Isolation and Characterization of 21 Microsatellite Loci in Cardiocrinum giganteum var. yunnanense (Liliaceae), an Important Economic Plant in China
1
Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, Yunnan, China
2
Key Laboratory of Tropical Forest Ecology, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Mengla 666303, Yunnan, China
3
Pharmacy and Inspection Department, Sichuan Traditional Chinese Medicine College, Mianyang 621000, Sichuan, China
4
The Germplasm Bank of Wild Species in Southwest China, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, Yunnan, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2012, 13(2), 1437-1443; https://doi.org/10.3390/ijms13021437
Submission received: 31 December 2011
/
Revised: 16 January 2012
/
Accepted: 17 January 2012
/
Published: 31 January 2012
(This article belongs to the Section Biochemistry)
Abstract
:Twenty-one microsatellite markers from the genome of Cardiocrinum giganteum var. yunnanense, an important economic plant in China, were developed with a fast isolation protocol by amplified fragment length polymorphism of sequences containing repeats (FIASCO). Polymorphism within each locus was assessed in 24 wild individuals from Gaoligong Mountains in western Yunnan Province, China. The number of alleles per locus ranged from 2 to 4 with a mean of 2.9. The expected and observed levels of heterozygosity ranged from 0.042 to 0.726 and from 0.000 to 1.000, with averages of 0.44 and 0.31, respectively. These polymorphic microsatellite markers should prove useful in population genetics studies and assessments of genetic variation to develop conservation and management strategies for this species.
1. Introduction
The herbaceous perennial genus Cardiocrinum (Endlicher) Lindley is a member of the lily family (Liliaceae) and contains three species and one variety, namely Cardiocrinum cathayanum (E. H. Wilson) Stearn, C. cordatum (Thunb.) Makino, C. giganteum (Wall.) Makino, and C. giganteum var. yunnanense (Leichtlin ex Elwes) Stearn [1]. All the species are characterized by ovate-cordate leaves with reticulate veins, and terminal racemes with many large flowers [2].
Cardiocrinum giganteum var. yunnanense is a perennial herb and mainly distributed in Gansu, Guangdong, Guangxi, Guizhou, Henan, Hubei, Hunan, Shaanxi, Sichuan, and Yunnan provinces of China and adjacent regions of Myanmar [3]. It grows in forests at altitudes ranging from 1200 to 3600 m elevation [3]. With its attractive flowers (Figure 1), this species has attracted the attention of botanists and horticulturalists, who have taken an interest in the commercial development of this species as an ornamental resource [4]. It is an important economic plant in China. The seeds are used as a replacement for Aristolochia fruits to treat cough [5], and bulbs are used as a starch staple by the local people in Guangxi and Yunnan [6]. Its economic attributes have made Cardiocrinum giganteum var. yunnanense at risk of overexploitation of natural populations. Moreover, its habitat has been badly degraded and fragmented due to heavy logging and forest destruction in past decades, which has reduced the distribution of this species to a fragmented range with small populations [7].
To provide effective conservation and management strategies for this important economic plant, it is necessary to understand the spatial genetic structure, genetic diversity, and levels of gene flow within and among its populations. However, in the genus Cardiocrinum, except 13 microsatellite loci were developed from the genome of C. cordatum [8], no nuclear microsatellite primers or other types of markers have been reported for C. giganteum var. yunnanense. Microsatellites show numerous advantages over other fingerprinting methods such as RAPD, ALFP, and ISSR because they are locus-specific, codominant, highly reproducible, and usually highly polymorphic [9]. Hence, we have developed and characterized 21 microsatellite markers for Cardiocrinum giganteum var. yunnanense, which will facilitate further investigations on the genetic diversity, population structure, and gene flow of this species.
2. Results and Discussion
In total, 273 positive clones were sequenced. A total of 223 (82%) sequences were found to contain simple sequence repeats (SSRs); 114 of these with appropriate microstellite and sufficient flanking regions were selected to design locus-specific primers. Polymorphisms of all 114 microsatellite loci were assessed in 24 wild individuals. Of these primers, 30 successfully amplified the target regions, and 21 of them displayed polymorphisms and 9 showed monomorphism (Table 1). The number of alleles per locus ranged from 2 to 4, with a mean of 2.9. The expected (HE) and observed (HO) heterozygosities ranged from 0.042 to 0.726 and from 0.000 to 1.000, with average of 0.44 and 0.31, respectively (Table 2). Among 21 microstellite markers, 16 loci showed significant deviation from Hardy-Weinberg equilibrium (HWE) (P < 0.01) (Table 2), probably due to heterozygote deficiency or the limitation of sample size, also because of the presence of null alleles. Twenty-eight loci pairwise (13.3%) showed significant genotypic linkage disequilibrium (LD) between pairs of loci (P < 0.001).
3. Experimental Section
3.1. Isolation of Microsatellite Loci
Genomic DNA was extracted from silica-gel-dried leaves by following a CTAB method and the microsatellite loci were isolated by using the fast isolation by AFLP of sequences containing repeats (FIASCO) protocol [10,11]. Approximately 500 ng of total genomic DNA was digested with MseI enzyme (New England Biolabs, Beberly, MA, USA), and then fragments were ligated to the MseI AFLP adaptor pair (5′-TACTCAGGACTCAT-3′/5′-GACGATGAGTCCTGAG-3′) at 37 °C for 2 h with T4 DNA ligase (Fermentas, Burlington, ON, Canada).
A diluted digestion-ligation mixture (1:10) was amplified with the adaptor-specific primers MseI-N (5′-GATGAGTCCTGAGTAAN-3′) by following the program: 95 °C for 3 min, 30 cycles of 94 °C for 30 s, 53 °C for 60 s, 72 °C for 60 s followed by an elongation step of 5 min at 72 °C. Amplified fragments with a size range of 200–800 bp were enriched for microsatellite repeats by magnetic bead selection with 5′-biotinylated (AC)15, (AG)15, and (AAG)10 probes. Captured fragments were re-amplified with adaptor-specific primers. Polymerase chain reaction (PCR) products were purified by using an EZNA Gel Extraction Kit (Omega Bio-Tek, Guangzhou, China).
The purified PCR products with enriched microsatellite repeats were ligated into the pGEM-T vector (Promega, USA), and transformed into DH5α cells (TaKaRa, Dalian, China). Recombinant clones were screened by blue/white selection and the positive clones were tested by PCR with (AC)10/(AG)10/(AAG)7 and T7/Sp6 primers. The clones with positive inserts were sequenced with an ABI PRISM 3730XL DNA sequencer (Applied Biosystems, Foster City, CA, USA). The program Oligo 6.0 was used to design locus-specific primers for those microsatellite sequences found to containt sufficient flanking regions [12].
3.2. Detection of Polymorphism
Polymorphisms of microsatellite loci were evaluated in 24 wild individuals of Cardiocrinum giganteum var. yunnanense from Gaoligong Mountains (24°40′–28°30′ N, 98°11.2′–98°47.5′ E) in western Yunnan province. Polymerase chain reactions (PCR) were performed in 20 μL of reaction containing 30–50 ng genomic DNA, 0.6 μM of each primer, 7.5 μL 2× Taq PCR MasterMix [Tiangen (Tiangen, Beijing China); 0.1 U Taq Polymerase/μL, 0.5 mM dNTP each, 20 mM Tris-HCl (pH = 8.3), 100 mM KCl, 3 mM MgCl2]. PCR amplifications were conducted under the following program: 95 °C for 3 min followed by 30–36 cycles at 94 °C for 30 s, with the annealing temperature optimized for each specific primer (Table 1), for 30 s, 72 °C for 60 s, and a final extension step at 72 °C for 7 min. The amplified fragments were separated on 6% polyacrylamide denaturing gels with a 20-bp ladder molecular size standard (Fermentas, Burlington, Ontario, Canada) by silver staining.
3.3. Data Analysis
Standard genetic diversity parameters of polymorphic loci, e.g., the number of alleles (NA), and expected (HE) and observed levels of heterozygosity. We also estimated deviations from Hardy-Weinberg equilibrium (HWE) and genotypic linkage disequilibrium (LD) between pairs of loci using Chi-square tests.
4. Conclusions
The 21 microsatellite markers developed in this study are the first set of such markers for Cardiocrinum giganteum var. yunnanense. They should prove useful for further investigating the spatial genetic structure, genetic diversity, and levels of gene flow within and among populations of this species, which will help to develop viable strategies for the conservation and management of this important economic plant.
Acknowledgments
This work was supported by knowledge innovation engineering of the Chinese Academy of Sciences (grant no. 2010KIBA06) and Natural Science Foundation of Mianyang (grant no. 09S002-7). This study was conducted in the Laboratory of Molecular Biology at the Germplasm Bank of Wild Species in Southwest China, Kunming Institute of Botany, Chinese Academy of Sciences. Laboratory assistance was provided by Zhirong Zhang. We thank Zhixue Yang and Yuhua Li for collecting samples.
References
- Mabberley, D.J. Mabberley’s Plant-book: A Portable Dictionary of Plants, Their Classification and Uses; Cambridge University Press: New York, NY, USA, 2008; p. 151. [Google Scholar]
- Wu, Z.Y.; Lu, A.M.; Tang, Y.C.; Chen, Z.D.; Li, D.Z. The Families and Genera of Angiosperms in China, A Comprehensive Analysis; Science Press: Beijing, China, 2003; p. 256. [Google Scholar]
- Liang, S.; Tamura, M.N. Cardiocrinum. In Flora of China; Wu, Z.Y., Raven, P.H., Eds.; Science Press: Beijing, China; Missouri Botanical Garden Press: St. Louis, MO, USA, 2000; Volume 24, pp. 134–135. [Google Scholar]
- Zhang, J.Z.; Long, Y.Y.; Sun, G.F. Biodiversity of Cardiocrinum giganteum and observation during its introduction. Acta Hortic. Sin 2002, 29, 462–466. [Google Scholar]
- Li, M.; Ling, K.H.; Lam, H.; Shaw, P.C.; Cheng, L.; Techen, N.; Khan, L.A.; Chang, Y.S.; But, P.P. Cardiocrinum seeds as a replacement for Aristolochia fruits in treating cough. J. Ethnopharmacol 2010, 130, 429–432. [Google Scholar]
- Li, H. Cardiocrinum. In Flora Yunnanica; Wu, Z.Y., Ed.; Science Press: Beijing, China, 1997; Volume 7, pp. 787–789. [Google Scholar]
- Li, R.; Dao, Z.L.; Li, H. Seed plant species diversity and conservation in the northern Gaoligong mountains in western Yunnan, China. Mt. Res. Dev 2011, 31, 160–165. [Google Scholar]
- Molecular Ecology Resources Primer Development Consortium. Permanent genetic resources added to molecular ecology resources database 1 August 2009–30 September 2009. Mol. Ecol. Resour. 2010, 10, 232–236.
- Powell, W.; Morgante, M.; Andre, C.; Hanafey, M.; Vogel, J.; Tingey, S.; Rafalski, A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed 1996, 2, 119–122. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of leaf tissue. Phytochem. Bull 1987, 19, 11–15. [Google Scholar]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: a review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
- Offerman, J.; Rychlik, W. Oligo Primer Analysis Software. In Introduction to Bioinformatics: A Theoretical and Practical Approach; Krawetz, S., Womble, D., Eds.; Humana Press: Totowa, NJ, USA, 2003; pp. 345–361. [Google Scholar]
Figure 1.
Inflorescence of Cardiocrinum giganteum var. yunnanense, showing the attractive flowers.
| Locus | Primer sequences (5′-3′) | Repeat motif | Size range (bp) | Ta (°C) | GenBank Accession No. |
|---|---|---|---|---|---|
| CGY003 * | F: TATGGAGGGTTCTATTGCC | (AG)9 | 214–223 | 52 | JQ340036 |
| R: GGTTTCAGAGTTCATTGGAT | |||||
| CGY005 | F: AAAGGAGGGGAAGGCATAGT | (AG)5AT(AG)5 | 257 | 55 | JQ340037 |
| R: CTAAGAGACCGCCTCCTCAT | |||||
| CGY006 * | F: TGGTATTGTCAGAATCTCAT | (TG)10(AG)13 | 169–182 | 50 | JQ340038 |
| R: AGGTTGTTGGGTGGAGTAGT | |||||
| CGY007 * | F: TGTGTGAGTTTGAGCATAAT | (AG)15 | 130–145 | 52 | JQ340039 |
| R: CGGATACTCAGTGAACCTAC | |||||
| CGY011 * | F: ACAATAACCCCAGTAGACC | (AG)14 | 164–168 | 55 | JQ340040 |
| R: TGGGTGCTCATCAAGTGTC | |||||
| CGY012 * | F: CGAACTGAACATTGAGAAGA | (AG)15 | 119–127 | 50 | JQ340041 |
| R: ATTACACTCTGACAACACCG | |||||
| CGY015 | F: TCTCAAGTAAATCCAACAAAT | (AG)16 | 156 | 50 | JQ340042 |
| R: AAGGTATTGGAATGGCGAT | |||||
| CGY028 * | F: ATGAGAAAGAGAGATGAAAG | (AG)13 | 147–153 | 48 | JQ340043 |
| R: TAAAGTGTGTGTAGGTGGAG | |||||
| CGY029 * | F: TTCATTATCATCTCGGACAC | (TG)7(AG)14 | 157–165 | 48 | JQ340044 |
| R: AGAAGGTCAACCGAACACAT | |||||
| CGY031 * | F: ACTCCTCTACCCTTTCACCA | (AG)9 | 163–173 | 48 | JQ340045 |
| R: CATGATATTTATACTGAGGTTCT | |||||
| CGY035 | F: AACAAAAGAAAGCAGTAGAA | (TC)11 | 184 | 48 | JQ340046 |
| R: TATGATAGAGCAAAAGAGGG | |||||
| CGY036 * | F: TATCGCCTTCTTACACTTA | (AG)18 | 178–182 | 50 | JQ340047 |
| R: TGAGCCGATTCCTACATTTT | |||||
| CGY037 | F: TCCAAGAGAGAAAGCATCAA | (TC)9 | 144 | 50 | JQ340048 |
| R: ATGGCAGAATCACAATAAGT | |||||
| CGY043 * | F: TTTCAGCCACCCTCACTATT | (AG)8 | 180–186 | 50 | JQ340049 |
| R: CTCCTATTTTTACAAGACGC | |||||
| CGY053 * | F: TGCCAGAAAAGAATCACAA | (AG)11 | 144–152 | 50 | JQ340050 |
| R: ATGACCCTTCCTAATTCG | |||||
| CGY054 * | F: ACCCAAATAAAGTAACAGACCA | (TC)16 | 197–207 | 57 | JQ340051 |
| R: TGCCCCATCACATCCCCACC | |||||
| CGY058 * | F: GTAGTTTCCTTCATCGCCTT | (TC)15 | 243–251 | 57 | JQ340052 |
| R: CCACACAGGGAGGCATCTTT | |||||
| CGY064 * | F: TATTTCTTATTCTTCACCTC | (AG)14 | 121–127 | 47 | JQ340053 |
| R: AAAACCAATAAAATCCCTC | |||||
| CGY065 * | F: CCGTTGGGATTATGAGTATT | (TC)19 | 167–175 | 50 | JQ340054 |
| R: CAGCATAGAGCATAGCCCTT | |||||
| CGY066 * | F: TGGAGAGATTCAGGTTCATA | (AG)14 | 218–230 | 52 | JQ340055 |
| R: GAGACCATACATCACTAAATCA | |||||
| CGY067 | F: GTGACCTTAGGAGTATATTAGC | (AG)10 | 237 | 55 | JQ340056 |
| R: CGGAAATGGCTACTAACTAAGA | |||||
| CGY072 | F: AGATGAAGGAGTAGGGACAA | (TC)8 | 305 | 55 | JQ340057 |
| R: CAAACTCCCACTCACCATTC | |||||
| CGY073 * | F: GTCTCCCTCCTTCTCAAAAT | (TC)7 | 250–258 | 55 | JQ340058 |
| R: CTTCTTGCCCCCACTAACTT | |||||
| CGY075 * | F: GCCATAGAGACATAGGGAGG | (AG)19 | 213–221 | 55 | JQ340059 |
| R: ATGAAACCTGACCTAAGCAC | |||||
| CGY083 * | F: CCTACTCATTTTTCAACTTTC | (TG)13 | 290–298 | 52 | JQ340060 |
| R: GCCCATTCCCAACCACTATT | |||||
| CGY091 * | F: TGGACACATTTTTGGCTAAG | (AC)5AT(AC)11 | 120–132 | 50 | JQ340061 |
| R: CGACGATTAGGGCAAAGGTA | |||||
| CGY099 | F: TCATTCCACTCCACCATAAA | (AC)12 | 119 | 50 | JQ340062 |
| R: ATACCTAACCATCTTCCAAT | |||||
| CGY105 | F: CCCAAAAATAATCATCAAGC | (AC)7 | 152 | 52 | JQ340063 |
| R: CACCTACCCTGCTTTGTTCA | |||||
| CGY110 * | F: ATAGTGTAGCAGTGAAGCGA | (TG)7 | 115–119 | 57 | JQ340064 |
| R: TGTGGTTGGTTTCTCATTGC | |||||
| CGY111 | F: TGACACCCCCATACTTAGAC | (TG)7 | 115 | 50 | JQ340065 |
| R: TCTCATCACTCTATCTCATT |
Ta: PCR annealing temperature;
*displayed polymorphisms.
Table 2.
Result of 21 polymorphic microsatellite loci screening in 24 wild individuals of Cardiocrinum giganteum var. yunnanense.
| Locus | NA | HE | HO | Fis | Locus | NA | HE | HO | Fis | ||
|---|---|---|---|---|---|---|---|---|---|---|---|
| W&C | R&H | W&C | R&H | ||||||||
| CGY003 * | 2 | 0.042 | 0.042 | – | – | CGY054 * | 2 | 0.042 | 0.042 | – | – |
| CGY006 * | 3 | 0.434 | 0.042 | 0.906 | 0.493 | CGY058 * | 3 | 0.543 | 0.917 | −0.715 | −0.411 |
| CGY007 | 4 | 0.611 | 0.875 | −0.446 | −0.243 | CGY064 * | 2 | 0.550 | 0.083 | 0.851 | 0.486 |
| CGY011 * | 4 | 0.621 | 0.292 | 0.536 | 0.370 | CGY065 * | 3 | 0.657 | 0.125 | 0.813 | 0.882 |
| CGY012 * | 4 | 0.726 | 0.458 | 0.374 | 0.439 | CGY066 * | 2 | 0.156 | 0 | 1.000 | 1.044 |
| CGY028 | 4 | 0.482 | 0.292 | 0.401 | 0.357 | CGY073 * | 2 | 0.337 | 0 | 1.000 | 1.044 |
| CGY029 * | 3 | 0.635 | 0.083 | 0.871 | 0.928 | CGY075 * | 3 | 0.511 | 0 | 1.000 | 1.044 |
| CGY031 * | 2 | 0.350 | 0.083 | 0.766 | 0.847 | CGY083 * | 3 | 0.624 | 1 | −0.624 | −0.489 |
| CGY036 | 3 | 0.254 | 0.125 | 0.514 | 0.531 | CGY091 * | 2 | 0.042 | 0.042 | – | – |
| CGY043 | 3 | 0.669 | 0.583 | 0.131 | 0.155 | CGY110 | 3 | 0.465 | 0.417 | 0.107 | −0.068 |
| CGY053 * | 3 | 0.566 | 1 | −0.795 | −0.489 | ||||||
NA: number of alleles; HE: expected heterozygosity; HO: observed heterozygosity; Fis: estimates of inbreeding coefficient; W&C: Weir and Cockerham’s method; R&H: Robertson and Hill’s method;
*statistically significant deviation from Hardy-Weinberg equilibrium (HWE) (P < 0.01).
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
MDPI and ACS Style
Li, R.; Yang, J.; Yang, J.; Dao, Z. Isolation and Characterization of 21 Microsatellite Loci in Cardiocrinum giganteum var. yunnanense (Liliaceae), an Important Economic Plant in China. Int. J. Mol. Sci. 2012, 13, 1437-1443. https://doi.org/10.3390/ijms13021437
AMA Style
Li R, Yang J, Yang J, Dao Z. Isolation and Characterization of 21 Microsatellite Loci in Cardiocrinum giganteum var. yunnanense (Liliaceae), an Important Economic Plant in China. International Journal of Molecular Sciences. 2012; 13(2):1437-1443. https://doi.org/10.3390/ijms13021437
Chicago/Turabian StyleLi, Rong, Jie Yang, Junbo Yang, and Zhiling Dao. 2012. "Isolation and Characterization of 21 Microsatellite Loci in Cardiocrinum giganteum var. yunnanense (Liliaceae), an Important Economic Plant in China" International Journal of Molecular Sciences 13, no. 2: 1437-1443. https://doi.org/10.3390/ijms13021437
APA StyleLi, R., Yang, J., Yang, J., & Dao, Z. (2012). Isolation and Characterization of 21 Microsatellite Loci in Cardiocrinum giganteum var. yunnanense (Liliaceae), an Important Economic Plant in China. International Journal of Molecular Sciences, 13(2), 1437-1443. https://doi.org/10.3390/ijms13021437
