Chicago/Turabian StyleSantos, Juliana C., Alexandre Funck, Isabelle J. L. Silva-Fernandes, Silvia H. B. Rabenhorst, Carlos A. R. Martinez, and Marcelo L. Ribeiro. 2014. "Effect of APE1 T2197G (Asp148Glu) Polymorphism on APE1, XRCC1, PARP1 and OGG1 Expression in Patients with Colorectal Cancer" International Journal of Molecular Sciences 15, no. 10: 17333-17343. https://doi.org/10.3390/ijms151017333
APA StyleSantos, J. C., Funck, A., Silva-Fernandes, I. J. L., Rabenhorst, S. H. B., Martinez, C. A. R., & Ribeiro, M. L. (2014). Effect of APE1 T2197G (Asp148Glu) Polymorphism on APE1, XRCC1, PARP1 and OGG1 Expression in Patients with Colorectal Cancer. International Journal of Molecular Sciences, 15(10), 17333-17343. https://doi.org/10.3390/ijms151017333