Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean) Genome
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgements
Reference
- Hanai, L.R.; Campos, T.; Camargo, L.E.A.; Benchimol, L.L.; de souza, A.P.; Melotto, M.; Carbonell, S.A.M. Development, characterization, and comparative analysis of polymorphism at common bean SSR loci isolated from genic and genomic sources. Genome 2007, 50, 266–277. [Google Scholar]
- Blair, M.W.; Hurtado, N.; Chavarro, C.M.; Munoz-Torres, M.C.; Giraldo, M.C.; Pedraza, F.; Tomkins, J.; Wing, R. Gene-based SSR markers for common bean (Phaseolus vulgaris L.) derived from root and leaf tissue ESTs: An integration of the BMc series. BMC Plant Biol 2011, 11, 50–59. [Google Scholar]
- Córdoba, J.M.; Chavarro, C.; Schlueter, J.A.; Jackson, S.A.; Blair, M.W. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC Genomics 2010, 11, 436–445. [Google Scholar]
- Blair, M.W.; Torres, M.M.; Pedraza, F.; Giraldo, M.C.; Buendía, H.F.; Hurtado, N. Development of microsatellite markers for common bean (Phaseolus vulgaris L.) based on screening of non-enriched, small-insert genomic libraries. Genome 2009, 52, 772–782. [Google Scholar]
- Garcia, R.A.V.; Rangel, P.N.; Brondani, C.; Martins, W.S.; Melo, L.C.; Carneiro, M.S.; Borba, T.C.; Brondani, R.P. The characterization of a new set of EST-derived simple sequence repeat (SSR) markers as a resource for the genetic analysis of Phaseolus vulgaris. BMC Genetics 2011, 12, 41–54. [Google Scholar]
- Gill-Langarica, H.R.; Muruaga-Martínez, J.S.; Vargas-Vázquez, M.L.; Rosales-Serna, R.; Mayek-Pérez, N. Genetic diversity analysis of common beans based on molecular markers. Genet. Mol. Biol 2011, 34, 595–605. [Google Scholar]
- Van, O.C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICROCHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- Gupta, P.K.; Rustgi, S.; Sharma, S.; Singh, R.; Kumar, N.; Balyan, H.S. Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol. Genet. Genomic 2003, 270, 315–323. [Google Scholar]
- Luo, Z.; Zhou, G.; Chen, X.; Lu, Q.; Hu, W. Isolation of high quality genomic DNA from plants (In Chinese). Bulletin of Human Medical University 2001, 26, 178–180. [Google Scholar]
- Benson, G. TANDEM REPEATS FINDER: A program to analyze DNA sequences. Nucleic Acids Res 1999, 27, 573–580. [Google Scholar]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics methods and protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.01): An integrated software package for population genetics data analysis; Computational and Molecular Population Genetics Lab (CMPG), Institute of Zoology, University of Berne, 2005; Berne, Switzerland. [Google Scholar]
- Lei, P.; Zhi, W.Q.; Shuang, M.L.; Hong, G.L.; Xin, F.H.; Wei, D.K.; Yi, D. Isolation and characterization of microsatellite markers in the sacred lotus (Nelumbo nucifera Gaertn.). Mol. Ecol. Res 2007, 7, 1054–1056. [Google Scholar]
- Kan, H.; Xing, F.H.; Wei, D.K.; Yi, D. Characterization of 11 new microsatellite loci in taro (Colocasia esculenta). Mol. Ecol. Res 2009, 9, 582–584. [Google Scholar]
Locus | Primer Sequence (5′–3′) | Repeat Motif | Size Range (bp) | Ho | He | Na | D | PIC | Ta (°C) | GenBank |
---|---|---|---|---|---|---|---|---|---|---|
C9 | F:ACAGAGACGAGTGCGTGAGAGTTAG | (AT)15 | 445–470 | 0.469 | 0.428 | 4 | * | 0.471 | 57 | JQ739888 |
R:AAAGACAGTTCTAGGAAGAACCGTC | ||||||||||
C33 | F: CTCTTTCTGCTTCCTTTCTACGC | (AG)15 | 536–565 | 0.531 | 0.814 | 7 | * | 0.721 | 59 | JQ739889 |
R:TTCTTCACAGTCAAGGGAGTAGAAG | ||||||||||
C42 | F:TGTCATAAACCTGCTGGTGAATAAC | (AG)28 | 287–342 | 0.026 | 0.473 | 3 | NS | 0.444 | 60 | JQ739900 |
R:CCTATTTCAGAATCACAGCTATGAC | ||||||||||
C45a | F: CATGAATGATTACGATTCGAGC | (AG)20 | 106–199 | 0.162 | 0.151 | 2 | NS | 0.281 | 60 | JQ739901 |
R:TGAGTGATTACTAGTGGAACCCA | ||||||||||
C76 | F: AGGCGAAGCAAGAGGTTTTATCCAC | (CT)20 | 194–233 | 0.027 | 0.24 | 3 | * | 0.454 | 59 | JQ739890 |
R:GAAGAGGCAGAAAGAACTTACAGCG | ||||||||||
C106a | F:TTGCAGGTAGCAGGTTGT | (TCTA)3TCTG | 383–431 | 0.029 | 0.585 | 5 | * | 0.656 | 57 | JQ739891 |
R:CAGACAGATAGATAGAGACGG | (TCTA)3TCAA(TCTA)5 | |||||||||
C115a | F: CGTAGTCTCTTTCGTCCTTTTCTGC | (CT)17 | 212–245 | 0.114 | 0.533 | 3 | * | 0.575 | 57 | JQ739892 |
R: TTACATGCCCTTTCCCTCGTTTG | ||||||||||
C117 | F: GTACCTCCTTTTGAGTTTGTAAGG | (CT)12 | 150–173 | 0.028 | 0.406 | 3 | * | 0.55 | 55 | JQ739893 |
R: GTTCGTAAGCCTACTTTCTCA | ||||||||||
C119 | F: CCACCATTGCTCTCAGTGTTA | (CT)21 | 251–292 | 0.139 | 0.45 | 3 | * | 0.458 | 57 | JQ739894 |
R: TAGATGTGTGTTTGTGTTCCG | ||||||||||
C130a | F: CCATTTCAAAGCAAACCCCTT | (CT)3CG(CT)2TG (CT)19 | 298–349 | 0.028 | 0.597 | 3 | * | 0.590 | 60 | JQ739896 |
R: TGACCCGCGATTATTTACCAC | ||||||||||
C132a | F: CAGTGGTTATTCTGGGGATT | (CT)13 | 477–502 | 0.118 | 0.674 | 5 | * | 0.687 | 58 | JQ739897 |
R: GGTTGTTTATGGCAGTAGCA | ||||||||||
C136a | F:GTAAAAGTCTCCTTCTACTTTCCCC | (CT)22 | 272–315 | 0.057 | 0.306 | 4 | * | 0.503 | 60 | JQ739898 |
R:CTCTCAAGCATGTTTGGATTGTAGC | ||||||||||
G10a | F: TCTTCTGTCCATCCCTCCATACT | (AG)27 | 220–273 | 0.088 | 0.327 | 3 | * | 0.444 | 60 | JQ739899 |
R: GATTGGTGGAAATCGACTTGTCT |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Wang, A.; Ding, Y.; Hu, Z.; Lin, C.; Wang, S.; Wang, B.; Zhang, H.; Zhou, G. Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean) Genome. Int. J. Mol. Sci. 2012, 13, 11188-11193. https://doi.org/10.3390/ijms130911188
Wang A, Ding Y, Hu Z, Lin C, Wang S, Wang B, Zhang H, Zhou G. Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean) Genome. International Journal of Molecular Sciences. 2012; 13(9):11188-11193. https://doi.org/10.3390/ijms130911188
Chicago/Turabian StyleWang, Aihua, Yi Ding, Zhenhua Hu, Chufa Lin, Shuzhen Wang, Bingcai Wang, Hongyuan Zhang, and Guolin Zhou. 2012. "Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean) Genome" International Journal of Molecular Sciences 13, no. 9: 11188-11193. https://doi.org/10.3390/ijms130911188
APA StyleWang, A., Ding, Y., Hu, Z., Lin, C., Wang, S., Wang, B., Zhang, H., & Zhou, G. (2012). Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean) Genome. International Journal of Molecular Sciences, 13(9), 11188-11193. https://doi.org/10.3390/ijms130911188