Microarray Analysis of Transcriptional Responses to Abscisic Acid and Salt Stress in Arabidopsis thaliana
Abstract
:1. Introduction
2. Results and Discussion
2.1. Genes Expressed in Response to Salt Stress
2.2. Genes Expressed in Response to ABA Treatment
2.3. Confirmation of Microarray Results by Quantitative Real-Time PCR
2.4. Comparison of Gene Expression Profiles between Salt and ABA Treatments
3. Experimental Section
3.1. Plant Material and Growth Conditions
3.2. RNA Extraction and Reverse Transcription
3.3. Microarray Analysis
3.4. Verification of Microarray Data
4. Conclusions
Acknowledgments
Conflict of Interest
- Accession CodeMicroarray data from this article can be found in GEO (Gene Expression Omnibus) under the accession code GSE45543.
References
- DeRisi, J.; Penland, L.; Brown, P.O.; Bittner, M.L.; Meltzer, P.S.; Ray, M.; Chen, Y.; Su, Y.A.; Trent, J.M. Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat. Genet 1996, 14, 457–460. [Google Scholar]
- Kilian, J.; Peschke, F.; Berendzen, K.W.; Harter, K.; Wanke, D. Prerequisites, performance and profits of transcriptional profiling the abiotic stress response. Biochim. Biophys. Acta 2012, 1819, 166–175. [Google Scholar]
- Redman, J.C.; Haas, B.J.; Tanimoto, G.; Town, C.D. Development and evaluation of an Arabidopsis whole genome Affymetrix probe array. Plant J 2004, 38, 545–561. [Google Scholar]
- Zeller, G.; Henz, S.R.; Widmer, C.K.; Sachsenberg, T.; Ratsch, G.; Weigel, D.; Laubinger, S. Stress-induced changes in the Arabidopsis thaliana transcriptome analyzed using whole-genome tiling arrays. Plant J 2009, 58, 1068–1082. [Google Scholar]
- Kaya, C.; Ilktac, A.; Gokmen, E.; Ozturk, M.; Karaman, I.M. The long-term results of transurethral vaporization of the prostate using plasmakinetic energy. BJU Int 2007, 99, 845–848. [Google Scholar]
- Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Inaba, M.; Murata, N. Ionic and osmotic effects of NaCl-induced inactivation of photosystems I and II in Synechococcussp. Plant Physiol 2000, 123, 1047–1056. [Google Scholar]
- Chinnusamy, V.; Jagendorf, A.; Zhu, J.K. Understanding and improving salt tolerance in plants. Crop Sci 2005, 45, 437–448. [Google Scholar]
- Maricle, B.R.; Cobos, D.R.; Campbell, C.S. Biophysical and morphological leaf adaptations to drought and salinity in salt marsh grasses. Environ. Exp. Bot 2007, 60, 458–467. [Google Scholar]
- Sekmen, A.H.; Turkan, I.; Takio, S. Differential responses of antioxidative enzymes and lipid peroxidation to salt stress in salt-tolerant Plantago maritima and salt-sensitive Plantago media. Physiol. Plant 2007, 131, 399–411. [Google Scholar]
- Kreps, J.A.; Wu, Y.; Chang, H.-S.; Zhu, T.; Wang, X.; Harper, J.F. Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 2002, 130, 2129–2141. [Google Scholar]
- Kilian, J.; Whitehead, D.; Horak, J.; Wanke, D.; Weinl, S.; Batistic, O.; D’Angelo, C.; Bornberg-Bauer, E.; Kudla, J.; Harter, K. The AtGenExpress global stress expression data set: Protocols, evaluation and model data analysis of UV-B light, drought and cold stress responses. Plant J 2007, 50, 347–363. [Google Scholar]
- Watanabe, S.; Kojima, K.; Ide, Y.; Sasaki, S. Effects of saline and osmotic stress on proline and sugar accumulation in Populus euphratica in vitro. Plant Cell Tissue Organ Cult 2000, 63, 199–206. [Google Scholar]
- Ranf, S.; Wünnenberg, P.; Lee, J.; Becker, D.; Dunkel, M.; Hedrich, R.; Scheel, D.; Dietrich, P. Loss of the vacuolar cation channel, AtTPC1, does not impair Ca2+ signals induced by abiotic and biotic stresses. Plant J 2008, 53, 287–399. [Google Scholar]
- Jiang, Y.; Deyholos, M.K. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes. Plant Biol 2006, 6, 25. [Google Scholar]
- Seki, M.; Narusaka, M.; Ishida, J.; Nanjo, T.; Fujita, M.; Oono, Y.; Kamiya, A.; Nakajima, M.; Enju, A.; Sakurai, T.; et al. Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J 2002, 31, 279–292. [Google Scholar]
- Takahashi, S.; Seki, M.; Ishida, J.; Satou, M.; Sakurai, T.; Narusaka, M.; Kamiya, A.; Nakajima, M.; Enju, A.; Akiyama, K.; et al. Monitoring the expression profiles of genes induced by hyperosmotic, high salinity, and oxidative stress and abscisic acid treatment in Arabidopsis cell culture using a full-length cDNA microarray. Plant Mol. Biol 2004, 56, 29–55. [Google Scholar]
- Kawasaki, S.; Borchert, C.; Deyholos, M.; Wang, H.; Brazille, S.; Kawai, K.; Galbraith, D.; Bohnert, H.J. Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 2001, 13, 889–905. [Google Scholar]
- Rabbani, M.A.; Maruyama, K.; Abe, H.; Khan, M.A.; Katsura, K.; Ito, Y.; Yoshiwara, K.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA get-blot analyses. Plant Physiol 2003, 133, 1755–1767. [Google Scholar]
- Adie, B.A.; Perez-Perez, J.; Perez-Perez, M.M.; Godoy, M.; Sanchez-Serrano, J.J.; Schmelz, E.A.; Solano, R. ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis. Plant Cell 2007, 19, 1665–1681. [Google Scholar]
- Finkelstein, R.R.; Gampala, S.S.; Rock, C.D. Abscisic acid signaling in seeds and seedlings. Plant Cell 2002, 14, S15–S45. [Google Scholar]
- Cheong, Y.H.; Moon, B.C.; Kim, J.K.; Kim, C.Y.; Kim, M.C.; Kim, I.H.; Park, C.Y.; Kim, J.C.; Park, B.O.; Koo, S.C.; et al. BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor. Plant Physiol 2003, 132, 1961–1972. [Google Scholar]
- Kang, J.Y.; Choi, H.I.; Im, M.Y.; Kim, S.Y. Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell 2002, 14, 343–357. [Google Scholar]
- Fujita, Y.; Fujita, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. ABA-mediated transcriptional regulation in response to osmotic stress in plants. J. Plant Res 2011, 124, 509–525. [Google Scholar]
- Cutler, S.R.; Rodriguez, P.L.; Finkelstein, R.R.; Abrams, S.R. Abscisic acid: Emergence of a core signaling network. Annu. Rev. Plant Biol 2010, 61, 651–679. [Google Scholar]
- Xiong, L.; Schumaker, K.S.; Zhu, J.K. Cell signaling during cold, drought, and salt stress. Plant Cell 2002, 14, S165–S183. [Google Scholar]
- Zhang, J.; Jia, W.; Yang, J.; Ismail, A.M. Role of ABA in integrating plant responses to drought and salt stresses. Field Crops Res 2006, 97, 111–119. [Google Scholar]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol 2006, 57, 781–803. [Google Scholar]
- Chinnusamy, V.; Schumaker, K.; Zhu, J.K. Molecular genetic perspectives on cross-talk and specificity in abiotic stress signalling in plants. J. Exp. Bot 2004, 55, 225–236. [Google Scholar]
- Thomashow, M.F. Plant cold acclimation: Freezing Tolerance Genes and Regulatory Mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol 1999, 50, 571–599. [Google Scholar]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Gene expression and signal transduction in water-stress response. Plant Physiol 1997, 115, 327–334. [Google Scholar]
- Mahajan, S.; Tuteja, N. Cold, salinity and drought stresses: An overview. Arch. Biochem. Biophys 2005, 444, 139–158. [Google Scholar]
- Uno, Y.; Furihata, T.; Abe, H.; Yoshida, R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci. USA 2000, 97, 11632–11637. [Google Scholar]
- Nakashima, K.; Shinwari, Z.K.; Sakuma, Y.; Seki, M.; Miura, S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Organization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins involved in dehydration- and high-salinity-responsive gene expression. Plant Mol. Biol 2000, 42, 657–665. [Google Scholar]
- Sharma, N.; Abrams, S.R.; Waterer, D.R. Uptake, movement, activity, and persistence of an abscisic acid analog (8′Acetylene ABA methyl ester) in marigold and tomato. J. Plant Growth Regul. 2005, 24–28. [Google Scholar]
- Bohra, J.S.; Dörffling, H.; Dörffling, K. Salinity tolerance of rice (Oryza sativa L.) with reference to endogenous and exogenous abscisic acid. J. Agron. Crop Sci 1995, 174, 79–86. [Google Scholar]
- Wilkinson, S.; Davies, W.J. ABA-based chemical signal-ling: The co-ordination of responses to stress in plants. Plant Cell Environ 2002, 25, 195–210. [Google Scholar]
- Christmann, A.; Weiler, E.W.; Steudle, E.; Grill, E. A hydraulic signal in root-to-shoot signalling of water shortage. Plant J 2007, 52, 167–174. [Google Scholar]
- Yokoi, S.; Quintero, F.J.; Cubero, B.; Ruiz, M.T.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J 2002, 30, 529–539. [Google Scholar]
- Saeedipour, S. Salinity tolerance of rice lines related to endogenous abscisic acid (ABA) level synthesis under stress. Afr. J. Plant Sci 2011, 5, 628–633. [Google Scholar]
- Xiong, L.; Zhu, J.K. Regulation of abscisic acid biosynthesis. Plant Physiol 2003, 133, 29–36. [Google Scholar]
- Zhu, J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol 2002, 53, 247–273. [Google Scholar]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Characterization of the expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and analysis of its promoter in transgenic plants. Mol. Gen. Genet 1993, 236, 331–340. [Google Scholar]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. The plant hormone abscisic acid mediates the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in Arabidopsis thaliana. Mol. Gen. Genet 1993, 238, 17–25. [Google Scholar]
- Fujita, M.; Fujita, Y.; Maruyama, K.; Seki, M.; Hiratsu, K.; Ohme-Takagi, M.; Tran, L.S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J 2004, 39, 863–876. [Google Scholar]
- Goda, H.; Sasaki, E.; Akiyama, K.; Maruyama-Nakashita, A.; Nakabayashi, K.; Li, W.; Ogawa, M.; Yamauchi, Y.; Preston, J.; Aoki, K.; et al. The AtGenExpress hormone and chemical treatment data set: Experimental design, data evaluation, model data analysis and data access. Plant J 2008, 55, 526–542. [Google Scholar]
- Bossi, F.; Cordoba, E.; Dupré, P.; Mendoza, M.S.; Román, C.S.; León, P. The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J 2009, 59, 359–374. [Google Scholar]
- Lee, S.J.; Kang, J.Y.; Park, H.J.; Kim, M.D.; Bae, M.S.; Choi, H.I.; Kim, S.Y. DREB2C interacts with ABF2, a bZIP protein regulating abscisic acid-responsive gene expression, and its overexpression affects abscisic acid sensitivity. Plant Physiol 2010, 153, 716–727. [Google Scholar]
- Lu, G.; Paul, A.L.; McCarty, D.R.; Ferl, R.J. Transcription factor veracity: Is GBF3 responsible for ABA-regulated expression of Arabidopsis Adh? Plant Cell 1996, 8, 847–857. [Google Scholar]
- Chen, W.Q.; Provart, N.J.; Glazebrook, J.; Katagiri, F.; Chang, H.S.; Eulgem, T.; Mauch, F.; Luan, S.; Zou, G.Z.; Whitham, S.A.; et al. Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses. Plant Cell 2002, 14, 559–574. [Google Scholar]
- Wang, Y.; Li, H.; Si, Y.; Zhang, H.; Guo, H.; Miao, X. Microarray analysis of broad-spectrum resistance derived from an indica cultivar Rathu Heenati. Planta 2012, 235, 829–840. [Google Scholar]
- Jia, M.A.; Li, Y.; Lei, L.; Di, D.; Miao, H.; Fan, Z. Alteration of gene expression profile in maize infected with a double-stranded RNA fijivirus associated with symptom development. Mol. Plant Pathol 2012, 13, 251–262. [Google Scholar]
- Wolfinger, R.D.; Gibson, G.; Wolfinger, E.D.; Bennett, L.; Hamadeh, H.; Bushel, P.; Afshari, C.; Paules, R.S. Assessing gene significance from cDNA microarray expression data via mixed models. J. Comput. Biol 2001, 8, 625–637. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar]
seq | Locustag | Annotation | Microarray NaCl-logFC | RT-PCR NaCl-logFC | Microarray ABA-logFC | RT-PCR ABA-logFC |
---|---|---|---|---|---|---|
1 | AT4G10265 | putative wound-responsive protein | 4.8003 | 1.0353 | 2.1751 | 1.959 |
2 | AT5G50360 | hypothetical protein | 2.5511 | 4.973 | 4.0022 | 3.5212 |
3 | AT1G07430 | protein phosphatase 2C 3 | 1.8292 | 5.835 | 4.2210 | 0.2495 |
4 | AT2G41190 | transmembrane amino acid transporter-like protein | 1.7845 | 3.7497 | 3.6432 | 1.0875 |
5 | AT5G57050 | ABI2 | 1.0575 | 2.4057 | 3.4208 | 0.1722 |
6 | AT4G15160 | LTP family protein | 1.0653 | 2.421 | −1.5312 | −0.0905 |
7 | AT4G20780 | calcium-binding protein CML42 | −1.0333 | −3.0587 | −1.9896 | −1.4238 |
8 | AT3G17510 | CBL-interacting serine | −1.1578 | −3.153 | −1.0133 | −1.1058 |
9 | AT1G56430 | nicotianamine synthase | −1.8847 | −2.319 | −1.1996 | −1.6192 |
10 | AT3G46880 | protein coding | −3.6012 | −5.8873 | −4.0783 | −0.5008 |
Locustag | NaCl-stressed fold change | ABA-stressed fold change | ABRE element | Annotation |
---|---|---|---|---|
AT4G10265 | 27.8632 | 4.5162 | – | wound-responsive protein |
AT5G50360 | 5.8608 | 16.0246 | −413 (CACGTG) −78 (CACGTG) | hypothetical protein |
AT5G49120 | 5.3675 | 5.7876 | −177 (CACGTG) | senescence-associated protein-related |
AT5G40790 | 4.8776 | 6.6758 | −158 (CACGTG) | hypothetical protein |
AT5G53710 | 4.6116 | 4.6627 | – | hypothetical protein |
AT1G52890 | 3.8061 | 4.5065 | −164 (CACGTG) −794 (CACGTG) −993 (CACGTG) | transcription factor NAC19 |
AT5G63350 | 3.7261 | 16.2454 | – | hypothetical protein |
AT2G18550 | 3.7087 | 5.5151 | – | leucine zipper protein ATHB-21, transcription factor |
AT1G07430 | 3.5534 | 18.6473 | – | protein phosphatase 2C-3 |
AT1G47960 | 3.4988 | 2.2437 | – | vacuolar inhibitor of fructosidase 1 |
AT4G02280 | 3.4619 | 3.5309 | – | UDP-glycosyltransferase |
AT2G41190 | 3.4442 | 12.4944 | – | transmembrane amino acid transporter-like protein |
AT4G14819 | 3.4372 | 3.7987 | – | hypothetical protein |
AT5G53120 | 3.4023 | 2.7388 | – | SPDS3 (spermine synthase 3) |
AT3G22560 | 3.3933 | 6.3729 | – | GNAT family protein |
AT3G48020 | 3.1747 | 4.0543 | – | protein coding |
AT1G80160 | 2.9702 | 6.5128 | −369 (CACGTG) −153 (CACGTG) | Lactoylglutathione lyase |
AT5G40690 | 2.8515 | 3.0216 | – | hypothetical protein |
AT2G25625 | 2.6942 | 4.4558 | – | hypothetical protein |
AT4G18980 | 2.6594 | 7.0188 | – | protein AtS40-3 |
AT4G27410 | 2.4024 | 2.7636 | – | transcription factor NAC72 |
AT3G11410 | 2.2645 | 5.3254 | −397 (CACGTG) | protein phosphatase 2C-37 |
AT3G14360 | 2.2635 | 2.0886 | – | lipase class 3 family protein |
AT1G79520 | 2.2204 | 4.6101 | – | Cation efflux family protein |
AT5G17460 | 2.2132 | 4.5499 | – | hypothetical protein |
AT2G39800 | 2.1813 | 6.0887 | −209 (CACGTG) | Gamma-glutamyl phosphate reductase |
AT5G25220 | 2.1642 | 2.2841 | – | transcription factor KNAT3 |
AT1G17940 | 2.1421 | 4.8303 | – | BRO1-like domain-containing protein |
AT1G51140 | 2.1383 | 3.3635 | −284 (CACGTG) | transcription factor bHLH122 |
AT5G66400 | 2.1236 | 4.5373 | – | dehydrin RAB18 |
AT5G57050 | 2.0813 | 10.7091 | – | ABI2 |
Locustag | NaCl-stressed fold change | ABA-stressed fold change | Annotation |
---|---|---|---|
AT4G20780 | 0.4886 | 0.2518 | calcium-binding protein CML42 |
AT3G03780 | 0.4726 | 0.2624 | threonine-protein kinase WNK-related protein |
AT4G37670 | 0.4649 | 0.2412 | N-acetyl-l-glutamate synthase 2 |
AT2G23600 | 0.4647 | 0.4048 | acetone-cyanohydrin lyase |
AT5G59080 | 0.4621 | 0.497 | hypothetical protein |
AT4G14680 | 0.4594 | 0.3298 | sulfate adenylyltransferase APS3 |
AT4G21870 | 0.458 | 0.1104 | heat shock protein class V 15.4 |
AT3G17510 | 0.4482 | 0.4954 | CBL-interacting serine |
AT5G19230 | 0.4458 | 0.4943 | GPI-anchored glycoprotein membrane precursor |
AT1G76952 | 0.4207 | 0.3389 | IDA-like 5 protein |
AT4G36410 | 0.4118 | 0.3982 | ubiquitin-protein ligase UBC17 |
AT1G33340 | 0.4064 | 0.2444 | clathrin assembly protein |
AT1G55380 | 0.3985 | 0.4387 | histidine-rich C1 domain-containing protein |
AT5G15830 | 0.3832 | 0.464 | transcription factor BZIP3 |
AT5G59340 | 0.3664 | 0.2786 | transcription factor WOX2 |
AT1G58370 | 0.3592 | 0.3879 | glycosyl hydrolase-like prottein 10 |
AT1G76990 | 0.3184 | 0.3688 | ACT domain-containing protein 3 |
AT1G56430 | 0.2708 | 0.4354 | nicotianamine synthase |
AT5G04310 | 0.2456 | 0.291 | pectate lyase family protein |
AT5G57220 | 0.1931 | 0.2487 | CYP81F2 |
AT3G15356 | 0.1843 | 0.2811 | lectin-like protein |
AT3G16530 | 0.1668 | 0.3124 | legume lectin-like protein |
AT3G46880 | 0.0824 | 0.0592 | protein coding |
Locustag | NaCl-stressed fold change | ABA-stressed fold change | Annotation |
---|---|---|---|
AT4G15160 | 2.0926 | 0.346 | LTP family protein |
seq | Locus tag | Forward Primers (5′-3′) | Reverse Primers (5′-3′) |
---|---|---|---|
1 | AT4G10265 | ATGAGCTCTGCAAGCAAAACGT | TTAACTAGGACCCCAACAGCTC |
2 | AT5G50360 | ATCAGACAGAGTTAATGACGG | CATCACAGAACGAAGTAATCG |
3 | AT1G07430 | ATGTCACGAGCCATAGGAGAC | AGCTTCGTCAGCAATACTGACG |
4 | AT2G41190 | ATTACACTAAACATGCCACAGG | CAATGATCGAACTCAGAATCAT |
5 | AT5G57050 | ATGAAGCGGCGAGGATAGAAGCTG | CTGCCGCGGACATTGCTGCAGGAT |
6 | AT4G15160 | ACTGTGAAGCCACCACCACCTC | CGTCAAGACCCACTAAGTCGTC |
7 | AT4G20780 | AACGCTGATCTCTCCGATCTC | GATTCCGGTCAACGGAAACGAT |
8 | AT3G17510 | AGTACATTCCTTCAATTCCCGATG | CAGCTGTTACTGATAAACCAACTT |
9 | AT1G56430 | ATCGACCCATCAGCGAATATGGT | CGAAGCTTGATCTATATGATCAT |
10 | AT3G46880 | ATGGAGGGTAAAGGAAGAGTTG | CATCGTTGTTATCTCTGTTCTGAT |
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Liu, Y.; Ji, X.; Zheng, L.; Nie, X.; Wang, Y. Microarray Analysis of Transcriptional Responses to Abscisic Acid and Salt Stress in Arabidopsis thaliana. Int. J. Mol. Sci. 2013, 14, 9979-9998. https://doi.org/10.3390/ijms14059979
Liu Y, Ji X, Zheng L, Nie X, Wang Y. Microarray Analysis of Transcriptional Responses to Abscisic Acid and Salt Stress in Arabidopsis thaliana. International Journal of Molecular Sciences. 2013; 14(5):9979-9998. https://doi.org/10.3390/ijms14059979
Chicago/Turabian StyleLiu, Yujia, Xiaoyu Ji, Lei Zheng, Xianguang Nie, and Yucheng Wang. 2013. "Microarray Analysis of Transcriptional Responses to Abscisic Acid and Salt Stress in Arabidopsis thaliana" International Journal of Molecular Sciences 14, no. 5: 9979-9998. https://doi.org/10.3390/ijms14059979
APA StyleLiu, Y., Ji, X., Zheng, L., Nie, X., & Wang, Y. (2013). Microarray Analysis of Transcriptional Responses to Abscisic Acid and Salt Stress in Arabidopsis thaliana. International Journal of Molecular Sciences, 14(5), 9979-9998. https://doi.org/10.3390/ijms14059979