Microsatellite Markers for the Chameleon Grasshopper (Kosciuscola tristis) (Orthoptera: Acrididae), an Australian Alpine Specialist
Abstract
1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgments
References
- Hennessy, K.; Fitzharris, B.; Bates, B.C.; Harvey, N.; Howden, S.M.; Hughes, L.; Salinger, J.; Warrick, R. Australia and New Zealand. Climate Change 2007: Impacts, Adaptation and Vulnerability. Proceedings of Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, Cambridge, UK; 2007; pp. 507–540. [Google Scholar]
- Rehn, J.A.G. Family Acrididae: Subfamily Cyrtacanthacrldinae tribes Oxyini, Spathosternini, and Praxibulini. In The Grasshoppers and Locusts (Acridoidea) of Australia; CSIRO: Melbourne, Australia, 1957. [Google Scholar]
- Key, K.H.L.; Day, M.F. The physiological mechanism of colour change in the grasshopper, Kosciuscola tristis Sjöst. (Orthoptera: Acrididae). Aust. J. Zool 1954, 2, 340–363. [Google Scholar]
- Umbers, K.D.L. Turn the temperature to turquoise: cues for colour change in the male chameleon grasshopper (Kosciuscola tristis) (Orthoptera: Acrididae). J. Insect Physiol 2011, 57, 1198–1204. [Google Scholar]
- Morgan, M.J.; Hunter, D.; Pietsch, R.; Osborne, W.; Keogh, J.S. Assessment of genetic diversity in the critically endangered Australian corroboree frogs, Pseudophryne corroboree and Pseudophryne pengilleyi, identifies four evolutionarily significant units for conservation. Mol. Ecol 2008, 17, 3448–3463. [Google Scholar]
- Mitrovski, P.; Heinze, D.A.; Broome, L.; Hoffmann, A.A.; Weeks, A.R. High levels of variation despite genetic fragmentation in populations of the endangered mountain pygmy-possum, Burramys parvus, in alpine Australia. Mol. Ecol 2007, 16, 75–87. [Google Scholar]
- Peakall, R.O.D.; Smouse, P.E. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar]
- Boutin-Ganache, I.; Raposo, M.; Raymond, M.; Deschepper, C.F. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. Biotechniques 2001, 31, 24–28. [Google Scholar]
- Raymond, M.; Rousset, F. Genepop (Version 1.2): Population Genetics Software for Exact Tests and Ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-Checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Chapuis, M.-P.; Popple, J.-A.; Simpson, S.J.; Estoup, A.; Martin, J.-F.; Steinbauer, M.; Mcculloch, L.; Sword, G.A. Eight polymorphic microsatellite loci for the Australian plague locust, Chortoicetes terminifera. Mol. Ecol. Res 2008, 8, 1414–1416. [Google Scholar]
- Chapuis, M.-P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol 2007, 24, 621–631. [Google Scholar]
- Blanchet, E.; Pages, C.; Blondin, L.; Billot, C.; Rivallan, R.; Vassal, J.; Lecoq, M.; Risterucci, A. Isolation of Microsatellite Markers in the Calliptamus genus (Orthoptera, Acrididae). J. Ins. Sci 2010, 10, 1–6. [Google Scholar]
- Dempster, A.P.; Laird, N.M.; Rubin, D.B. Maximum likelihood from incomplete data via the EM algorithm. J. Roy. Stat. Soc. B 1977, 39, 1–38. [Google Scholar]
- Billotte, N.; Lagoda, P.J.L.; Risterucci, A.-M.; Baurens, F.-C. Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 1999, 54, 277–288. [Google Scholar]
- Sunnucks, P.; Hales, D.F. Numerous transposed sequences of mitochondrial cytochrome oxidase I-II in aphids of the genus Sitobion (Hemiptera: Aphididae). Mol. Biol. Evol 1996, 13, 510–524. [Google Scholar]
- Meglécz, E. Microfamily (version 1): A computer program for detecting flanking-region similarities among different microsatellite loci. Mol. Ecol. Notes 2007, 7, 18–20. [Google Scholar]
- Berthier, K.; Loiseau, A.; Streiff, R.; Arlettaz, R. Eleven polymorphic microsatellite markers for Oedaleus decorus (Orthoptera, Acrididae), an endangered grasshopper in Central Europe. Mol. Ecol. Res 2008, 8, 1363–1366. [Google Scholar]
| Locus | Primer Sequences (5′–3′) | Repeat Motif | Size Range (bp) | Genbank Accession No. |
|---|---|---|---|---|
| Ktr29 | F: TAACTGGCAGACAGGCACAC | (AC)19atg(CA)7 | 176–202 | HQ316183 |
| R: AGGCCTTAGAGCCCAGAGAC | ||||
| Ktr30 | F: GCAAATTTGGCGTCTTCATC | (AC)12 | 144–206 | HQ316184 |
| R: GTCATAAGGGCGGATACTGG | ||||
| Ktr58 | F: CAGTTACATACAGCAACATGTCTAGG | (GA)5a(AG)19 | 242–314 | HQ316185 |
| R: AGCTTCAAGCAAGACTGAGATG | ||||
| Ktr60 | F: TCACCGGTATGGCTCTTAGG | (TG)18 | 218–254 | HQ316186 |
| R: TTCGGCGTGAAGACGTAAC | ||||
| Ktr73 | F: GGGAATTTGAATCTGTGATCG | (TG)10ta(TG)8 | 242–250 | JX843414 |
| R: CACGACGTTGTAAAACGAC | ||||
| Ktr76 | F: GTAACTGAGCACCTGGCACA | (TG)12 | 234–238 | HQ316187 |
| R: GCAGACCGAGGATGAGAAAG | ||||
| Ktr82 | F: TCCAGTCTTGTCAGGAAATACG | (TG)19 | 196–218 | HQ316188 |
| R: TGCTGCAATCTCATCAATGG | ||||
| Ktr88 | F: ACATGCCGGTGCCATTTAC | (AC)8aa(AC)20 | 176–216 | HQ316189 |
| R: CAATGATTTCCGTGGATACG |
| Locus | Dye | Pf (μM) | Pr (μM) | MgCl2 (μM) | N | Ntest | NA | HO | HE | p | Null Allele Freq. |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Ktr29 | f | 0.02 | 0.10 | 2.0 | 26 | 26 | 15 | 0.692 | 0.907 | 0.32 | 0.10 |
| Ktr30 | p | 0.03 | 0.10 | 2.5 | 24 | 26 | 16 | 0.333 | 0.907 | <0.01 | 0.30 |
| Ktr58 | p | 0.03 | 0.10 | 2.5 | 24 | 26 | 4 | 0.583 | 0.497 | 0.82 | 0.00 |
| Ktr60 | n | 0.03 | 0.10 | 2.5 | 25 | 26 | 17 | 0.760 | 0.874 | 1.00 | 0.03 |
| Ktr73 | f | 0.02 | 0.10 | 2.5 | 25 | 30 | 3 | 0.160 | 0.215 | 0.42 | 0.07 |
| Ktr76 | v | 0.02 | 0.10 | 2.5 | 23 | 26 | 20 | 0.435 | 0.910 | <0.01 | 0.25 |
| Ktr82 | n | 0.02 | 0.10 | 2.5 | 25 | 26 | 12 | 0.200 | 0.852 | <0.01 | 0.35 |
| Ktr88 | v | 0.03 | 0.10 | 2.5 | 23 | 26 | 12 | 0.565 | 0.868 | 0.03 | 0.15 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Umbers, K.D.L.; Dennison, S.; Manahan, C.A.; Blondin, L.; Pagés, C.; Risterucci, A.-M.; Chapuis, M.-P. Microsatellite Markers for the Chameleon Grasshopper (Kosciuscola tristis) (Orthoptera: Acrididae), an Australian Alpine Specialist. Int. J. Mol. Sci. 2012, 13, 12094-12099. https://doi.org/10.3390/ijms130912094
Umbers KDL, Dennison S, Manahan CA, Blondin L, Pagés C, Risterucci A-M, Chapuis M-P. Microsatellite Markers for the Chameleon Grasshopper (Kosciuscola tristis) (Orthoptera: Acrididae), an Australian Alpine Specialist. International Journal of Molecular Sciences. 2012; 13(9):12094-12099. https://doi.org/10.3390/ijms130912094
Chicago/Turabian StyleUmbers, Kate D. L., Siobhan Dennison, Czarina A. Manahan, Laurence Blondin, Christine Pagés, Ange-Marie Risterucci, and Marie-Pierre Chapuis. 2012. "Microsatellite Markers for the Chameleon Grasshopper (Kosciuscola tristis) (Orthoptera: Acrididae), an Australian Alpine Specialist" International Journal of Molecular Sciences 13, no. 9: 12094-12099. https://doi.org/10.3390/ijms130912094
APA StyleUmbers, K. D. L., Dennison, S., Manahan, C. A., Blondin, L., Pagés, C., Risterucci, A.-M., & Chapuis, M.-P. (2012). Microsatellite Markers for the Chameleon Grasshopper (Kosciuscola tristis) (Orthoptera: Acrididae), an Australian Alpine Specialist. International Journal of Molecular Sciences, 13(9), 12094-12099. https://doi.org/10.3390/ijms130912094
