Elaeis oleifera Genomic-SSR Markers: Exploitation in Oil Palm Germplasm Diversity and Cross-Amplification in Arecaceae
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characterization of E. oleifera Genomic SSRs
2.2. Primers Designed for E. oleifera gSSR
2.3. Germplasm Characterization: Allelic Polymorphism and Genetic Variation in E. oleifera and E. guineensis
2.4. Genetic Relationship of the Genus Elaeis
2.5. Cross-Transferability of E. oleifera gSSR Markers
2.6. Sequence Variability and Molecular Basis of E. oleifera gSSR Markers Fragment Length Polymorphism
3. Experimental Section
3.1. Plant Materials and gSSR Source
3.2. SSR Identification and Primer Design
3.3. SSR Analysis
3.4. Data Analysis
3.5. Cross-Transferability Amplification
3.6. Sequencing of Cloned SSR-PCR Products for Alignment and Phenetic Analysis
4. Conclusions
Acknowledgments
References
- Teh, C.K. Genetic Diversity of Central and South American Wild Oil Palm (E. oleifera) Populations Using Microsatellite Markers. M.Sc. Thesis, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia, 2010. [Google Scholar]
- Hardon, J.J.; Tan, G.Y. Interspecific hybrids in the Elaeis. I. Cross-ability, cytogenetics and fertility of F1 hybrids of E. guineensis × E. oleifera. Euphytica 1969, 18, 372–379. [Google Scholar]
- Choo, Y.M.; Yusof, B. Elaeis oleifera palm for the pharmaceutical industry. PORIM Inf. Ser 1996, 42, 1–4. [Google Scholar]
- Madon, M.; Clyde, M.M.; Cheah, S.C. Application of genomic in situ hybridization (GISH) on Elaeis hybrids. J. Oil Palm Res 1999, 74–80. [Google Scholar]
- Feng, S.P.; Li, W.G.; Huang, H.S.; Wang, J.Y.; Wu, Y.T. Development, characterization and cross-species/genera transferability of EST-SSR markers for rubber tree (Hevea brasiliensis). Mol. Breed 2009, 28, 85–97. [Google Scholar]
- Powell, W.; Morgante, M.; Andre, C.; Hanafey, M.; Vogel, J.; Tingey, S.; Rafalski, A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed 1996, 2, 225–238. [Google Scholar]
- Singh, R.; Noorhariza, M.Z.; Ting, N.C.; Rozana, R.; Tan, S.G.; Low, L.E.T.; Ithnin, M.; Cheah, S.C. Exploiting an oil palm EST the development of gene-derived and their exploitation for assessment of genetic diversity. Biologia 2008, 63, 1–9. [Google Scholar]
- Billotte, N.; Marseillac, N.; Risterucci, A.M.; Adon, B.; Brotteir, P.; Baurens, F.C.; Singh, R.; Herran, A.; Asmady, H.; Billot, C.; et al. Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.). Theor. Appl. Genet 2005, 110, 754–765. [Google Scholar]
- Billotte, N.; Jourjon, M.F.; Marseillac, N.; Berger, A.; Flori, A.; Asmady, H.; Adon, B.; Singh, R.; Nouy, B.; Potier, F.; et al. QTL detection by multi-parent linkage mapping in oil palm (Elaeis guineensis Jacq.). Theor. Appl. Genet 2010, 120, 1673–1687. [Google Scholar]
- Hayati, A.; Wickneswari, R.; Maizura, I.; Rajanaidu, N. Genetic diversity of oil palm (Elaeis guineensis Jacq.) germplasm collections from Africa: Implications for improvement and conservation of genetic resources. Theor. Appl. Genet 2004, 108, 1274–1284. [Google Scholar]
- Maizura, I.; Rajanaidu, N.; Zakri, A.H.; Cheah, S.C. Assessment of genetic diversity in oil palm (Elaeis guineensis Jacq.) using Restriction Fragment Length Polymorphism (RFLP). Genet. Resour. Crop Evol 2006, 53, 187–195. [Google Scholar]
- Kularatne, R.S. Assessment of Genetic Diversity in Natural oil Palm (Elaeis guineensis Jacq.) Populations using Amplified Fragment Length Polymorphism Markers. Ph.D. Dissertation, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia, 2000. [Google Scholar]
- Rajanaidu, N.; Ariffin, D. Screening of Oil Palm Natural Populations Using RAPD and RFLP Molecular Marker. Proceeding of the International Symposium Oil Palm Genetics Resources Utilization, Kuala Lumpur, Malaysia, 8–10 June 2000, Rajanaidu, N.; Ariffin, D. Malaysian Palm Oil Board: Kuala Lumpur, Malaysia, 2000; pp. AA1–28. [Google Scholar]
- Ting, N.C.; Noorhariza, M.Z.; Rozana, R.; Low, L.E.T.; Ithnin, M.; Cheah, S.C.; Tan, S.G.; Singh, R. SSR mining in oil palm EST database: Application in oil palm germplasm diversity studies. J. Genet 2010, 89, 135–145. [Google Scholar]
- Barcellos, E.; Amblard, P.; Berthaud, J.; Seguin, M. Genetic diversity and relationship in American and African oil palm as revealed by RFLP and AFLP molecular markers. Pesq. Agropec. Bras. Brasilia 2002, 37, 1105–1114. [Google Scholar]
- Billotte, N.; Risterucci, A.M.; Barcelos, E.; Noyer, J.L.; Amblard, P.; Baurens, F.C. Development, characterisation and across-taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers. Genome 2001, 44, 413–425. [Google Scholar]
- Budiman, M.A.; Rajinder, S.; Low, E.T.L.; Nunberg, A.; Citek, R.; Rohlfing, T.; Bedell, J.A.; Lakey, N.D.; Martienssen, R.A.; Cheah, S.C. Sequencing of the Oil Palm Genespace. Proceeding of the 2005 PIPOC International Palm Oil Congress (Agriculture), Sunway Pyramid Convention Centre, Petaling Jaya, Malaysia, 25–29 September 2005; Malaysian Palm Oil Board: Kuala Lumpur, Malaysia, 2005; pp. 628–639. [Google Scholar]
- Huang, X.; Madan, A. CAP3: A DNA sequence assembly program. Genome Res 1999, 9, 868–877. [Google Scholar]
- Low, E.T.L.; Halimah, A.; Boon, S.H.; Elyana, M.S.; Tan, C.Y.; Ooi, L.C.L. Oil palm (Elaeis guineensis Jacq.) tissue culture ESTs: Identifying genes associated with callogenesis and embryogenesis. BMC Plant Biol 2008, 8. [Google Scholar] [CrossRef]
- Jung, S.; Abbott, A.; Jusudurai, C. Frequency, type, distribution of simple sequence repeats in Rosaceae ESTs. Funct. Integr. Genomics 2005, 5, 136–143. [Google Scholar]
- Aggarwal, R.K.; Hendre, P.S.; Varshney, R.K.; Bhat, P.R.; Krishnakumar, V.; Singh, L. Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor. Appl. Genet 2007, 114, 359–372. [Google Scholar]
- Gong, L.; Stift, G.; Kofler, R.; Pachner, M.; Lelley, T. Microsatellites for the genus Cucurbita and an SSR-based genetic linkage map of Cucurbita pepo L. Theor. Appl. Genet 2008, 117, 37–48. [Google Scholar]
- Morgante, M.; Hanafey, M.; Powell, W. Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nat. Genet 2002, 30, 194–200. [Google Scholar]
- Cardle, L.; Ramsay, L.; Milbourne, D.; Macaulay, M.; Marshall, D.; Waugh, R. Computational and experimental characterization of physically clustered simple sequence repeats in plants. Genetics 2000, 156, 847–854. [Google Scholar]
- Gao, L.F.; Tang, J.; Li, H.; Jia, J. Analysis of microsatellites in major crops assessed by computational and experimental approaches. Mol. Breed 2003, 113, 163–185. [Google Scholar]
- Thiel, T.; Michalek, W.; Varshney, R.K.; Graner, A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet 2003, 106, 411–422. [Google Scholar]
- Poncet, V.; Rondeau, M.; Tranchant, C.; Cayrel, A.; Hamon, S.; de Kochko, A.; Hamon, P. SSR mining in coffee tree EST databases: Potential use of EST-SSRs as markers for the Coffea genus. Mol. Genet. Genomics 2006, 276, 436–449. [Google Scholar]
- Pestsova, E.; Ganal, M.W.; Roder, M.S. Isolation and mapping of microsatellite marker specific for the D genome of bread wheat. Genome 2000, 43, 689–697. [Google Scholar]
- Bhattramakki, D.; Dong, J.; Chhabra, K.; Hart, G.E. An integrated SSR and RFLP linkage map of Sorghum bicolor (L.) Moench. Genome 2000, 43, 988–1002. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet 1980, 32, 314–331. [Google Scholar]
- Purba, A.R.; Noyer, J.L.; Baudouin, L.; Perrier, X.; Hamon, S.; Lagoda, P.J.L. A new aspect of genetic diversity of Indonesian oil palm (Elaeis guineensis Jacq.) revealed by isoenzyme and AFLP markers and its consequences for breeding. Theor. Appl. Genet 2000, 101, 956–961. [Google Scholar]
- Rajanaidu, N. Elaeis oleifera Collection in Central and South America. Proceeding of the International Workshop on Oil Palm Germplasm and Utilization, Selangor, Malaysia, 26–27 March 1986; Palm Oil Research Institute Malaysia: Kuala Lumpur, Malaysia, 1986; pp. 84–94. [Google Scholar]
- Barbara, T.; Palma-Silva, C.; Paggi, G.M.; Bered, F.; Fay, M.F.C.; Lexer, C. Cross-species transfer of nuclear microsatellite markers: Potential and limitations. Mol. Ecol 2007, 18, 3759–3767. [Google Scholar]
- Roa, A.C.; Chavarriaga-Aguirre, P.; Duque, M.C.; Maya, M.M.; Bonierbale, M.W.; Iglesias, C.; Tohme, J. Cross-species amplication of cassava (Manihot esculenta) (Euphorbiaceae) microsatellites: Allelic polymorphism and degree of relationship. Am. J. Bot 2000, 87, 1647–1655. [Google Scholar]
- Rossetto, M. Sourcing of SSR Markers from Related Plant Species. In Plant Genotyping—The DNA Fingerprinting of Plant; Henry, R.J., Ed.; CABI Publishing: New York, NY, USA, 2001; pp. 211–224. [Google Scholar]
- Wu, K.S.; Tanksley, S.D. Abundance, polymorphism and genetic mapping of microsatellites in rice. Mol. Gen. Genet 1993, 241, 225–235. [Google Scholar]
- Sefc, K.M.; Lopes, M.S.; Mendon, D.; Dos Santos, M.R.; da Camara Machado, M.L.; da Camara Machado, A. Identification of microsatellite loci in olive (Olea europaea) and their characterization in Italian and Iberian olive trees. Mol. Ecol 2000, 9, 1171–1173. [Google Scholar]
- Hodgetts, R.B.; Aleksiuk, M.A.; Brown, A.; Clarke, C.; Macdonald, E.; Nadeem, S.; Khasa, D. Development of microsatellite markers for white spruce (Picea glauca) and related species. Theor. Appl. Genet 2001, 102, 1252–1258. [Google Scholar]
- Liewlaksaneeyanawin, C.; Ritland, C.E.; El-Kassaby, Y.A.; Ritland, K. Single-copy, species-transferable microsatellite markers developed from loblolly pine ESTs. Theor. Appl. Genet 2004, 109, 361–369. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol 2000, 132, 365–386. [Google Scholar]
- Yeh, F.C.; Boyle, T.J.B. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belg. J. Bot 1997, 129, 157. [Google Scholar]
- Nei, M.; Takezaki, N. Estimation of genetic distances and phylogenetic trees from DNA analysis. Proceedings of the 5th World Congress on Genetics Applied to Livestock Production, Guelph, Canada, 7–12 August 1994, University of Guelph: Guelph, Canada, 1994; Volume 21, pp. 405–412. [Google Scholar]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar]
- Sneath, P.H.A.; Sokal, R.R. Numerical Taxonomy: The Principles and Practice of Numerical Classification; W. H. Freeman: San Francisco, CA, USA, 1973. [Google Scholar]
- Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol 2007, 24, 1596–1599. [Google Scholar]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser 1999, 41, 95–98. [Google Scholar]
SSR Motif | Number of Repeat Units | Total | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | >15 | ||
Mononucleotide | |||||||||||||
A/T | - | - | - | - | - | 101 | 78 | 60 | 37 | 29 | 28 | 95 | 428 |
C/G | - | - | - | - | - | 2 | 3 | - | 1 | - | - | 3 | 9 |
Di-nucleotide | |||||||||||||
AC/GT | - | - | 4 | 2 | 1 | 2 | 1 | - | - | - | - | 10 | |
AG/CT | - | - | 7 | 8 | 7 | 3 | 9 | 1 | 1 | 6 | 2 | 5 | 49 |
AT/AT | - | - | 6 | 5 | 5 | 6 | 6 | 2 | 2 | - | 2 | 12 | 46 |
Tri-nucleotide | |||||||||||||
AAC/GTT | - | 2 | - | - | - | - | - | - | - | - | - | - | 2 |
AAG/CTT | 9 | 4 | 3 | - | 1 | 1 | 1 | 1 | - | - | - | 20 | |
AAT/ATT | 1 | 3 | 2 | 1 | - | 1 | 1 | 1 | - | - | - | 10 | |
ACC/GGT | - | 1 | - | - | - | - | - | - | - | - | - | - | 1 |
AGG/CCT | 5 | 2 | - | - | - | - | - | - | - | - | - | - | 7 |
Tetra-nucleotide | |||||||||||||
AAAC/GTTT | - | - | - | 1 | - | - | - | - | - | - | - | - | 1 |
AAAG/CTTT | 1 | - | - | - | - | - | - | - | - | - | - | 1 | |
AAAT/ATTT | 1 | 3 | - | - | - | - | - | - | - | - | - | 4 | |
AATT/AATT | - | 1 | - | - | - | - | - | - | - | - | - | 1 | |
ACAT/ATGT | - | - | - | 1 | - | 1 | - | - | - | - | - | - | 2 |
AGCT/ATCG | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
Penta-nucleotide | |||||||||||||
AAAAG/CTTTT | 3 | 1 | - | - | - | - | - | - | - | - | - | - | 4 |
AAAAT/ATTTT | 3 | - | - | - | - | - | - | - | - | - | - | - | 3 |
AGGGG/CCCCT | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
Hexa-nucleotide | |||||||||||||
AGAGGG/CCCTCT | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
Hepta-nukleotide | |||||||||||||
AAACCCT/ATTTGGG | - | - | - | - | - | - | - | - | - | - | - | 2 | 2 |
N (Mono-) | - | - | - | - | - | 103 | 81 | 60 | 38 | 29 | 28 | 99 | 437 |
NN (Di-) | - | - | 17 | 15 | 13 | 11 | 15 | 4 | 3 | 6 | 4 | 17 | 105 |
NNN (Tri-) | 15 | 12 | 5 | 1 | 1 | 1 | 1 | 2 | 2 | - | - | - | 40 |
NNNN (Tetra-) | 3 | 4 | - | 2 | - | 1 | - | - | - | - | - | - | 10 |
NNNNN (Penta-) | 7 | 1 | - | - | - | - | - | - | - | - | - | - | 8 |
NNNNNN (Heksa-) | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
NNNNNNN(Hepta-) | - | - | - | - | - | - | - | - | - | - | - | 2 | 2 |
Total | 603 |
Primer ID | Primer Sequence (5′-3′) (F: Forward; R: Reverse) | SSR Motif | Ta (°C) | Amplicon (bp) | Accession No. (ProbeDB) | Allele No. | PIC |
---|---|---|---|---|---|---|---|
Di-nucleotide | |||||||
sMo00018 | F: TTAAATGAGAGAGAGACGAGGAC R: TGGAGCCATGAGAAAGAGTA | (CT)14 | 54 | 246 | Pr009947963 | 6 | 0.555 |
sMo00020 | F: CCTTTCTCTCCCTCTCCTTTTG R: CCTCCCTCCCTCTCACCATA | (AG)15 | 58 | 190 | Pr009947964 | 12 | 0.824 |
sMo00024 | F: TCACCAAAGCAGAAGAAACA R: GGTGTTGATAATTGCCTGAA | (AT)28 | 54 | 223 | Pr010315683 | - | - |
sMo00027 | F: TTACAGTTGAGGCAGTATGTCAAT R: CTGTATGTCAAACCTTCTGCAC | (TC)14 | 50 | 209 | Pr009947965 | 6 | 0.574 |
sMo00055 | F: GGCATTTCAGATAACGACAAA R: GCACCCAAGTCTCTCTACCTC | (GA)11 | 54 | 202 | Pr010315684 | 5 | 0.243 |
sMo00108 | F: AGCTTCAATTCATACGCAAC R: TGTTATATGTGACTACCAGAGCA | (AT)19 | 53 | 170 | Pr010315685 | 1 | 0 |
Mean | 6.0 | 0.549 | |||||
Tri-nucleotide | |||||||
sMo00127 | F: GTGGTTTGGGAGAAAGAGTGT R: TGCGGTGGATTAGCATTATT | (GAA)12 | 56 | 205 | Pr010315686 | - | - |
sMo00128 | F: TAGCTCCAACAGCTTGCCTTAT R: GGTCCCGTCCTATGATTTATTCT | (AAT)12 | 56 | 192 | Pr009947966 | 6 | 0.654 |
sMo00129 | F: TTAGTATTGGGTGTGCATAAGTGG R: GCTTCCAGCTCCTCTTTCTACC | (TTC)13 | 56 | 229 | Pr009947967 | 8 | 0.786 |
sMo00130 | F: TAAGCAAAAGATCAGGGCACTC R: GGCTGGTGAAAATAGGTTTACAAAG | (AAG)11 | 56 | 192 | Pr009947968 | 13 | 0.801 |
sMo00132 | F: ATAGCCAGAGGGCAAAACTGT R: GCAACACACGGACTCAAAACTA | (TTA)13 | 56 | 161 | Pr009947969 | 4 | 0.264 |
Mean | 7.8 | 0.626 | |||||
Tetra-nucleotide | |||||||
sMo00134 | F: TCCCAATAGTCGTTACAAACCAG R: GATTAGCAAAAGGGCAAAAAGG | (ATTA)6 | 56 | 252 | Pr009947970 | 2 | 0.338 |
sMo00137 | F: AGGAAGGAGAAGGAGATGAACAG R: CTTTGGATTTGAGCAGAGGAAG | (AAAT)6 | 54 | 151 | Pr010315687 | 3 | 0.141 |
Mean | 2.5 | 0.240 | |||||
Penta-nucleotide | |||||||
sMo00138 | F: AGGGTTGTCGCTCCAATTTAT R: GGCATCTTTTTGACCTGTAGAAG | (TTTTC)6 | 56 | 190 | Pr009947971 | 5 | 0.498 |
sMo00140 | F: TTAGATCATTTCCCTTGCTTCG R: CGCTGGTCCTGATAACACATT | (AAAAT)5 | 56 | 216 | Pr010315688 | 1 | 0 |
sMo00141 | F: ACTTGACATACAGGTTCCACTGA R: CCTGCTACCTCCTAATTCTATCAAA | (TTCTT)5 | 56 | 174 | Pr010317029 | 2 | 0.218 |
sMo00147 | F: TACCCAATCCCACCGAGTTA R: CGTCTCCACTGAACCACAAAA | (AAAAG)5 | 54 | 240 | Pr010317030 | 3 | 0.225 |
Mean | 2.75 | 0.314 | |||||
Compound | |||||||
sMo00152 | F: GGAACAGAGGACAAGAAAGAAA R: TGTATCAAGCCTCAAGTATCTGG | (AC)6(AG)11 | 56 | 255 | Pr009947972 | 3 | 0.209 |
sMo00154 | F: CAAAAGGGTTGTTTGTATACGTG R: TGCATGAATATCCTCTCAAAGTTAC | (TG)7cgcgcgtgtgcgcgtg(TA)8 | 54 | 161 | Pr010317031 | 8 | 0.349 |
sMo00161 | F: ACTGTTTCGTCAAGCATTTG R: ATCAAGAGAAGGTCGTGTCAG | (TG)8(AG)8 | 54 | 163 | Pr010317032 | 1 | 0 |
Mean | 4.0 | 0.279 |
Country | N | Ao | P (%) | Ho (SD) | He (SD) | Fis |
---|---|---|---|---|---|---|
E. oleifera | ||||||
Colombia | 29 | 2.56 | 50.0 | 0.200 (0.263) | 0.275 (0.325) | 0.273 * |
Costa Rica | 34 | 3.00 | 55.6 | 0.160 (0.223) | 0.253 (0.316) | 0.368 * |
Panama | 34 | 2.89 | 55.6 | 0.193 (0.264) | 0.310 (0.325) | 0.377 * |
Honduras | 22 | 2.17 | 50.0 | 0.102 (0.197) | 0.210 (0.260) | 0.514 * |
Mean | 2.66 | 52.8 | 0.164 (0.238) | 0.262 (0.307) | 0.383 | |
E. guineensis | ||||||
Deli dura | 10 | 2.07 | 44.4 | 0.118 (0.171) | 0.260 (0.282) | 0.546 * |
Nigeria | 10 | 2.47 | 50.0 | 0.321 (0.362) | 0.329 (0.305) | 0.024 |
Mean | 2.27 | 47.2 | 0.220 (0.267) | 0.295 (0.294) | 0.285 |
Genus | Elaeis | Cocos | Oenocarpus | Euterpe | Jessenia | Ptychosperma | Cyrtostachys | Dictyosperma | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Species | oleifera | guineensis | Nucifera | multicaulis-Spruce | oleracea | bataua | Macarthurii | renda Blume | album | ||||
SSR locus | Colombia | Costa Rica | Nigeria | Deli dura | Cocos nucifera (Yellow) | Cocos nucifera (Red) | Cocos nucifera (Green) | Oenocarpus multicaulis-Spruce | Euterpe oleracea | Jessenia bataua | Ptychosperma Macarthurii | Cyrtostachys renda Blume | Dictyosperma album |
sMo00020 | 191 | 200 | 184 | 190 | 210 | 218 | 219 | - | NA | NA | 188 | NA | NA |
sMo00027 | 212 | 210 | 200 | 200 | 300 | 300 | 300 | 226 | 226 | 224 | NA | 260 | 200 |
sMo00055 | 200 | 200 | 188 | 188 | 195 | 195 | 195 | 190 | 190 | 190 | 190 | 190 | 190 |
sMo00129 | 222 | 230 | 204 | 204 | 178 | 178 | 178 | 180 | NA | NA | NA | NA | NA |
sMo00130 | 192 | 192 | 176 | 184 | 176 | 176 | 176 | 188 | 188 | 188 | - | 208 | 184 |
sMo00134 | 252 | 252–260 | 252 | 252 | 252–260 | 252–260 | 252–260 | - | 252–260 | - | 252–260 | - | - |
sMo00137 | 151 | 151 | 154–162 | 162 | 140 | 138 | 140 | 150 | 140 | 151 | 142 | 146 | 142 |
sMo00138 | 190–206 | 200 | 184–198 | 198 | 208 | 218 | 208 | - | - | NA | 186 | NA | NA |
sMo00140 | 214 | 214 | 204 | 204 | 184 | 184 | 184 | 204 | 204 | - | - | - | 204 |
sMo00141 | 176 | 176 | 250–260 | 250–260 | 176 | 176 | 176 | NA | 260 | 260 | NA | NA | NA |
sMo00154 | 160 | 160 | 238 | 232 | 160 | 160 | 160 | 160 | 160 | 160 | 160 | 160 | NA |
Genus | Species | Full Name | Origin | No. of Palms |
---|---|---|---|---|
Elaeis | Oleifera | Elaeis oleifera | Colombia | 29 |
Costa Rica | 34 | |||
Panama | 34 | |||
Honduras | 22 | |||
Sub-total | 119 | |||
Elaeis | guineensis | Elaeis guineensis | Nigeria | 10 |
Deli dura | 10 | |||
Sub-total | 20 | |||
Cocos | Nucifera | Cocos nucifera | Solomon Islands | 3 |
Euterpe | Oleracea | Euterpe oleracea | South America | 2 |
Jessenia | Bataua | Jessenia bataua | Mart. South America | 1 |
Oenocarpus | multicaulis-spruce | Oenocarpus multicaulis Spruce | North-western South America, | 1 |
Ptychosperma | macarthurii | Ptychosperma macarthurii | Northeastern Australia | 1 |
Cyrtostachys | renda Blume | Cyrtostachys renda Blume | Malaysia, Indonesia | 1 |
Dictyosperma | Album | Dictyosperma album | Mauritius | 1 |
Sub-total | 10 | |||
Total | 149 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zaki, N.M.; Singh, R.; Rosli, R.; Ismail, I. Elaeis oleifera Genomic-SSR Markers: Exploitation in Oil Palm Germplasm Diversity and Cross-Amplification in Arecaceae. Int. J. Mol. Sci. 2012, 13, 4069-4088. https://doi.org/10.3390/ijms13044069
Zaki NM, Singh R, Rosli R, Ismail I. Elaeis oleifera Genomic-SSR Markers: Exploitation in Oil Palm Germplasm Diversity and Cross-Amplification in Arecaceae. International Journal of Molecular Sciences. 2012; 13(4):4069-4088. https://doi.org/10.3390/ijms13044069
Chicago/Turabian StyleZaki, Noorhariza Mohd, Rajinder Singh, Rozana Rosli, and Ismanizan Ismail. 2012. "Elaeis oleifera Genomic-SSR Markers: Exploitation in Oil Palm Germplasm Diversity and Cross-Amplification in Arecaceae" International Journal of Molecular Sciences 13, no. 4: 4069-4088. https://doi.org/10.3390/ijms13044069