Next Article in Journal
Microencapsulated Hydroxyapatite–TEGDMA Systems for Self-Healing in Dental Applications
Previous Article in Journal
Recent Advances in Titanium-Based Metal–Organic Frameworks: Structure, Property, and Application in Photocatalysis
Previous Article in Special Issue
Strategies to Determine and Mitigate Pesticide Residues in Food
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Camellia sinensis Seed Flavonoids Attenuate UVB-Induced Inflammation and UVA-Induced Photodamage via MAPK/NF-κB and AP-1 Pathways

1
Key Laboratory of Synthetic and Biological Colloids, Ministry of Education, School of Chemical & Material Engineering, Jiangnan University, Wuxi 214122, China
2
Guangzhou Huashi Cosmetics Technology Co., Ltd., Guangzhou 510000, China
*
Authors to whom correspondence should be addressed.
Molecules 2026, 31(5), 871; https://doi.org/10.3390/molecules31050871
Submission received: 17 January 2026 / Revised: 23 February 2026 / Accepted: 3 March 2026 / Published: 5 March 2026

Abstract

This study evaluated the anti-inflammation and anti-photoaging effects of Camellia sinensis seed flavonoids (CSF) against UVB and UVA irradiation and elucidated the underlying mechanisms. Using UVB-irradiated human keratinocytes and UVA-irradiated human dermal fibroblasts, we found that CSF significantly reduced intracellular ROS and suppressed the secretion of inflammatory factors (PGE-2, TNF-α, IL-6, IL-8) by inhibiting the p38/JNK and NF-κB pathways, along with iNOS and COX-2 expression. In keratinocytes, CSF also downregulated Caspase-3 and upregulated barrier proteins filaggrin and Claudin-1. In fibroblasts, CSF counteracted UVA damage by upregulating collagen IV and XVII at the dermo-epidermal junction and enhancing the production of collagen I, III, and hyaluronic acid in the dermis, mediated via AP-1 inhibition and TGF-β/Smad pathway modulation. These results demonstrate that CSF coordinated anti-inflammatory, barrier-repair, and anti-photoaging actions, highlighting its potential as a promising skincare ingredient.

Graphical Abstract

1. Introduction

Solar ultraviolet (UV) radiation represents a major environmental factor contributing to acute and chronic skin damage, leading to skin health problems with reactions such as sunburn and long-term outcomes like photoaging [1,2,3]. UV radiation, particularly UV-B (280–315 nm) and UV-A (315–400 nm), has a high penetration capacity and induces reactive oxygen species (ROS) generation, causing DNA damage and influence cell signaling pathways that are related to inflammation, barrier function impairment, and chronic photoaging-interconnected pathological processes that form a complex network of damage in vivo [4,5,6].
UV radiation is a primary environmental risk factor for various skin pathologies, with epidemiological data showing persistently high rates of UV-related skin disorders [7]. Acute exposure causes sunburn through DNA damage, while chronic exposure leads to photoaging and immunosuppression. These effects are mediated by mechanisms including oxidative stress and epigenetic alterations. Sunscreens containing UV filters are commonly used to mitigate these risks [8,9]. However, growing concerns over synthetic UV filters—particularly regarding potential endocrine disruption and marine toxicity—have intensified the demand for natural, sustainable alternatives in cosmetic and dermatological applications [10,11].
Tea seed cake, also known as tea meal, is a cake-like substance formed by pressing the residual solids left after extracting tea oil from the seeds of the tea tree (Camellia sinensis). Camellia sinensis seeds are rich in flavonoid compounds, which exhibit a broad spectrum of biological activities that are antioxidant and anti-inflammatory, and include free radical scavenging and the modulation of cellular signaling pathways (e.g., suppression of the TLR4/MyD88/NF-κB pathway, regulation of the Keap1/Nrf2 pathway, and modulation of MAPK signaling (ERK1/2, p38)) [12,13,14,15]. In recent years, our group has isolated saponins from tea (Camellia sinensis) seed cake and proven their sebosuppression and anti-inflammatory efficacies as follows [16,17,18]: Tea seed saponins were shown to suppress cortisol-induced lipogenesis and inflammation in sebocytes via the 11β-HSD1/SREBP-1 and TLR2/NF-κB pathways. Additionally, tea seed saponins reduced sebum production through AMPK/mTOR signaling. Furthermore, Camellia sinensis seed cake extract alleviated DHT-induced damage in dermal papilla cells, indicating promising anti-androgenic and hair growth-promoting activities. Despite this, the other ingredients and their efficacy remain untapped.
This study investigated the anti-inflammatory and anti-photoaging effects of flavonoids extracted from Camellia sinensis seeds (CSF) against UV-induced skin damage, aiming to provide a new natural product candidate and a multi-target mechanistic framework for advanced photodamage protection.

2. Results

2.1. CSF Component Analysis

Based on the Ultra-High Performance Liquid Chromatography–Tandem Mass Spectrometry (UHPLC-MS/MS) dataset (Figure 1), the chemical composition of the analyzed extract was characterized. Structures were identified by comparison with reference standards. Detailed information on the reference standards is provided in the Supplementary Materials. Structural classification revealed that the extract was predominantly rich in flavonoids. Accordingly, the ten most abundant flavonoids identified are listed in Table 1.
Notably, derivatives of kaempferol constituted a significant portion of the composition, including kaempferol 3,7-diglucoside, kaempferitrin, kaempferol-3-O-rutinoside, dihydrokaempferol, and the aglycone kaempferol itself [19,20]. This analysis provides a material basis of flavonoids with potential anti-inflammatory and anti-photoaging properties for subsequent experimental investigations.

2.2. CSF Has Multiple Effects on UVB-Induced HaCaT Keratinocytes

Prior to establishing the UVB-induced inflammatory model, the effects of CSF on the viability of HaCaT cells were investigated. This was to exclude any potential influence of CSF themselves on cell survival. As shown in Figure 2a, CSF at concentrations ranging from 0.25 to 10 μg/mL did not exhibit significant cytotoxicity. Therefore, a CSF concentration of 10 μg/mL was selected for subsequent experiments.

2.2.1. CSF Alleviate UVB-Induced Oxidative Stress in HaCaT Keratinocytes

To establish a UVB-induced inflammation model, the effect of UVB irradiation (as a model stimulant) on the viability and oxidative stress of HaCaT cells was investigated (Figure 2). As shown in Figure 2b, when HaCaT cells were exposed to UVB at a dose of 30 mJ/cm2, cell viability decreased to approximately 50%, which represented the IC50 for photodamage. Concurrently, a sharp increase in intracellular ROS levels was observed (Figure 2d). These results indicate the successful establishment of a HaCaT cell photodamage model. Treatment with CSF markedly attenuated this UVB-induced oxidative stress. CSF treatment significantly reduced ROS levels by 20% compared to the model group (UVB-irradiated) (Figure 2c). The results demonstrate that CSF obviously protected against UVB-induced oxidative stress in HaCaT keratinocytes.
Figure 2. Effects of CSF on HaCaT cell viability (a). Effects of UVB on HaCaT cell viability (b). The effect of CSF on intracellular ROS levels following UVB irradiation (c,d); green fluorescence intensity indicates ROS production. For (a,b), ** and *** indicated p < 0.01 and 0.001 compared with the control group, respectively. For (c), ## represents p < 0.01 compared with the control group; ** indicates p < 0.01 compared with the UVB group. Values are expressed as the mean ± standard deviation (SD), n = 3.
Figure 2. Effects of CSF on HaCaT cell viability (a). Effects of UVB on HaCaT cell viability (b). The effect of CSF on intracellular ROS levels following UVB irradiation (c,d); green fluorescence intensity indicates ROS production. For (a,b), ** and *** indicated p < 0.01 and 0.001 compared with the control group, respectively. For (c), ## represents p < 0.01 compared with the control group; ** indicates p < 0.01 compared with the UVB group. Values are expressed as the mean ± standard deviation (SD), n = 3.
Molecules 31 00871 g002
Moreover, UVB irradiation induced photodamage in HaCaT cells, reducing viability and upregulating Caspase-3 mRNA expression (Figure 3). Treatment with CSF effectively counteracted this damage, suppressing Caspase-3 expression and increasing cell viability by 20%, demonstrating its protective role via inhibition of the apoptotic pathway.

2.2.2. CSF Suppressed UVB-Induced Inflammatory Response

The results obtained from the assay kits demonstrated that UVB irradiation significantly elevated the intracellular levels of the pro-inflammatory mediators of prostaglandin E2 (PGE-2), tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6), and interleukin-8 (IL-8) in the model group (Figure 4), indicating that oxidative stress induces a strong inflammatory response. Treatment with CSF markedly attenuated this UVB-induced inflammatory response in a concentration-dependent manner. Specifically, CSF treatment led to significant reductions in the levels of these inflammatory cytokines compared to the UVB-irradiated control group: PGE-2 by 52.6%, TNF-α by 62.3%, IL-6 by 55.1%, and IL-8 by 60.37%. These results demonstrate that CSF possesses a potent anti-inflammatory effect against UVB-induced inflammation in HaCaT keratinocytes.
To elucidate the upstream mechanisms underlying the elevated pro-inflammatory cytokines, key signaling pathways were analyzed. Further Western blot analysis demonstrated that UVB exposure concurrently activated key phosphorylated proteins in the MAPK signaling pathway, namely p38 and JNK (Figure 5a), and promoted the expression of the nuclear transcription factor NF-κB p65. GAPDH was employed as a loading control due to its consistent expression in HaCaT cells following UVB irradiation, ensuring reliable normalization of p-p38, p-JNK, and NF-κB signals. Upon activation of the key inflammatory pathway NF-κB, RT-qPCR analysis (Figure 5c,d) demonstrated upregulation of its downstream mediators, inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2), at the mRNA level, which subsequently led to increased production of inflammatory mediators such as ROS precursors and PGE-2. Following CSF intervention, the protein expression levels of p-p38, p-JNK, and NF-κB p65 in the treatment group were markedly downregulated. Consequently, the mRNA expressions of its downstream genes iNOS and COX-2 were also inhibited, ultimately manifesting as a reduction in the levels of various pro-inflammatory factors. This cascade of results clearly indicates that the anti-inflammatory effect of CSF is achieved by inhibiting p38/JNK phosphorylation, blocking the activation of the NF-κB signaling pathway, and thereby downregulating the expression of iNOS and COX-2 and reducing the production of inflammatory mediators including ROS, PGE-2, TNF-α, IL-6, and IL-8.

2.2.3. CSF Enhanced the Expression of Skin Barrier Protection-Related mRNA

The skin barrier critically relies on key proteins such as filaggrin (FLG), which is involved in stratum corneum formation and hydration, and claudin-1, a core component of tight junctions. UVB irradiation significantly downregulated the mRNA expression of both FLG and claudin-1, indicating compromised barrier integrity (Figure 6). Treatment with CSF effectively counteracted this damage, restoring the expression levels of these proteins and thereby demonstrating its protective role in repairing the UVB-impaired skin barrier.

2.3. CSF Protects the Skin from Photodamage to the Dermo-Epidermal Junction and Dermis Induced by UVA

To ensure that the observed biological effects were not attributable to cytotoxicity, the impact of CSF on HDF cell viability was tested across a spectrum of concentrations (0.25–250 μg/mL). Figure 7a confirms the absence of significant cytotoxic activity within 0.25–25 μg/mL. The highest concentration of 25 μg/mL was thereby designated as the working concentration for all subsequent treatments.

2.3.1. The Anti-Photoaging Effect of CSF on the Dermo-Epidermal Junction Irradiated by UVA

To simulate daily environmental UVA exposure on HDFs, UVA doses within the range of 6–10 J/cm2 are typically selected [21,22,23]. After exposing HDFs to varying doses of UVA radiation, cell viability was assessed using the CCK-8 assay. Compared with the non-irradiated control group, exposure to 8 J/cm2 UVA resulted in approximately 84% cell viability (Figure 7b). This dose was chosen to establish a photoaging model that mimics real-world UVA exposure, as it induces a measurable stress response while maintaining sufficient cell viability for subsequent mechanistic investigations. This approach allows the examination of the protective effects of CSF against UVA-induced damage without the confounding influence of acute cytotoxicity.
Collagen IV constitutes the primary structural component of the lamina densa within the basement membrane, while collagen XVII, as a transmembrane hemidesmosomal protein, physically links keratinocytes to the basement membrane, together ensuring dermal–epidermal junction integrity [24,25]. Matrix metalloproteinase-9 (MMP-9) is the key enzyme responsible for the degradation of these collagens. As shown in Figure 8, enzyme-linked immunosorbent assay (ELISA) results revealed that UVA irradiation significantly reduced the content of collagen IV and collagen XVII in the model group compared to the control. Concurrently, quantitative polymerase chain reaction (qPCR) analysis demonstrated a marked upregulation of MMP-9 mRNA expression following UVA exposure, indicating structural damage and impaired anchoring function of the basement membrane. Treatment with CSF effectively counteracted these UVA-induced detrimental effects. CSF intervention significantly downregulated the expression of MMP-9. Consequently, the degradation of collagen IV and XVII was markedly attenuated (Figure 8). These results indicate that CSF provides crucial protection for maintaining dermo-epidermal junction (DEJ) integrity under UVA stress, likely by inhibiting the expression of enzymes that degrade its essential collagenous framework.

2.3.2. CSF Attenuates UVA-Induced Damage to Connective Tissue Structure in Dermal Fibroblasts

To investigate the protective effect of CSF on the dermis, we assessed the levels of key structural collagens and their regulatory enzymes following UVA irradiation. As shown in Figure 9, the contents of collagen type I and collagen type III were significantly reduced in the UVA-irradiated model group compared to the non-irradiated control. This result indicates severe damage to the dermal connective tissue structure.
At the molecular level, qPCR analysis revealed that UVA irradiation markedly upregulated the mRNA expression of matrix metalloproteinase-1 (MMP-1) and matrix metalloproteinase-3 (MMP-3) (Figure 9). MMP-1 is the primary enzyme responsible for the degradation of fibrillar collagens, including types I and III. MMP-3 (stromelysin-1), in turn, can activate pro-MMP-1, thereby amplifying the collagenolytic cascade. Treatment with CSF effectively counteracted these UVA-induced alterations. Consequently, the mRNA levels of MMP-1 and MMP-3 were significantly downregulated in CSF-treated groups compared to the UVA model group. This suppression of MMP expression was associated with a restoration in the protein levels of collagen type I and type III.

2.3.3. The Pathway Mechanism by Which CSF Protects HDF Cells and Reduces UVA Photoaging Damage

HAS2 catalyzes the biosynthesis of HA, the primary glycosaminoglycan in the skin’s extracellular matrix. HAS2 was markedly upregulated in the CSF-treated group, leading to increased synthesis of HA (Figure 10). Western blot analysis further elucidated the molecular pathways involved. UVA irradiation activated the AP-1 pathway. Conversely, CSF treatment significantly suppressed this activation. Concurrently, UVA exposure downregulated TGF-β expression and its downstream effector p-Smad3 while upregulating the inhibitory Smad7. These changes collectively indicate a suppression of collagen synthesis signaling. Treatment with CSF effectively reversed these alterations, restoring TGF-β levels, increasing p-Smad3, and reducing Smad7 expression. These results demonstrate that CSF mitigates UVA-induced damage to connective tissue structure by inhibiting the AP-1-mediated destructive pathway and concurrently rescuing the TGF-β/Smad collagen synthesis axis.

3. Discussion

Plant-derived bioactive compounds offer distinct therapeutic advantages due to their inherent chemical complexity [26]. Comprising multiple constituents, they modulate diverse molecular targets simultaneously, often resulting in synergistic effects [27]. This multi-target mechanism, combined with their generally favorable safety profile and milder action, positions them as superior candidates for chronic disease management and long-term preventive applications compared to single-target synthetic agents [28].
The observed protective effects align with known flavonoid bioactivities. Contemporary research indicates flavonoids act as signal modulators, by activating the p-Akt/Nrf2/HO-1 axis and suppressing NF-κB/MAPK signaling to downregulate COX-2, for instance [29,30]. This modulation of specific molecular pathways provides a mechanistic basis for the reduced photodamage observed in our study.
UV radiation exerts differential effects on skin layers due to its spectral properties [1]: UVB (280–315 nm) primarily targets the epidermis, inducing direct DNA damage and inflammation, whereas UVA (315–400 nm) penetrates into the dermis, promoting oxidative stress and chronic photoaging. To model these layer-specific mechanisms, HaCaT keratinocytes were used to assess epidermal inflammatory responses, while human dermal fibroblasts (HDFs) were selected to evaluate dermal collagen degradation and oxidative damage.
As a central mediator in UV-induced photoaging, ROS inflict cutaneous damage through dual mechanisms: direct oxidative assault and indirect signaling disruption [31]. At the molecular level, ROS induce lipid peroxidation, compromise protein integrity, and cause oxidative DNA damage and mutagenesis [32]. On a cellular scale, ROS perpetuate inflammation by activating pathways such as MAPK and NF-κB while simultaneously suppressing the TGF-β signaling axis [33]. This imbalance promotes extracellular matrix degradation by upregulating matrix metalloproteinases (MMPs) and downregulating collagen synthesis. Collectively, these events drive chronic inflammation, impair barrier function, and induce cellular apoptosis and senescence, ultimately manifesting as the clinical hallmarks of photoaging, including wrinkle formation, loss of elasticity and xerosis. This study specifically investigated the mechanism by which CSF mitigate UV-induced skin inflammation and photoaging through multi-target synergistic regulation.
UVB irradiation triggers excessive intracellular ROS generation, a primary instigator of photodamage. This oxidative stress potently activates key stress response signaling pathways, including the MAPK pathways; this is evidenced by the phosphorylation of p38 and JNK and the master inflammatory regulator NF-Κb [34,35]. The activation of these pathways subsequently upregulates pro-inflammatory mediators such as PGE-2, TNF-α, IL-6, and IL-8. To further elucidate the upstream mechanisms underlying these changes, key inflammatory mediators and signaling events were analyzed. Notably, iNOS and COX-2 function as critical effector enzymes in UVB-induced skin inflammation and photoaging [36]. They translate upstream ROS and activated inflammatory pathways (NF-κB and MAPK) into specific bioactive molecules (NO, PGE-2), thereby amplifying the production of pro-inflammatory mediators and collectively driving inflammation and cellular damage. Importantly, CSF treatment effectively counteracted this cascade and the production of associated inflammatory factors (PGE-2, TNF-α, IL-6, and IL-8), with an effect comparable to that of 10 μM (-)-Epigallocatechin-3-gallate (EGCG) [37]. The reduction in ROS levels suggests the presence of direct antioxidant activity, which likely underlies the observed suppression of p-p38, p-JNK, and NF-κB activation. This inhibition of upstream signaling led to decreased production of downstream inflammatory cytokines and enzymes.
CSF also protected skin barrier integrity alongside its anti-inflammatory effects (Figure 11). The skin barrier depends on both structural proteins like FLG for physical strength and tight-junction proteins like claudin-1 for selective permeability [38,39]. CSF significantly reversed the UVB-induced downregulation of FLG and claudin-1, indicating its role in restoring both the physical and functional barrier. Furthermore, CSF inhibited UVB-induced apoptosis in keratinocytes, primarily by suppressing the activation of the executioner caspase, caspase-3, a key mediator in the apoptotic pathway. By simultaneously breaking this cycle at multiple points—oxidative initiation, inflammatory amplification, and structural execution—CSF exhibits a network-targeting profile that distinguishes it from single-mechanism interventions.
The structural integrity of the DEJ, which is essential for epidermal adhesion and signaling, relies heavily on type IV collagen within the basement membrane and the transmembrane-anchoring protein type XVII collagen (BP180) in hemidesmosomes [40,41]. UVA radiation disrupts this junction, in part through the upregulation of matrix metalloproteinase-9 (MMP-9). MMP-9 proteolytically degrades these critical structural components, leading to destabilization of the DEJ. Our experimental data indicate that CSF treatment effectively mitigates this damage. The mechanism involves the suppression of the UVA-activated transcription factor AP-1, a key upstream regulator of MMP-9 gene expression. By inhibiting the AP-1 pathway, CSF reduces MMP-9 overexpression, thereby helping to maintain the integrity of type IV and XVII collagen networks and preserving DEJ function.
The bulk mechanical properties of skin are primarily determined by the dermal matrix, whose major constituents are fibrillar collagens (types I and III) and the glycosaminoglycan HA [42,43]. UVA irradiation triggers a dual dysregulation: it simultaneously enhances ECM degradation and impairs its synthesis. The catabolic response is mediated via AP-1-dependent upregulation of MMPs, particularly MMP-1 (which initiates collagen fiber cleavage) and MMP-3 (which amplifies damage by activating pro-MMP-1 and degrading other ECM components) [44,45,46]. Concurrently, UVA suppresses the principal anabolic TGF-β/Smad pathway. It achieves this by inducing the expression of the inhibitory Smad7, which interferes with Smad3 signal transduction, leading to reduced procollagen synthesis. Our results show that CSF counteracts this imbalance through a two-pronged mechanism. First, it inhibits the AP-1/MMP axis, reducing the degradation of collagens I and III, showing efficacy similar to 25 μg/mL EGCG [47]. Second, it restores the anabolic TGF-β/Smad3 signaling, likely via downregulation of Smad7, thereby promoting collagen production [48]. Furthermore, CSF enhanced dermal HA content by upregulating the expression of hyaluronic acid synthase 2 (HAS2). Collectively, these actions on collagen turnover and HA synthesis served to preserve the structural volume and composition of the dermal matrix.
Several limitations of this study should be acknowledged. As this study was conducted solely in vitro using acute UV exposure and direct compound application, the findings do not account for chronic skin remodeling, bioavailability barriers, or clinical translation, which require future validation using more complex models such as 3D skin models, animal models (e.g., mouse or pig skin) and human skin explants.
Our findings demonstrate that CSF confers protection against UVA-induced photoaging by coordinately preserving the integrity of two critical structural compartments: the dermal–epidermal junction (DEJ) and the dermal connective tissue. This protection is achieved through the modulation of key signaling pathways that govern extracellular matrix (ECM) homeostasis.

4. Materials and Methods

4.1. Extraction of Flavonoids

Camellia sinensis seed (produced in Anhua, Hunan Province, genus Camellia in the family Theaceae, Herbarium of the Institute of Botany, Chinese Academy of Sciences (Beijing, China), PE02222162) meal powder (10 g) was extracted with 250 mL of 60% ethanol under 250 W ultrasonic irradiation for 2 h (Figure 12). The crude extract was centrifuged, and the supernatant was collected. After evaporating ethanol using a rotary evaporator, the aqueous residue was defatted three times with petroleum ether (1:1, v/v). The water phase was then extracted with ethyl acetate (1:1, v/v) to enrich flavonoids. The ethyl acetate phase was collected, concentrated via rotary evaporation, and freeze-dried for 48 h to obtain crude flavonoids.
D101 macroporous resin was preconditioned by soaking in 95% ethanol for 24 h and was then washed with deionized water until it was alcohol-free [49]. This D101 macroporous resin purification method enables efficient enrichment of flavonoids from complex plant matrices under mild conditions, effectively removing polar impurities while preserving the structural integrity and bioactivity of the target compounds. It was then treated sequentially with 5.0% NaOH and 2.0% HCl for 4 h each, rinsed to neutrality, and packed into a column. A sample solution of crude flavonoids (1.5 mg/mL) was loaded onto the column at a flow rate of 1.5 mL/min. After loading, the column was washed extensively with distilled water (3.0–4.0 mL/min) until the eluent became clear and flavonoid-free. Adsorbed impurities were eluted with 20% ethanol, followed by flavonoid desorption using 70% ethanol at 1.5 mL/min. The eluate was collected in fractions, and those with high flavonoid purity were mixed, concentrated under reduced pressure, and freeze-dried to obtain purified flavonoids (CSF).

4.2. Quantitative Analysis of Flavonoids

The total flavonoid content was determined by the sodium nitrite–aluminum nitrate colorimetric method [50], using rutin as a standard. A standard curve was prepared with rutin solutions (0–0.02 mg/mL). The absorbance was measured at 510 nm after 15 min. The CSF sample was dissolved in 60% ethanol, and an aliquot was analyzed following the same procedure. The total flavonoid concentration was calculated from the standard curve, and the yield was determined according to Formula (1). After calculation, the flavonoid purity in CSF was 72%.
P = C × V M × 1000
P represents the total flavonoid extraction yield from tea seeds (mg RE/g, expressed as rutin equivalent); C denotes the flavonoid concentration in the extract (μg/mL); V is the volume of the flavonoid extract (mL); M is the mass of the test sample (g).

4.3. UHPLC-MS/MS Analytical Method

The chemical composition of CSF was analyzed by UHPLC-MS/MS. CSF samples were extracted with a chilled methanol/acetonitrile/water solution, homogenized, ultrasonicated at low temperature, and centrifuged. The supernatant was filtered and injected for analysis. Separation was performed on a Shimadzu LC 30A system equipped with a Waters UPLC HSS T3 column (2.1 × 100 mm, 1.8 µm) at 40 °C, using a gradient of 0.1% formic acid with ammonium formate (A) and acetonitrile (B) at 500 µL/min. Detection was carried out on an mass spectrometer (QTRAP 7500+, AB Sciex, Framingham, MA, USA) in positive/negative switching mode with MRM quantification. Quality control samples were analyzed throughout the run to ensure system stability.

4.4. Cell Cultures

Human keratinocyte (HaCaT, CRL-2249, Cell Bank of the Chinese Academy of Sciences, Shanghai, China) cells were cultured at 37 °C in a humidified CO2 incubator (95% air, 5% CO2, Bosun Medical Biological Instrument Co., Shanghai, China) in DMEM medium (Gibco, Thermo Fisher Scientific, Grand Island, NY, USA) supplemented with 10% fetal bovine serum. Human Dermal Fibroblast (HDF, CRL-2845, Cell Bank of Type Culture Collection of Chinese Academy of Sciences China (Shanghai, China)) was cultured at 37 °C in a humidified CO2 incubator in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin.

4.5. Protective Effects of CSF Against UVB-Induced Injury in HaCaT Keratinocytes

4.5.1. Assessment of Viability of HaCaT Keratinocytes

CSF was dissolved in serum-containing DMEM (250 μg/mL) and was then filter-sterilized and diluted with culture medium for experiments [51]. HaCaT cells (1.2 × 106 cells) were collected, resuspended at a density of 2 × 105 cells/mL, and seeded into 96-well plates (100 μL per well). Following a 24 h incubation, the experimental groups were administered 100 μL of CSF at various concentrations (0.25 to 250 μg/mL), while the control groups received 100 μL of DMEM medium. After another 24 h incubation, the plates were added CCK-8 and incubated for 40 min. The CCK-8 assay measures cell viability based on the reduction of WST-8 to water-soluble formazan by cellular dehydrogenases [52]; absorbance at 450 nm (Enzyme Immunoassay Apparatus, Feyond-A300, Hangzhou Allsheng Instruments Co., Ltd., Hagzhou, China) reflects metabolic activity.
In a parallel experiment, the impact of UVB irradiation on cell viability was assessed. After the initial culture, control groups were maintained in DMEM medium, whereas experimental groups were exposed to UVB irradiation (Ultraviolet crosslinker, SCIENTZ03-II, Ningbo Scientz Biotechnology Co., Ltd., Ningbo, China) at 312 nm and doses ranging from 15 to 60 mJ/cm2 in PBS. After irradiation, cells were incubated with DMEM for 24 h. Cell viability was then determined using the CCK-8 assay as described above. All experiments were performed in triplicate.

4.5.2. Cell Proliferation Assay

HaCaT cells (3 × 105 cells/well) were plated in 96-well plates at a density of 2 × 105 cells per mL, with 100 μL added to each well (2 × 104 cells/well) [53]. Following a 24 h incubation period, the control group was kept in DMEM medium. In contrast, the model and experimental groups underwent UVB irradiation at a dose of 30 mJ/cm2 with the plate lids removed. After UVB exposure, the model group continued to receive DMEM alone, while the experimental groups were treated with CSF at 2.5, 5.0 and 10.0 μg/mL in DMEM. After an additional 24 h of culture, CCK-8 reagent was introduced into each well and the plates were incubated for 40 min. Absorbance was then measured at 450 nm using a microplate reader. All experiments were performed in triplicate.

4.5.3. Intracellular ROS Detection in HaCaT Cells

HaCaT cells (1.2 × 106 cells) were seeded in 24-well plates at a density of 2 × 105 cells/mL (0.5 mL/well). After 24 h of culture, the control group was maintained in DMEM medium, while the model and experimental groups were exposed to UVB irradiation at 30 mJ/cm2 in open-lid condition. Following irradiation, the model group received DMEM medium, and the experimental groups were administered CSF at concentrations of 5.0 and 10.0 μg/mL in DMEM for 24 h. After removing the DMEM medium, 10 μM of 2′,7′-Dichlorodihydrofluorescein diacetate (DCFH-DA, Beyotime Biotechnology, Shanghai, China) was added to the cells and incubated at 37 °C for 20 min. Following the treatment, the cells were rinsed twice with phosphate-buffered saline (PBS). Images were captured using an inverted fluorescence microscope (IX73, Olympus Corporation, Tokyo, Japan) at ×200 magnification. DCF fluorescence was detected at an excitation wavelength of 488 nm and emission wavelength of 525 nm. At least five random fields per well were photographed, and representative images were shown. The fluorescence signal was visualized and quantified using a multi-mode microplate reader (Cytation 5, BioTek Instruments, Inc., Winooski, VT, USA) configured with an excitation filter of 488 nm and an emission filter of 525 nm. All experiments were performed in triplicate. Calculate the relative fluorescence intensity using Formula (2).
R F I = F I e F I b F I c F I b
RFI: relative fluorescence intensity; FIe: fluorescence signal for the model or treatment groups; FIc: fluorescence signal for the control group (basal ROS level); FIb: background fluorescence from probe-containing medium alone.

4.5.4. Determination of Secretion of PGE-2, TNF-α, IL-6 and IL-8 by ELISA

After the cells were cultured, the levels of inflammatory factors (PGE-2, TNF-α, IL-6 and IL-8) were measured using commercial ELISA kits (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s protocols. The optical density (OD) of each well was measured at a wavelength of 450 nm with Enzyme Immunoassay Apparatus. All experiments were conducted in triplicate.

4.6. Protective Effects of CSF Against UVA-Induced Damages in HDF Cells

4.6.1. Assessment of Viability of HDF Cells

HDF cells (1.2 × 106 cells) were harvested and seeded into 96-well plates at a density of 2 × 105 cells/mL (100 μL/well). Following a 24 h incubation, the cells were treated with 100 μL of CSF at varying concentrations (0.25–250 μg/mL) for the experimental groups, or with DMEM medium for the control groups. After an additional 24 h culture period, 10 μL of CCK-8 solution was added to each well, and the plates were incubated for 40 min. Absorbance was subsequently measured at 450 nm.
The effect of UVA irradiation on cell viability was evaluated. After the initial culture, control groups were kept in DMEM, while experimental groups were irradiated with UVA (Ultraviolet crosslinker, SCIENTZ03-II, Ningbo Scientz Biotechnology Co., Ltd., Ningbo, China) at 365 nm in PBS to ensure uniform exposure. The cells were irradiated at graded doses ranging from 4 to 32 J/cm2. Following irradiation, all groups were incubated with DMEM for 24 h, and cell viability was assessed using the CCK-8 method as described. All assays were conducted in triplicate.

4.6.2. Determination of Secretion of Collagen IV and Collagen XVII by ELISA

HDF cells (1.2 × 106 cells) were seeded in 24-well plates (2 × 105 cells/mL, 0.5 mL/well) [54]. After 24 h, the control group remained in DMEM, while the model and treatment groups received UVA irradiation (8 J/cm2). Following irradiation, the model group was given fresh DMEM, and the treatment groups were administered CSF at 10.0 or 25.0 μg/mL in DMEM for 24 h. The concentrations of collagen IV and collagen XVII in the samples were determined using corresponding ELISA kits (Absin Bioscience Inc., Shanghai, China) as per the provided protocols. The optical density (OD) was measured at a wavelength of 450 nm with Enzyme Immunoassay Apparatus. All assays were carried out in triplicate.

4.6.3. Determination of Secretion of Collagen I, Collagen III and Hyaluronic Acid by ELISA

HDF cells (1.2 × 106 cells) were seeded into 24-well plates at a density of 2 × 105 cells/mL (0.5 mL/well). After 24 h of incubation, cells were divided into groups: a control group maintained in DMEM, a model group exposed to UVA irradiation (8 J/cm2), and treatment groups irradiated similarly followed by administration of CSF at 10.0 or 25.0 μg/mL in DMEM for 24 h. Concentrations of collagen I, III and hyaluronic acid in the samples were measured using respective ELISA kits (Absin Bioscience Inc., Shanghai, China) according to the manufacturer’s instructions. The optical density (OD) was measured at a wavelength of 450 nm with Enzyme Immunoassay Apparatus. All experiments were performed in triplicate.

4.7. Quantitative Real-Time PCR Analysis

Total RNA was isolated from treated cells using a commercial RNA extraction kit (Wuhan Servicebio Technology Co., Ltd., Wuhan, China). The purity and concentration of the obtained RNA were quantified with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, cDNA was synthesized from the extracted RNA using a thermal cycler (Eastwin Life Sciences Inc., Suzhou, China). Real-time PCR amplification was performed on a Bio-Rad system (USA) using the cDNA as template, with a protocol of 40 cycles. Each cycle consisted of denaturation at 95 °C for 15 s, followed by annealing and extension at 60 °C for 30 s each. The sequences of the specific primers used are provided in Table 2.

4.8. Western Blot Analysis

HaCaT cells and HDF cells were lysed with RIPA buffer to extract total proteins. The protein samples were separated by 10% SDS-PAGE and subsequently transferred onto a polyvinylidene difluoride (PVDF) membrane (Wuhan Servicebio Technology, Wuhan, China). After blocking with 5% non-fat milk in TBST for 2 h at room temperature, the membranes were incubated overnight at 4 °C with specific primary antibodies from Servicebio (HaCaT Cells: p-p38, p-JNK, and NF-κB; HDF Cells: AP-1, TGF-β, Smad3 and Smad7). The membranes were then incubated with an HRP-conjugated secondary antibody for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence substrate (Wuhan Servicebio Technology, Wuhan, China) and imaged with a chemiluminescence imager. Band intensities were quantified densitometrically using the AIWBwell™ software.

4.9. Statistical Analysis

All results were expressed as mean ± standard deviation (SD). The “Student’s test” referred to in the manuscript is the unpaired t-test. The differences among the three groups were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s HSD test. The significance levels were indicated as follows: * p < 0.05 was considered to be statistically significant.

5. Conclusions

This study demonstrates that Camellia sinensis seed flavonoids (CSF) protect skin cells (and) against both UVB- and UVA-induced damages through synergistically multi-target pathways. An approach combining macroporous resin adsorption and targeted metabolomics was employed to purify and profile the flavonoids in tea seeds. In keratinocytes, CSF alleviates UVB-triggered oxidative stress and inflammation by scavenging ROS, inhibiting the MAPK/NF-κB pathway, suppressing the apoptotic pathway, and reinforcing skin barrier-related proteins. In fibroblasts, CSF counteracts UVA-mediated photoaging by suppressing AP-1/MMP-driven matrix degradation and restoring TGF-β/Smad-dependent ECM synthesis. Collectively, these findings suggest that CSF deserve further investigation as potential candidates for mitigating UVB-induced inflammation and UVA-induced photodamage. Nevertheless, it should be noted that the current findings are based on in vitro cell models; further validation using three-dimensional (3D) skin models or in vivo human studies is warranted to confirm its efficacy and translational potential.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/molecules31050871/s1: Figure S1: Extracted ion chromatogram (XIC) of procyanidin B2; Figure S2: Extracted ion chromatogram (XIC) of kaempferol 3,7-diglucoside; Figure S3: Extracted ion chromatogram (XIC) of epicatechin; Figure S4: Extracted ion chromatogram (XIC) of kaempferitrin; Figure S5: Extracted ion chromatogram (XIC) of kaempferol-3-O-rutinoside; Figure S6: Extracted ion chromatogram (XIC) of naringin; Figure S7: Extracted ion chromatogram (XIC) of naringenin-7-O-glucoside; Figure S8: Extracted ion chromatogram (XIC) of dihydrokaempferol; Figure S9: Extracted ion chromatogram (XIC) of kaempferol; Figure S10: Extracted ion chromatogram (XIC) of amentoflavone; Table S1: Reference Standard Information.

Author Contributions

X.-X.D. performed the experiments and wrote the original draft of the manuscript. R.-B.H. conducted the experiments. Y.-C.H. conducted the investigation. L.L. analyzed the data. J.-M.D. acquired the financial support for the project. M.Y. provided the research resources. G.-L.W. designed the methodology, and reviewed and edited the manuscript. J.W. managed the project and supervised the work. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

Y.-C.H., L.L., J.-M.D. and M.Y. were employed by the company Guangzhou Huashi Cosmetic Technology Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors declare that this study received funding from Guangzhou Huashi Cosmetic Technology Co., Ltd. The funders had the following involvement with the study: Y.-C.H., L.L., J.-M.D. and M.Y. provided the funding, resources, gave useful suggestions, and validated the data.

References

  1. Modenese, A.; Korpinen, L.; Gobba, F. Solar Radiation Exposure and Outdoor Work: An Underestimated Occupational Risk. Int. J. Environ. Res. Public Health 2018, 15, 2063. [Google Scholar] [CrossRef] [PubMed]
  2. Sreedhar, A.; Aguilera-Aguirre, L.; Singh, K.K. Mitochondria in Skin Health, Aging, and Disease. Cell Death Dis. 2020, 11, 444. [Google Scholar] [CrossRef]
  3. Mouret, S.; Baudouin, C.; Charveron, M.; Favier, A.; Cadet, J.; Douki, T. Cyclobutane Pyrimidine Dimers are Predominant DNA Lesions in whole Human Skin Exposed to UVA Radiation. Proc. Natl. Acad. Sci. USA 2006, 103, 13765–13770. [Google Scholar] [CrossRef]
  4. Vayalil, P.K.; Mittal, A.; Hara, Y.; Elmets, C.A.; Katiyar, S.K. Green Tea Polyphenols Prevent Ultraviolet Light-Induced Oxidative Damage and Matrix Metalloproteinases Expression in Mouse Skin. J. Investig. Dermatol. 2004, 122, 1480–1487. [Google Scholar] [CrossRef] [PubMed]
  5. Narayanan, D.L.; Saladi, R.N.; Fox, J.L. Ultraviolet radiation and skin cancer. Int. J. Dermatol. 2010, 49, 978–986. [Google Scholar] [CrossRef]
  6. Oh, J.H.; Joo, Y.H.; Karadeniz, F.; Ko, J.; Kong, C.S. Syringaresinol Inhibits UVA-Induced MMP-1 Expression by Suppression of MAPK/AP-1 Signaling in HaCaT Keratinocytes and Human Dermal Fibroblasts. Int. J. Mol. Sci. 2020, 21, 3981. [Google Scholar]
  7. Narla, S.; Kohli, I.; Hamzavi, I.H.; Lim, H.W. Visible Light in Photodermatology. Photochem. Photobiol. Sci. 2020, 19, 99–104. [Google Scholar] [CrossRef]
  8. Pniewska, A.; Kalinowska-Lis, U. A Survey of UV Filters Used in Sunscreen Cosmetics. Appl. Sci. 2024, 14, 3302. [Google Scholar] [CrossRef]
  9. Pawlowski, S.; Moeller, M.; Miller, I.B.; Kellermann, M.Y.; Schupp, P.J.; Petersen-Thiery, M. UV Filters Used in Sunscreens—A Lack in Current Coral Protection? Integr. Environ. Assess. Manag. 2021, 17, 926–939. [Google Scholar] [CrossRef]
  10. Jesus, A.; Sousa, E.; Cruz, M.; Cidade, H.; Lobo, J.; Almeida, I. UV Filters: Challenges and Prospects. Pharmaceuticals 2022, 15, 263. [Google Scholar] [CrossRef] [PubMed]
  11. Ferreira, S.M.; Gomes, S.M.; Santos, L. A Novel Approach in Skin Care: By-Product Extracts as Natural UV Filters and an Alternative to Synthetic Ones. Molecules 2023, 28, 2037. [Google Scholar] [CrossRef]
  12. Milutinov, J.; Pavlović, N.; Ćirin, D.; Atanacković Krstonošić, M.; Krstonošić, V. The Potential of Natural Compounds in UV Protection Products. Molecules 2024, 29, 5409. [Google Scholar] [CrossRef]
  13. Ghazi, S. Do the polyphenolic compounds from natural products can protect the skin from ultraviolet rays? Results Chem. 2022, 4, 100428. [Google Scholar] [CrossRef]
  14. Herrera, T.E.S.; Tello, I.P.S.; Mustafa, M.A.; Jamil, N.Y.; Alaraj, M.; Atiyah Altameem, K.K.; Alasheqi, M.Q.; Hamoody, A.-H.M.; Alkhafaji, A.T.; Shakir, M.N.; et al. Kaempferol: Unveiling its anti-inflammatory properties for therapeutic innovation. Cytokine 2025, 186, 156846. [Google Scholar] [CrossRef] [PubMed]
  15. Li, S.; Wang, S.; Zhang, L.; Ka, Y.; Zhou, M.; Wang, Y.; Tang, Z.; Zhang, J.; Wang, W.; Liu, W. Research progress on pharmacokinetics, anti-inflammatory and immunomodulatory effects of kaempferol. Int. Immunopharmacol. 2025, 152, 11438. [Google Scholar] [CrossRef]
  16. Li, J.; Zhang, L.Y.; Huang, Y.C.; Deng, J.M.; Yu, M.; Zouboulis, C.C.; Li, J.H.; Wang, G.L.; Wang, J. Saponin from Tea (Camellia sinensis) Seed Meal Attenuates Cortisol-Induced Lipogenesis and Inflammation in Human Cells. Molecules 2025, 30, 3844. [Google Scholar] [CrossRef] [PubMed]
  17. Ma, L.; Shen, H.; Fang, C.; Chen, T.; Wang, J. Camellia Seed Cake Extract Supports Hair Growth by Abrogating the Effect of Dihydrotestosterone in Cultured Human Dermal Papilla Cells. Molecules 2022, 27, 6443. [Google Scholar] [CrossRef]
  18. Li, J.; Huang, Y.C.; Deng, J.M.; Yu, M.; Zouboulis, C.C.; Wang, G.L.; Wang, J. Tea (Camellia sinensis) Seed Saponins Act as Sebosuppression Agents via the AMPK/mTOR Pathway. J. Cosmet. Dermatol. 2025, 24, e16793. [Google Scholar] [CrossRef] [PubMed]
  19. Ashihara, H.; Deng, W.W.; Mullen, W.; Crozier, A. Distribution and biosynthesis of flavan-3-ols in Camellia sinensis seedlings and expression of genes encoding biosynthetic enzymes. Phytochemistry 2010, 71, 559–566. [Google Scholar] [CrossRef]
  20. Li, Y.; Chen, C.; Li, Y.; Ding, Z.; Shen, J.; Wang, Y.; Zhao, L.; Xu, M. The identification and evaluation of two different color variations of tea. J. Sci. Food Agric. 2016, 96, 4951–4961. [Google Scholar] [CrossRef]
  21. Seo, S.W.; Park, S.K.; Oh, S.J.; Shin, O.S. TLR4-mediated Activation of the ERK Pathway Following UVA Irradiation Contributes to Increased Cytokine and MMP Expression in Senescent Human Dermal Fibroblasts. PLoS ONE 2018, 13, e0202323. [Google Scholar] [CrossRef] [PubMed]
  22. Zhang, C.; Yu, H.; Sun, L.; Zhou, X.; Lin, J. Human Amnion-derived Mesenchymal Stem Cells Protect against UVA Irradiation-Induced Human Dermal Fibroblast Senescence, in vitro. Mol. Med. Rep. 2017, 16, 1497–1505. [Google Scholar] [CrossRef]
  23. Hwang, J.; Yadav, A.; Jang, B.C.; Kim, Y. Antioxidant and Cytoprotective Effects of Stachys Riederi var. Japonica Ethanol Extract on UVA-irradiated Human Dermal Fibroblasts. Int. J. Mol. Med. 2019, 43, 1497–1505. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, J.; Lin, S.; Wei, Y.; Ye, Z. Recombinant human collagen XVII protects skin basement membrane integrity. Mol. Med. Rep. 2025, 31, 100. [Google Scholar] [CrossRef]
  25. Nakamura, T.; Yoshida, H.; Ota, Y.; Endo, Y.; Sayo, T.; Hanai, U.; Imagawa, K.; Sasaki, M.; Takahashi, Y. SPARC promotes production of type IV and VII collagen and their skin basement membrane accumulation. J. Dermatol. Sci. 2022, 107, 109–112. [Google Scholar] [CrossRef] [PubMed]
  26. Dincheva, I.; Badjakov, I.; Galunska, B. Editorial: Plant Bioactive Compounds in the Life Cycle. Plants 2023, 12, 258. [Google Scholar] [CrossRef]
  27. Marinas, I.-C.; Oprea, E.; Chifiriuc, M.-C.; Katsafadou, A.I.; Prodromou, S.I. Exploring the Valuable Potential of Horticultural By-Products: From Health Benefits to Sustainable Agricultural Practices. Horticulturae 2022, 8, 1213. [Google Scholar]
  28. Roy, A.; Datta, S.; Bhatia, K.S.; Bhumika; Jha, P.; Prasad, R. Role of plant derived bioactive compounds against cancer. S. Afr. J. Bot. 2022, 149, 1017–1028. [Google Scholar]
  29. Deng, X.; Wu, Q.; Liu, Y. Eucommia ulmoides Oliv. leaves flavonoids attenuate methylglyoxal-induced endothelial cell apoptosis in vitro and in vivo by upregulating AKT-Nrf2 signaling and downregulating oxidative stress. Food Sci. Nutr. 2024, 12, 7938–7953. [Google Scholar]
  30. Singh, D.; Shukla, G. The multifaceted anticancer potential of luteolin: Involvement of NF-κB, AMPK/mTOR, PI3K/Akt, MAPK, and Wnt/β-catenin pathways. Inflammopharmacology 2025, 33, 505–525. [Google Scholar] [PubMed]
  31. Sun, J.M.; Liu, Y.X.; Tsai, Y.T.; Liu, Y.D.; Ho, C.K.; Wen, D.S.; Tsai, T.Y.; Zheng, D.N.; Gao, Y.; Zhang, Y.F.; et al. Salvianolic Acid B Protects Against UVB-Induced HaCaT Cell Senescence and Skin Aging Through NRF2 Activation and ROS Scavenging. J. Photochem. Photobiol. B Biol. 2025, 266, 113139. [Google Scholar] [CrossRef]
  32. Gan, P.; Gao, Z.; Zhao, X.; Qi, G. Surfactin inducing mitochondria-dependent ROS to activate MAPKs, NF-κB and inflammasomes in macrophages for adjuvant activity. Sci. Rep. 2016, 6, 39303. [Google Scholar] [CrossRef]
  33. Srinivas, U.S.; Tan, B.W.Q.; Vellayappan, B.A.; Jeyasekharan, A.D. ROS and the DNA damage response in cancer. Redox Biol. 2019, 25, 101084. [Google Scholar] [CrossRef]
  34. Zhou, Y.; Zhao, H.; Guo, Z.; Song, C.; Xu, Y.; Dong, X. UVA and UVB Differentially Induce MAPK Pathways and Apoptosis in Human Skin Cells. J. Investig. Dermatol. 2009, 129, 983–993. [Google Scholar]
  35. Widel, M.; Krzywon, A.; Gajda, K.; Skonieczna, M.; Rzeszowska-Wolny, J. Induction of Bystander Effects by UVA, UVB, and UVC Radiation in Human Fibroblasts and the Implication of Reactive Oxygen Species. Free Radic. Biol. Med. 2014, 68, 278–287. [Google Scholar] [CrossRef] [PubMed]
  36. Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB Pathway for the Therapy of Diseases: Mechanism and Clinical Study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [PubMed]
  37. Salaheldin, T.A.; Adhami, V.M.; Fujioka, K.; Mukhtar, H.; Mousa, S.A. Photochemoprevention of ultraviolet Beam Radiation-induced DNA damage in keratinocytes by topical delivery of nanoformulated Epigallocatechin-3-gallate. Nanomed. Nanotechnol. Biol. Med. 2022, 44, 102580. [Google Scholar] [CrossRef]
  38. Debiska, A. New Treatments for Atopic Dermatitis Targeting Skin Barrier Repair via the Regulation of FLG Expression. J. Clin. Med. 2021, 10, 2506. [Google Scholar] [CrossRef]
  39. Bergmann, S.; von Buenau, B.; Vidal-y-Sy, S.; Haftek, M.; Wladykowski, E.; Houdek, P.; Lezius, S.; Duplan, H.; Bäsler, K.; Dähnhardt-Pfeiffer, S.; et al. Claudin-1 Decrease Impacts Epidermal Barrier Function in Atopic Dermatitis Lesions Dose-dependently. Sci. Rep. 2020, 10, 2024. [Google Scholar] [CrossRef] [PubMed]
  40. Mmbando, G.S.; Ngongolo, K. Environmental & Health Impacts of Ultraviolet Radiation: Current Trends and Mitigation Strategies. Discov. Sustain. 2024, 5, 436. [Google Scholar] [CrossRef]
  41. Jayadev, R.; Sherwood, D.R. Basement Membranes. Curr. Biol. 2017, 27, R199–R217. [Google Scholar] [CrossRef] [PubMed]
  42. Terazawa, S.; Takada, M.; Sato, Y.; Nakajima, H.; Imokawa, G. The Attenuated Secretion of Hyaluronan by UVA-exposed Human Fibroblasts is Associated with Up- and Downregulation of HYBID and HAS2 Expression via Activated and Inactivated Signaling of the p38/ATF2 and JAK2/STAT3 Cascades. Int. J. Mol. Sci. 2021, 22, 2057. [Google Scholar] [CrossRef] [PubMed]
  43. Freitas-Rodriguez, S.; Folgueras, A.R.; López-Otín, C. The Role of Matrix Metalloproteinases in Aging: Tissue Remodeling and Beyond. BBA—Mol. Cell Res. 2017, 1864, 2015–2025. [Google Scholar] [CrossRef] [PubMed]
  44. Wilson, S.E. Defective Perlecan-associated Basement Membrane Regeneration and Altered Modulation of Transforming Growth Factor Beta in Corneal Fibrosis. Cell. Mol. Life Sci. 2022, 79, 144. [Google Scholar] [CrossRef]
  45. Wang, B.; Hao, J.; Jones, S.C.; Yee, M.-S.; Roth, J.C.; Dixon, M.C. Overexpression of Smad7 is Associated with Reduced Collagen Synthesis in Adult Cardiac Fibroblasts: Role of Smad7 in the Development of Cardiac Fibrosis. J. Mol. Cell. Cardiol. 2002, 34, 1125–1136. [Google Scholar]
  46. Cutroneo, K.R. Evidence for TGF-ß1 and Bleomycin Intracellular Signaling through Autocrine Regulation of Smad3 Binding to the Proximal Promoter of the Smad7 Gene. J. Cell. Biochem. 2006, 97, 933–939. [Google Scholar] [CrossRef]
  47. Jia, Y.; Mao, Q.; Yang, J.; Du, N.; Zhu, Y.; Min, W. (-)-Epigallocatechin-3-Gallate Protects Human Skin Fibroblasts from Ultraviolet a Induced Photoaging. Clin. Cosmet. Investig. Dermatol. 2023, 16, 154–156. [Google Scholar] [CrossRef]
  48. Zhang, M.; Zhang, T.; Tang, Y.; Ren, G.; Zhang, Y.; Ren, X. Concentrated Growth Factor Inhibits UVA-induced Photoaging in Human Dermal Fibroblasts via the MAPK/AP-1 Pathway. Biosci. Rep. 2020, 40, BSR20193566. [Google Scholar] [CrossRef]
  49. Wang, J.Y.; Zhang, Q.X.; Chen, K.; Shen, Y.; Xu, M.; Chen, Y. Purification technology of total flavonoids from Citrus reticulata ‘Chachi’ leaves. J. Northwest A&F Univ. 2019, 2019, 120–127. [Google Scholar]
  50. Stanković, M.; Ćurčić, S.; Zlatić, N.; Bojović, T. Ecological Variability of the Phenolic Compounds of Olea europaea L. Leaves from Natural Habitats and Cultivated Conditions. Biotechnol. Biotechnol. Equip. 2017, 31, 499–504. [Google Scholar] [CrossRef]
  51. Lee, Y.; Yang, S.; Jung, Y.; Choe, H.; Yang, S. Photoprotective potato exosomes. Mol. Med. Rep. 2023, 28, 13054. [Google Scholar]
  52. Cai, L.; Qin, X.; Xu, Z.; Song, Y.; Jiang, H.; Wu, Y.; Ruan, H.; Chen, J. Comparison of Cytotoxicity Evaluation of Anticancer Drugs between Real-Time Cell Analysis and CCK-8 Method. ACS Omega 2019, 4, 12036–12042. [Google Scholar] [CrossRef] [PubMed]
  53. Liu, H.; Li, H.; Zhao, P.; Du, R.; Gao, Y. Collagen type III resists UVB induced photoaging of HaCaT cells by regulating mTOR signaling pathway. J. Photochem. Photobiol. B Biol. 2025, 267, 113153. [Google Scholar] [CrossRef] [PubMed]
  54. Liu, X.; Zhang, R.; Shi, H.; Li, X.; Li, Y.; Taha, A.; Xu, C. Protective effect of curcumin against ultraviolet A irradiation-induced photoaging in human dermal fibroblasts. Mol. Med. Rep. 2018, 17, 7227–7237. [Google Scholar] [CrossRef]
Figure 1. Total ion flow diagram of CSF in UHPLC-MS/MS. Numbers 1–10 represent the peaks corresponding to the identified compounds.
Figure 1. Total ion flow diagram of CSF in UHPLC-MS/MS. Numbers 1–10 represent the peaks corresponding to the identified compounds.
Molecules 31 00871 g001
Figure 3. Effect of CSF on HaCaT cell viability following UVB irradiation (a). Effect of UVB irradiation on the expression of Caspase-3 mRNA in HaCaT Cells (b). Compared with the control group, ##, ### represent p < 0.01, 0.001; Compared with the UVB group, *** indicates p < 0.001. Values are expressed as the mean ± SD, n = 3.
Figure 3. Effect of CSF on HaCaT cell viability following UVB irradiation (a). Effect of UVB irradiation on the expression of Caspase-3 mRNA in HaCaT Cells (b). Compared with the control group, ##, ### represent p < 0.01, 0.001; Compared with the UVB group, *** indicates p < 0.001. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g003
Figure 4. Effect of CSF on PGE-2 (a), TNF-α (b), IL-6 (c) and IL-8 (d) in HaCaT cells following UVB irradiation. Compared with the control group, ### represent p < 0.001; compared with the UVB group, *, ** and *** indicate p < 0.05, 0.01 and 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Figure 4. Effect of CSF on PGE-2 (a), TNF-α (b), IL-6 (c) and IL-8 (d) in HaCaT cells following UVB irradiation. Compared with the control group, ### represent p < 0.001; compared with the UVB group, *, ** and *** indicate p < 0.05, 0.01 and 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g004
Figure 5. Regulatory effects of CSF on p-p38, p-JNK, and NF-κB in HaCaT Cells. (a) Representative Western blot bands; (b) quantitative analysis of relative protein expression levels. Regulatory effects of CSF on iNOS (c) and COX-2 (d) mRNA in HaCaT cells. For (b), ##, ### represent p < 0.01, 0.001 compared with the control group, respectively; compared with the UVB group, *, ** indicate p < 0.05, 0.01, respectively. For (c,d), ## represents p < 0.01 compared with the control group; compared with the UVB group, * indicates p < 0.05. Values are expressed as the mean ± SD, n = 3.
Figure 5. Regulatory effects of CSF on p-p38, p-JNK, and NF-κB in HaCaT Cells. (a) Representative Western blot bands; (b) quantitative analysis of relative protein expression levels. Regulatory effects of CSF on iNOS (c) and COX-2 (d) mRNA in HaCaT cells. For (b), ##, ### represent p < 0.01, 0.001 compared with the control group, respectively; compared with the UVB group, *, ** indicate p < 0.05, 0.01, respectively. For (c,d), ## represents p < 0.01 compared with the control group; compared with the UVB group, * indicates p < 0.05. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g005
Figure 6. Effect of CSF on the mRNA of barrier genes FLG (a) and Claudin-1 (b) in HaCaT cells following UVB irradiation. Compared with the control group, ## represent p < 0.01; compared with the UVB group, *, ** indicate p < 0.05, 0.01, respectively. Values are expressed as the mean ± SD, n = 3.
Figure 6. Effect of CSF on the mRNA of barrier genes FLG (a) and Claudin-1 (b) in HaCaT cells following UVB irradiation. Compared with the control group, ## represent p < 0.01; compared with the UVB group, *, ** indicate p < 0.05, 0.01, respectively. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g006
Figure 7. Effects of CSF (a) and UVA (b) on HDF cell viability. Compared with the blank group, ** and *** indicate p < 0.01 and 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Figure 7. Effects of CSF (a) and UVA (b) on HDF cell viability. Compared with the blank group, ** and *** indicate p < 0.01 and 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g007
Figure 8. Effect of CSF on collagen IV (a) and collagen XVII (b) in HDF cells following UVA irradiation. Effect of CSF on MMP-9 (c) mRNA expression levels in HDF cells following UVA irradiation. Compared with the control group, ##, ### represent p < 0.01, 0.001, respectively; compared with the UVA group, *, ** and *** indicate p < 0.05, 0.01 and 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Figure 8. Effect of CSF on collagen IV (a) and collagen XVII (b) in HDF cells following UVA irradiation. Effect of CSF on MMP-9 (c) mRNA expression levels in HDF cells following UVA irradiation. Compared with the control group, ##, ### represent p < 0.01, 0.001, respectively; compared with the UVA group, *, ** and *** indicate p < 0.05, 0.01 and 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g008
Figure 9. Effect of CSF on collagen I (a) and collagen III (b) in HDF cells following UVA irradiation. Effect of CSF on MMP-1 (c) and MMP-3 (d) mRNA expression levels in HDF cells following UVA irradiation. Compared with the control group, ### represents p < 0.001; compared with the UVA group, ** and *** indicate p < 0.01, 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Figure 9. Effect of CSF on collagen I (a) and collagen III (b) in HDF cells following UVA irradiation. Effect of CSF on MMP-1 (c) and MMP-3 (d) mRNA expression levels in HDF cells following UVA irradiation. Compared with the control group, ### represents p < 0.001; compared with the UVA group, ** and *** indicate p < 0.01, 0.001, respectively. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g009
Figure 10. Effects of CSF on AP-1, TGF-β, and Smad3/7 protein levels in HDF cells. (a) Representative Western blot bands; (b) quantitative analysis of relative protein expression levels. Effect of CSF on hyaluronic acid (c) and HAS2 (d) mRNA expression levels in HDF cells following UVA irradiation. Compared with the control group, ##, ### represent p < 0.01, 0.001; compared with the UVA group, * and ** indicate p < 0.05 and 0.01. Values are expressed as the mean ± SD, n = 3.
Figure 10. Effects of CSF on AP-1, TGF-β, and Smad3/7 protein levels in HDF cells. (a) Representative Western blot bands; (b) quantitative analysis of relative protein expression levels. Effect of CSF on hyaluronic acid (c) and HAS2 (d) mRNA expression levels in HDF cells following UVA irradiation. Compared with the control group, ##, ### represent p < 0.01, 0.001; compared with the UVA group, * and ** indicate p < 0.05 and 0.01. Values are expressed as the mean ± SD, n = 3.
Molecules 31 00871 g010
Figure 11. Schematic representation of the hypothesized protective mechanisms of CSF in UV-induced keratinocytes and fibroblasts damage. CSF orchestrates a dual defense in skin cells. In keratinocytes, it mitigates UVB-triggered injury by scavenging reactive oxygen species (ROS), inhibiting the pro-inflammatory MAPK/NF-κB pathway, suppressing the apoptotic pathway, and upregulating barrier proteins. CSF protects the dermal–epidermal junction by inhibiting AP-1-driven MMP-9 expression, thereby preserving the integrity of the type IV collagen network and type XVII collagen anchoring complex. In the dermal matrix, CSF restores homeostasis by suppressing the AP-1/MMP axis (MMP-1/3) to reduce degradation while reactivating the TGF-β/Smad3 pathway and upregulating HAS2 to promote the synthesis of collagen I/III and hyaluronic acid. Red arrow: expression inhibited; Green arrow: expression activated.
Figure 11. Schematic representation of the hypothesized protective mechanisms of CSF in UV-induced keratinocytes and fibroblasts damage. CSF orchestrates a dual defense in skin cells. In keratinocytes, it mitigates UVB-triggered injury by scavenging reactive oxygen species (ROS), inhibiting the pro-inflammatory MAPK/NF-κB pathway, suppressing the apoptotic pathway, and upregulating barrier proteins. CSF protects the dermal–epidermal junction by inhibiting AP-1-driven MMP-9 expression, thereby preserving the integrity of the type IV collagen network and type XVII collagen anchoring complex. In the dermal matrix, CSF restores homeostasis by suppressing the AP-1/MMP axis (MMP-1/3) to reduce degradation while reactivating the TGF-β/Smad3 pathway and upregulating HAS2 to promote the synthesis of collagen I/III and hyaluronic acid. Red arrow: expression inhibited; Green arrow: expression activated.
Molecules 31 00871 g011
Figure 12. Schematic flowchart of the extraction, enrichment, and purification process of flavonoids from Camellia sinensis seed meal.
Figure 12. Schematic flowchart of the extraction, enrichment, and purification process of flavonoids from Camellia sinensis seed meal.
Molecules 31 00871 g012
Table 1. UHPLC-MS/MS analysis for the composition and structure of CSF (flavonoids).
Table 1. UHPLC-MS/MS analysis for the composition and structure of CSF (flavonoids).
CompoundRT [min]Adduct(m/z)Fragments
(m/z)
NameContent (mg/g)
13.49[M-H]577.1289.0Procyanidin B271.37
23.51[M+H]+611.2287.1Kaempferol 3,7-diglucoside107.51
33.72[M-H]289.0203.0Epicatechin86.97
44.48[M-H]577.3285.1Kaempferitrin76.44
54.68[M+H]+595.2287.1Kaempferol-3-O-
rutinoside
61.88
64.71[M-H]579.0271.1Naringin47.45
74.82[M-H]433.1271.0Naringenin-7-O-
glucoside
43.03
85.14[M-H]287.1259.1Dihydrokaempferol15.86
96.50[M-H]284.9117.1Kaempferol50.57
106.87[M-H]537.1375.2Amentoflavone73.71
Table 2. Primers sequence.
Table 2. Primers sequence.
CellsGenePrimers (5′-3′)
HaCaTCaspase-3F:TGGAAGCGAATCAATGGACTCT
R:TGAATGTTTCCCTGAGGTTTGC
iNOSF:GACTCACAGCCTTTGGACCTCA
R:GCTGGATGTCGGACTTTGTAGATT
COX2F:GGGTTGCTGGTGGTAGGAATG
R:CATAAAGCGTTTGCGGTACTCAT
FLGF:GGATGAAGCCTATGACACCACT
R:AACTCTGGATCCCCTACGCT
Claudin-1F:GCCAGGTACGAATTTGGTCAG
R:TTGGTGTTGGGTAAGAGGTTGT
GAPDHF:GGAAGCTTGTCATCAATGGAAATC
R:TGATGACCCTTTTGGCTCCC
HDFMMP9F:TCGACGTGAAGGCGCAGAT
R:AGAAGCGGTCCTGGCAGAAATA
MMP-1F:GACCTACAGGATTGAAAATTACACG
R:GCAAGATTTCCTCCAGGTCCAT
MMP-3F:CAATCCTACTGTTGCTGTGCG
R:GGACCACTGTCCTTTCTCCTAAC
HAS2F:TCCCGGTGAGACAGATGAGT
R:GGCTGGGTCAAGCATAGTGT
ACTINF:CACCCAGCACAATGAAGATCAAGAT
R:CCAGTTTTTAAATCCTGAGTCAAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Duo, X.-X.; Hou, R.-B.; Huang, Y.-C.; Li, L.; Deng, J.-M.; Yu, M.; Wang, G.-L.; Wang, J. Camellia sinensis Seed Flavonoids Attenuate UVB-Induced Inflammation and UVA-Induced Photodamage via MAPK/NF-κB and AP-1 Pathways. Molecules 2026, 31, 871. https://doi.org/10.3390/molecules31050871

AMA Style

Duo X-X, Hou R-B, Huang Y-C, Li L, Deng J-M, Yu M, Wang G-L, Wang J. Camellia sinensis Seed Flavonoids Attenuate UVB-Induced Inflammation and UVA-Induced Photodamage via MAPK/NF-κB and AP-1 Pathways. Molecules. 2026; 31(5):871. https://doi.org/10.3390/molecules31050871

Chicago/Turabian Style

Duo, Xiao-Xiao, Ru-Biao Hou, Yuan-Cheng Huang, Lei Li, Jian-Ming Deng, Min Yu, Guang-Li Wang, and Jing Wang. 2026. "Camellia sinensis Seed Flavonoids Attenuate UVB-Induced Inflammation and UVA-Induced Photodamage via MAPK/NF-κB and AP-1 Pathways" Molecules 31, no. 5: 871. https://doi.org/10.3390/molecules31050871

APA Style

Duo, X.-X., Hou, R.-B., Huang, Y.-C., Li, L., Deng, J.-M., Yu, M., Wang, G.-L., & Wang, J. (2026). Camellia sinensis Seed Flavonoids Attenuate UVB-Induced Inflammation and UVA-Induced Photodamage via MAPK/NF-κB and AP-1 Pathways. Molecules, 31(5), 871. https://doi.org/10.3390/molecules31050871

Article Metrics

Back to TopTop