Next Article in Journal
Nitazenes: The Emergence of a Potent Synthetic Opioid Threat
Next Article in Special Issue
Bioactivity-Guided Fractionation, Characterization, and Mechanistic Insights of Anticancer Agents from Simarouba glauca DC. Leaves
Previous Article in Journal
Unraveling the Chemical Composition and Biological Activity of Geum aleppicum Jacq.: Insights from Plants Collected in Kazakhstan
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Novel ST-Specific Molecular Target-Based Method for Simultaneous and Quantitative Detection of Staphylococcus aureus ST7, ST188 and ST398

1
State Key Laboratory of Food Science and Resources, Nanchang University, Nanchang 330047, China
2
Office of Science and Technology, Jiangxi General Institute of Testing and Certification, Nanchang 330052, China
3
Nanchang Key Laboratory of Food Rapid Testing, Jiangxi General Institute of Testing and Certification, Nanchang 330200, China
4
School of Chemistry and Biological Engineering, University of Science and Technology Beijing, Beijing 100083, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Molecules 2025, 30(19), 3889; https://doi.org/10.3390/molecules30193889
Submission received: 5 August 2025 / Revised: 6 September 2025 / Accepted: 18 September 2025 / Published: 26 September 2025

Abstract

Staphylococcus aureus is a globally crucial foodborne pathogen that can cause diarrhea, vomiting, and bloodstream infection in immunocompromised individuals. S. aureus has three predominant sequence types (STs) (ST7, ST188 and ST398) that are prevalent clones in both food and clinical cases. This study aimed to screen ST-specific targets for S. aureus ST7, ST188 and ST398, and then developed a novel rapid and accurate assay for the detection of these three predominant S. aureus STs in food. A total of 505 Staphylococcus strain genome sequences including 371 sequences of 58 different STs and 134 other non-target S. aureus ST genome sequences were subjected to pan-genome analysis; we successfully screened five novel ST-specific targets (group_10498 and group_10499 target for S. aureus ST7, group_9415 and group_9419 target for S. aureus ST188, group_9911 target for S. aureus ST398). The excellent specificity and sensitivity of all the targets were confirmed by PCR assays. Based on these molecular targets, mPCR and qPCR methods were developed for specifically identifying S. aureus’ three predominant STs without non-target bacterial interference. The limits of detection (LODs) for the mPCR assay in artificially contaminated milk were determined to be 104 CFU/mL for ST7, 105 CFU/mL for ST188, and 104 CFU/mL for ST398, while the LODs achieved by the qPCR method were 8.6 × 102 CFU/mL, 1.2 × 102 CFU/mL, and 6.4 × 103 CFU/mL, respectively. The testing results for actual food samples suggested that the developed mPCR or qPCR assays could be used as an alternative to standard MLST analysis, for the rapid and reliable identification of S. aureus STs. The novel molecular detection technology established in this study provides an efficient and reliable detection method for the prevention and control of predominant S. aureus ST contamination in food and has important application potential and promotion prospects.

Graphical Abstract

1. Introduction

Staphylococcus aureus is a globally crucial foodborne pathogen. The toxins produced by S. aureus can cause diarrhea, vomiting, bloodstream infection, purulent infection, etc., all of which seriously threaten human health [1,2]. Approximately 241,000 illnesses in the United States and 20–25% of foodborne bacterial outbreaks in China have been caused by S. aureus contamination each year [3,4]. Moreover, the widespread use of antibiotics has increased the prevalence of multidrug-resistant S. aureus, bringing new challenges to clinical treatment [5]. Therefore, accurate analysis of the virulence and prevalence of S. aureus is significant for evaluating the potential implications of the presence of this microorganism for food safety and public health.
Currently, various molecular subtyping approaches, including pulsed-field gel electrophoresis (PFGE), staphylococcal protein A (spa) typing and multilocus sequence typing (MLST), have been developed for S. aureus characterization [6]. However, PFGE analysis is relatively complicated, and the same PFGE model often shows different biochemical characteristics, which has limited its application in subtype analysis [7]. spa typing based on single locus analysis would limit the resolution for epidemiological typing, and recombination events might distort the underlying clonal relationships [8]. These factors have restricted their applications in practical use in the food industry and clinical application. As a robust technique, MLST, which is based on sequences of single-nucleotide polymorphisms from seven housekeeping genes to classify sequence types (STs) and clonal complexes (CCs), has proven useful for both epidemiology and evolutionary studies [9]. Studies tracking outbreaks related to S. aureus have revealed differences in pathogenicity at the intra-species level that are closely associated with specific S. aureus STs [10]. For example, Song et al. (2016) [11] found that the S. aureus ST188 strains were closely associated with outbreaks of staphylococcal food poisoning (SFP). Some studies reported that, in atopic dermatitis and pediatric patients with bloodstream infections, predominant methicillin-susceptible S. aureus (MSSA) clones belonged to ST188 and ST7 types [12,13]. A recent study revealed that ST7 became one of the most common S. aureus STs (the MRSA proportion of ST7 increased from 19.1% to 50%) after the COVID-19 epidemic in the city of Wuhan, China [14], and ST7 was the main reported ST of S. aureus in local wholesale and retail pork (detection rate: 57.5%) [15]. ST7, ST188 and ST398 clones were found to be multidrug-resistant, have strong biofilm formation ability and have a higher positive rate of a variety of virulence genes [14,15,16]. Relevant studies have shown that livestock-associated methicillin-resistant S. aureus (LA-MRSA) ST398 strains are prevalent in livestock farms, communities and hospitals in Europe and North America, while methicillin-susceptible S. aureus (MSSA) ST7, ST188 and ST398 are predominant in Asia [12,17,18,19,20]. Moreover, our previous work has proved that the S. aureus ST7, ST188 and ST398 strains are the predominant and persistent pathogens in the contamination of fresh rice and flour products, retail meat products and pasteurized milk [21,22]. Therefore, the accurate identification of these three predominant S. aureus STs’ occurrence and contamination is of utmost significance for food safety and clinical diagnosis.
According to the Industry Standard of SN/T 4525.2-2016 (MLST-based molecular typing method of Pathogenic Bacteria in Exported Food, Part 2: Staphylococcus aureus), the predominant steps for S. aureus ST identification include genomic DNA extraction, housekeeping gene amplification, product purification and sequencing analysis, data upload, and sequence alignment, which are expensive, time-consuming and labor-intensive [23]. MLST analysis of S. aureus can also be completed by online analysis (https://pubmlst.org/databases/, accessed on 20 May 2025) with whole genome data using high-throughput sequencing [24]. Nevertheless, high accuracy and great specificity of this method can hardly conceal its shortcomings as costly and time-consuming. To overcome these shortcomings, PCR-based molecular methods have been developed as promising alternatives for the traditional S. aureus MLST analysis. Notably, the selection of highly specific detection targets directly determines the sensitivity and accuracy of molecular detection methods. However, a limited number of specific targets for MLST analysis have been reported so far, such as targets sau1-hsdS1, A07, and C01 for identification of S. aureus ST398 [25,26,27] and targets SA0317 and SA2003 for S. aureus ST239 [28], but there were no targets for ST7 and ST188 as well as other ST strains. With the increase in available S. aureus genomic sequencing data and new isolated S. aureus STs, some reported molecular targets regarded as ST-specific may inevitably be isolated in other STs, and they also have limitations in accuracy and specificity. Therefore, mining of novel ST-specific molecular targets and development of rapid and quantitative technology are essential for accurate identification of the S. aureus predominant STs.
The pan-genome is composed of core and auxiliary gene banks and is a useful framework for describing the diversity of genomes in taxa. Based on the whole-genome data, pan-genomic analysis has great potential in the field of target mining. At present, a large number of S. aureus strains have been fully sequenced (NCBI bank, https://www.ncbi.nlm.nih.gov/, accessed on 10 January 2025), which provided sufficient information on the diversity of S. aureus STs. Using pan-genomic analysis, the potential molecular targets specific for different S. aureus STs can be easily mined. Thus, the aims of this study were to (1) establish a target screening platform based on pan-genome analysis to mine the novel ST-specific targets for detection of the three predominant S. aureus STs; and (2) establish mPCR and qPCR methods using novel molecular targets for simultaneous and quantitative detection of predominant S. aureus STs in actual samples (Figure 1).

2. Results

2.1. Phylogenetic Analysis of S. aureus Isolates

A core genome was determined for each isolate using a 99% cutoff [29]. We identified 1258 core genomes among the selected 371 S. aureus isolates through pan-genome analysis, and then constructed a phylogenetic tree using IQ-TREE 2.0 software.
Figure 1. The workflow for establishment of special target screening and molecular methods for predominant S. aureus STs. The workflow of S. aureus evolutionary tree construction (A → B → C). The workflow for special target screening of S. aureus STs (A → B → D). Establishment of molecular target-based methods for detection of STs (D → E → F → G → H).
Figure 1. The workflow for establishment of special target screening and molecular methods for predominant S. aureus STs. The workflow of S. aureus evolutionary tree construction (A → B → C). The workflow for special target screening of S. aureus STs (A → B → D). Establishment of molecular target-based methods for detection of STs (D → E → F → G → H).
Molecules 30 03889 g001
As shown in Figure S1, isolates were distributed across different STs, and most isolates belonged to ST7, ST188 and ST398. Notably, isolates belonging to different STs were highly discriminated, suggesting an evolutionary divergence between STs.

2.2. Identification of ST-Specific Genes of S. aureus

To screen specific candidate targets for the detection of the three predominant STs of S. aureus, we determined the distribution and size of the S. aureus pan-genome across the 505 genomes with a BLASTP identity cutoff of 85% [29]. A total of five specific markers were identified for these three STs. Notably, two (group_10498 and group_10499), two (group_9419 and group_9415), and one (group_9911) specific gene marker were found in ST7, ST188 and ST398, respectively, and coded for unknown proteins. Whereas A07, C01 and sau1-hsdS1 were previously reported as markers of ST398 [25,26,27], there were no targets reported for the detection of ST7 and ST188. The percentages of genomic sequences harboring these genes are displayed in Table 1. Compared with the reported targets, for both the targeted and non-targeted STs, the specific genes in our study displayed better performance in specificity with the same positive coverage.

2.3. Evaluating Specificity and Sensitivity of ST-Specific Genes Using PCR Assay

Primer sequences designed based on the ST-specific genes are listed in Table 2. Specificity of these primer pairs was determined by PCR using the related strains (Table 3). As expected, all primer sets designed on ST7, ST188 and ST398 specific genes could amplify target bands corresponding to the target strains, while other non-target strains produced no bands (Figure S2), which validated the excellent specificity of these primers. Then, for the anti-interference test of these primers, the other DNA samples from S. aureus ST8 1-1 of 101~107 CFU/mL were mixed with the three predominant S. aureus STs (initial concentration of 106 CFU/mL), respectively. As shown in Figure S3, all amplicons generated by target strains with other bacterial interference showed uniform and clear bands, indicating that all novel primers had excellent anti-interference abilities.
The sensitivity of identification for target genes specific to ST7, ST188 and ST398 was further verified. The LODs for group_10498 and group_10499 (specific for S. aureus ST7) were 8.6 × 103 CFU/mL and 8.6 × 104 CFU/mL, respectively, those for group_9419 and group_9415 were 1.2 × 104 CFU/mL and 1.2 × 103 CFU/mL (specific for S. aureus ST188), respectively, and for group_9911, 6.4 × 104 CFU/mL (specific for S. aureus ST398) (Figure S4).

2.4. Detection of Predominant S. aureus STs in Artificially Contaminated Milk

To evaluate the suitability of ST-specific gene-based PCR methods, we firstly established an mPCR assay for the simultaneous identification of three S. aureus STs in spiked milk. Based on the principle of high primer amplification efficiency and appropriate product length matching, three primer sets from the target genes (group_10498, group_9419 and group_9911) were selected for mPCR analysis.
Under optimal conditions, the mPCR assays were successful in clearly identifying the three target STs (Figure 2A). To assess the sensitivity of the mPCR assay, different concentrations of genomic DNA were tested. Three clear bands for all three target genes in lane 4 and two bands for group_10498 and group_9911 in lane 5 were observed, as shown in Figure 2B, determining that the LODs of mPCR for detection of ST7, ST188 and ST398 were 8.6 × 104 CFU/mL, 1.2 × 105 CFU/mL, and 6.4 × 104 CFU/mL, respectively.
For quantitative detection, we developed a qPCR assay for real-time testing on the three S. aureus STs. As shown in Figure 3A,B, the typical amplification curve and sharp melting curve of target genes indicated this qPCR assay could successfully quantify the three S. aureus STs. The LODs for the quantitative determination of ST7, ST188 and ST398 were 8.6 × 102 CFU/mL, 1.2 × 102 CFU/mL, and 6.4 × 103 CFU/mL, respectively (Figure 3C–E).
To determine the specificity of the mPCR and qPCR methods, genomic DNA from 30 target S. aureus ST strains and 30 non-target S. aureus ST strains were extracted. As shown in Table S1, regardless of the mPCR or qPCR method, positive results were obtained for all target S. aureus ST strains, while negative signals were obtained for non-target bacterial strains, indicating excellent specificity for identification of the three S. aureus STs.

2.5. Anti-Interference Test for mPCR and qPCR

As shown in Figure 4A, a faint band was observed in the mPCR detection of S. aureus ST188 only when the concentration of S. aureus ST8 reached 108 CFU/mL. For samples interfered with by non-target bacteria at other concentrations, correct and clear bands could be produced using the mPCR method. As shown in Figure 4B, no significant differences were noted in the amplification cycle threshold (Ct) values of the qPCR assay for detection of the three target S. aureus STs across different concentrations of interfering non-target S. aureus ST8. These results demonstrate that although the detection signals of the mPCR and qPCR methods established in this study are subject to certain interference under different concentrations of non-target S. aureus ST8, it is acceptable that these methods have strong anti-interference ability and adaptability.

2.6. Application of mPCR and qPCR in Natural Milk to Detect Three S. aureus STs

All detection results for the mPCR and qPCR assays are listed in Table 4. When positive control samples gave accurate results, only one pork meat and one wet rice noodle sample tested positive for S. aureus ST188, and none of the samples tested positive for S. aureus ST7 or ST398 by mPCR or qPCR assay.
As shown in Table 5, the corresponding sensitivity, specificity, and efficiency values were all 100% for the identification of the three predominant S. aureus STs, indicating that the established mPCR and qPCR methods maintained good consistency with the standard MLST method for detection of the three predominant S. aureus STs.

3. Discussion

Molecular subtyping is the most commonly used assay for phenotypic characterization for identification of S. aureus isolates. Molecular subtyping could rapidly determine the association between virulence and source of S. aureus, which is useful in long-term epidemiology and evolutionary studies. As the most commonly used molecular subtyping method for S. aureus characterization, MLST is based on sequences of single nucleotide polymorphisms from seven housekeeping genes to classify STs and CCs, but it is too time-consuming and labor-intensive for the needs of large-scale screening [30]. The molecular target-based PCR method provides an alternative approach for the detection of target S. aureus STs [2]. However, there are few available ST-specific targets for S. aureus identification, except sau1-hsdS1, A07, and C01 used for identification of ST398 [25,26,27]. Targets SA0317 and SA2003 were simultaneously used to identify ST239 [28], and the mPCR method was used for ST764 identification [31]. Moreover, reported targets for detection of different STs are still limited in accuracy and specificity, because similar sequences are screened in different STs. Thus, there is a definite need for mining novel ST-specific molecular targets for reliable detection of other predominant S. aureus STs.
In this work, we screened novel ST-specific targets using a pan-genome analysis on 371 S. aureus genome sequences belonging to 58 different STs and 134 other sequences belonging to other species of Staphylococcus. The pan-genome analysis revealed 27,961 protein-coding genes, including 939 core genes. Isolates belonging to different STs were highly discriminated, suggesting an evolutionary divergence between STs. Five novel ST-specific molecular targets were screened. Among them, the specific targets for ST7 and ST188 identification have not been reported before. The discovery of novel ST-specific molecular targets provides a low-cost, more efficient, and convenient approach for the rapid MLST of S. aureus. Notably, all five target genes encoded hypothetical proteins with little or no information on their function. The identification of these specific hypothetical protein-coding regions can not only improve the accuracy of our established rapid detection methods but also contribute to the analysis of gene structures and functional roles and ultimately promote in-depth understanding of the unique metabolic behaviors and associations of different S. aureus STs [32]. We will conduct more experiments to verify the functions of key unknown target genes. For instance, ref. [33] constructed knockout mutants of unknown genes in target strains and evaluated changes in their phenotypic characteristics (such as biofilm-forming ability and pathogenicity in animal models), and investigated the expression levels of unknown genes under various stress conditions, among other related work. More in-depth functional annotation would lay a solid foundation for exploring the biological significance of these targets in the pathogenic process of S. aureus.
The usefulness of a PCR-based assay is largely dependent on the specificity and sensitivity of the target sequence. Previous work for the identification of specific targets was focused on relatively small genomic datasets including gene fragments or virulence genes. For example, van Belkum et al. (2008) [25] screened the ST398-specific targets SAPIG2194 (A07) and SAPIG2195 (C01) by amplified fragment length polymorphism (AFLP) analysis based on 147 marker fragments from 46 pig-related MRSA isolates. Stegger et al. (2011) [28] identified the ST398-specific target region (530 bp) in sau1-hsdS1 by aligning seven of the publicly available sau1-hsdS1 sequences. According to the reported results, the specificity of the reported targets for ST398 detection could be limited by genetic mutations [34]. In contrast to previous target mining based on coding sequences or single virulence genes, we carried out a pan-genome analysis approach to screen ST-specific targets with high reliability. Pan-genome analysis, which is based on whole-genome sequence alignment, has been used to mine specific markers in bacteria, such as virulence, serovar, molecular subtyping and antibiotic resistance. All markers are usually related to genes acquired though horizontal transfer from the genes of other species, and usually present in species showing corresponding phenotypes [35,36]. Undoubtedly, this study has only established a rapid detection technology for three important S. aureus STs, which is insufficient to meet practical detection needs. In subsequent work, we will further improve the mining of ST molecular targets to achieve accurate identification of other S. aureus STs.
Due to the expansion of the genome database, some nucleotide targets previously considered to be specific are inevitably eliminated. To obtain truly reliable and specific targets, a combination between bioinformatics analysis and a PCR verification based on an extensive collection of bacterial strains is crucial. As shown in Table 1, the novel screened ST-specific targets in this work exhibited better performance compared with those in previously reported studies, and all reported targets showed a slight overlap with the genomes of other species, while the percentages of genomic sequences present in target species and non-target strains were 100% and 0%, respectively. Moreover, we evaluated the ST398-specific targets A07 and C01 using 81 target bacterial strains and 71 other bacterial strains, and found two target genes also matched with genomes of other species, particularly target C01 (Figure S5), which was consistent with the reported results [34]. In comparison, molecular targets mined in our work were more specific to three predominant S. aureus STs. In addition, specificity verification results using 81 target bacterial strains and 71 other bacterial strains also showed excellent performance.
In order to rapidly identify S. aureus STs, some ST-specific target-based PCR methods have been applied [25,26,27,28,31]. However, these methods often require combining multiple targets to distinguish specific STs, which is not conducive to the rapid detection of S. aureus STs. In this study, we achieved simple detection of S. aureus STs based on single specific targets. To further achieve simultaneous and quantitative identification of target bacteria, we firstly established an mPCR method based on the novel targets to detect three predominant S. aureus STs, which showed excellent performance in specificity and anti-interference ability. Then, a qPCR assay was developed for real-time identification of target bacteria. The LODs for quantitative determination of S. aureus ST7, ST188 and ST398 in spiked milk were 8.6 × 102 CFU/mL, 1.2 × 102 CFU/mL, and 6.4 × 103 CFU/mL respectively. The developed qPCR assay has a lower cost and better sensitivity than that reported in other work [28,37]. The mPCR method established in this study has the advantages of low cost and simple operation and can simultaneously detect three S. aureus STs, making it particularly suitable for rapid screening scenarios in primary-level institutions. In comparison, the qPCR method is significantly superior to the mPCR method in terms of detection sensitivity and anti-interference capability. It can achieve accurate quantification of a single target bacterium and provide precise data support for clinical diagnosis and treatment. However, the mPCR and qPCR technologies established in this study would have difficulty meeting the POCT requirements, and false positive results may occur due to aerosol contamination during the detection process. Zhang et al. (2025) [38] developed a recombinase polymerase amplification system combined with lateral flow immunoassay for detection of S. aureus without aerosol contamination. Savas et al. (2025) [39] established a novel smartphone-based nanozyme-enhanced electrochemical immunosensor for S. aureus POCT. The developed biosensor effectively detected S. aureus, with a calculated LOD of 4 CFU/mL in undiluted milk. Combining isothermal amplification technology and test strip technology can effectively improve the method established in this study, thereby truly achieving accurate identification of three S. aureus STs. We successfully applied the mPCR assay and qPCR method to identify S. aureus ST7, ST188 and ST398 in natural food samples. Compared with the standard MLST analysis, our assay was more rapid and convenient [40], providing a preliminary foundation for its use as an alternative solution to the traditional MLST method.

4. Material and Methods

4.1. Bacterial Strains and Genomic DNA Extraction

A total of 198 strains, including 172 S. aureus strains representing 48 different STs and 26 non-S. aureus strains were used in this study (Table 3). These reference strains were isolated from our laboratory, while a few standard strains obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and China Medical Culture Collection (CMCC, Beijing, China). All test bacteria were grown in Luria-Bertani (LB) medium (Guangdong Huankai Co., Ltd., Guangzhou, China) at 37 °C. And the genomic DNA from overnight cultures was extracted with bacterial DNA extraction Mini Kit (Mabio, Guangzhou, China). A microplate reader (Epoch 2, BioTek Instruments Inc., Winooski, VT, USA) and Qubit® 3.0 Fluorometer (Life Invitrogen, Waltham, MA, USA) were used to determine the purity and concentration of genomic DNA respectively, and the extracted DNA was stored at −20 °C before use.

4.2. Phylogenetic Analysis

As shown in Figure 1 (A→B→C), all analyzed S. aureus genome sequences downloaded from NCBI were annotated with Prokka v1.11 [41]. The annotated files (.gff) were collected to perform pan-genome analysis using Roary v3.11.2 [42]. The obtained data (.aln) of a core genome alignment of S. aureus were then used for efficient tree construction using IQ-TREE software 2.0 on a linux platform [43], and the final result was then visualized using iTOL v7.2.1 (https://itol.embl.de/upload.cgi, accessed on 20 May 2025).

4.3. Screening of S. aureus ST-Specific Targets

The 505 Staphylococcus strain genome sequences contained 371 S. aureus sequences of 58 different STs and 134 other non-target S. aureus STs, and the corresponding sequence information is shown in Table S2. The ST-specific molecular targets were screened through pan-genome analysis using Roary software; the workflow is shown in Figure 1 (A → B → D). After the pan-genome analysis, the existence/non-existence profile of all genes across strains was determined and then converted into a 0/1 matrix using a local script. S. aureus FORC59, S. aureus 08-02300 and S. aureus subsp. aureus ST398 were selected as the references for target identification. The screening criteria were as follows: 100% presence in target S. aureus ST strains and 0% presence in non-target S. aureus ST strains. The candidate ST-specific genes were then aligned using the BLAST 2.17.0 program to further validate their specificity.

4.4. Primer-Based Evaluation of Novel ST-Specific Targets

Five candidate targets specific for the S. aureus STs were screened by pan-genome analysis. The primer pairs for these S. aureus ST-specific targets were designed using Primer Premier 6.0 software and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) (Table 2).
The PCR amplifications were performed in a 10 μL PCR reaction volume including 1× Taq Master (Dongsheng, Guangzhou, China), 5 μM of primer pairs, 1 μL of genomic DNA and 3 μL ultrapure water using a Biometra TOne 96G thermal cycler (Analytik Jena, Jena, Germany). The cycling conditions were as follows: initial denaturation at 95 °C for 10 min, followed by 30 cycles of denaturation at 95 °C for 30 s, 57 °C for 40 s, and 72 °C for 30 s, and a final extension at 72 °C for 10 min. The amplicons were run on a 1.5% agarose gel electrophoresis followed by a visualized detection using an automatic digital gel image analysis system (Tanon-2500; Tanon Science & Technology Co., Ltd., Shanghai, China). The specificity of each primer pair was determined against the bacterial strains listed in Table 2. Limits of detection (LODs) were determined with varied concentrations of genomic DNA extracted from fresh cultures of the S. aureus 151-0 strain (ST7), S. aureus 126-0 strain (ST188), and S. aureus 322-1 strain (ST398), respectively.

4.5. Multiplex PCR and Quantitative PCR Conditions

For the simultaneous detection of three S. aureus STs (ST7, ST188 and ST398), mPCR assays based on three specific primers were performed, and contained 12.5 μL of PCR mix, 0.2 μM of primers targeting S. aureus ST188 and S. aureus ST398, 0.5 μM of primers targeting S. aureus ST7, and 1 μL each of the three template DNAs, as well as ultrapure water added to achieve a 25 μL volume. The cycling program was as follows: initial denaturation at 95 °C for 10 min, followed by 30 cycles of denaturation at 95 °C for 30 s, 57 °C for 40 s, and 72 °C for 30 s, and a final extension at 72 °C for 10 min. A 1.5% agarose gel electrophoresis was used to separate all amplified products.
For the quantitative detection of these predominant S. aureus STs, real-time PCR assays based on three specific primers were also performed. Three independent dye-based qPCR methods were prepared, and each reaction mixture contained 5 μL of TB Green™ Premix Ex Taq™ II (TaKaRa, Biotech, Dalian, China), 0.5 μM of primer pairs and 1 μL template DNA, as well as ultrapure water added to reach a 10 μL volume. The qPCR was performed on a Light Cycler® 96 real-time PCR system (Roche, Basel, Switzerland), and the thermal cycling was as follows: denaturation at 95 °C for 100 s, followed by 45 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 30 s. The data were analyzed using LightCycler® 96 1.1.0.1320 software. All results were collected in triplicate.

4.6. Sensitivity of the mPCR/qPCR Assays in Artificially Contaminated Milk Samples

For the LOD evaluation, 25 mL of milk determined to be negative for S. aureus by standard culture methods was homogenized in 225 mL of sterile saline solution. Fresh cultures with strains of these three S. aureus STs were mixed with homogenate to prepare varied concentrations of substrate ranging from 101~108 CFU/mL, then all of the genomic DNA was extracted for mPCR and qPCR analysis.

4.7. Evaluation of Specificity and Anti-Interference Capability of mPCR/qPCR Assays

The specificity of the mPCR and qPCR assays was determined using 30 target S. aureus ST strains and 30 non-target S. aureus ST strains (Table S1), and ultrapure water instead of genomic DNA was used as a negative control. As specificity criteria, primer sets that amplified target bands or generated obvious fluorescence signals from the corresponding target ST strains but not from non-target S. aureus ST strains were considered specific.
To evaluate the accuracy of the mPCR and qPCR methods under the interference of contaminant bacteria, fresh cultures of the three target S. aureus ST strains were mixed with S. aureus strain 1-1 (ST8) at different concentrations, resulting in final concentration ratios of 107:108, 107:107, 107:106, 107:105, 107:104, and 107:103, respectively. DNA templates from all samples were extracted, and detection was performed using the mPCR and qPCR methods, with each sample tested in triplicate.

4.8. Application of the mPCR and qPCR Assays for the Analysis of Food Samples

To determine the validity of the mPCR/qPCR assays for S. aureus ST identification in food samples, a comparative study was performed using the gold standard method (according to guidelines from National Food Safety Standards of China GB 4789.10-2016). Briefly, a total of 30 food samples (including 10 milk, 10 pork meat and 10 wet rice noodle samples) were purchased from local markets, and 25 g/25 mL of each sample was homogenized in 225 mL of sodium chloride broth (Huankai, Guangzhou, China), followed by thorough mixing and culturing at 36 ± 1 °C for 18–24 h. Then, the enrichment cultures were streaked into Baird–Parker plates and blood plates for isolation and purification. Then, genomic DNA of an unknown strain was extracted and used as a template for mPCR and qPCR detection. In parallel, the isolate strains were identified using a combination identification of staining microscopy, hemolysis and coagulase test. The confirmed S. aureus isolates were then subjected to an MLST analysis according to the Industry Standard (SN/T 4525.2-2016). The performance of the qPCR and mPCR methods was further evaluated by using a correlation analysis with the standard MLST method. The main parameters included SE (sensitivity), i.e., the ability to detect positive samples; SP (specificity), i.e., the ability to detect negative samples; and the efficiency (EF); the calculation formulas are as follows:
SE (%) = a/(a + b) × 100
SP (%) = c/(c + d) × 100
EF (%) = (a + c)/(a + b + c + d) × 100
where a is the number of true-positive samples, with positive results obtained using mPCR/qPCR and the traditional MLST method; b is the number of false-positive samples, with a negative result for the traditional MLST method and a positive result for the mPCR/qPCR methods; c is the number of true-negative samples, with negative results determined using mPCR/qPCR and the traditional MLST method; and d is the number of false-negative samples, with a positive result for the traditional MLST method and a negative result for mPCR/qPCR assay.

5. Conclusions

In summary, novel mPCR and qPCR methods were developed to simultaneously and quantitative detect three predominant STs of S. aureus in food using pan-genome analysis. Compared with the standard MLST analysis, the developed molecular methods are low in cost and easy to operate, enabling sensitive and specific detection of three predominant S. aureus STs. The LODs for the mPCR assay in artificially contaminated milk were determined to be 104 CFU/mL for ST7, 105 CFU/mL for ST188, and 104 CFU/mL for ST398, while the LODs achieved by the qPCR method were 8.6 × 102 CFU/mL, 1.2 × 102 CFU/mL, and 6.4 × 103 CFU/mL respectively. The current results indicate that the newly developed mPCR and qPCR detection methods have application potential in the detection of S. aureus in food, providing a preliminary foundation for subsequent exploration of their use as alternative solutions to the traditional MLST method.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules30193889/s1, Figure S1: Phylogenetic analysis of S. aureus; Figure S2: The specificity evaluation of novel targets for three major S. aureus STs by PCR assay; Figure S3: Anti-interference evaluation of primer pairs; Figure S4: Sensitivity of novel target-based PCR assay for detection of three major S. aureus STs; Figure S5: Verification of specificity of the reported target for S. aureus ST398 by PCR amplification. Table S1: Bacterial strains used for specificity evaluation of mPCR and qPCR methods; Table S2: Bacterial strains whose genomes were used for bioinformatics analysis; Reference [44] is cited in the supplementary materials.

Author Contributions

B.Z.: Investigation, Methodology, Data curation, Writing—original draft; X.N.: Project administration, Methodology; X.M.: Supervision, Data curation; J.C. (Jiawen Chen): Validation, Visualization; J.C. (Jiaxin Chen): Validation, Visualization; B.M.: Supervision, Project administration; X.W.: Supervision, Project administration, Writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Jiangxi Provincial Natural Science Foundation (20242BAB20333, 20252BAC240614), Science and Technology Project of Jiangxi Provincial Administration for Market Regulation (GSJK202401) and Research Project of Jiangxi General Institute of Testing and Certification (ZYK202403).

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Acknowledgments

We thank the State Key Laboratory of Applied Microbiology Southern China, Key Laboratory of Agricultural Microbiomics and Precision Application, Ministry of Agriculture and Rural Affairs, faculty members in the Institute of Microbiology, Guangdong Academy of Sciences, Guangzhou, China.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Zhu, J.; Xie, R.; Gao, R.; Zhao, Y.; Yodsanit, N.; Zhu, M.; Burger, J.C.; Ye, M.; Tong, Y.; Gong, S. Multimodal nanoimmunotherapy engages neutrophils to eliminate Staphylococcus aureus infections. Nat. Nanotechnol. 2024, 19, 1032–1043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Zhou, B.; Ye, Q.; Chen, M.; Li, F.; Xiang, X.; Shang, Y.; Wang, C.; Zhang, J.; Xue, L.; Wang, J.; et al. Novel species-specific targets for real-time PCR detection of four common pathogenic Staphylococcus spp. Food Control 2022, 131, 108478. [Google Scholar] [CrossRef] [Scilit]
  3. Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne illness acquired in the United States—Predominant pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, X.; Li, G.; Xia, X.; Yang, B.; Xi, M.; Meng, J. Antimicrobial susceptibility and molecular typing of methicillin-resistant Staphylococcus aureus in retail foods in Shaanxi, China. Foodborne Pathog. Dis. 2014, 11, 281–286. [Google Scholar] [CrossRef] [Scilit]
  5. Zhang, K.; Yang, N.; Mao, R.; Hao, Y.; Teng, D.; Wang, J. An amphipathic peptide combats multidrug-resistant Staphylococcus aureus and biofilms. Commun. Biol. 2024, 7, 1582. [Google Scholar] [CrossRef] [Scilit]
  6. Gong, C.; Guan, W.; Liu, X.; Zheng, Y.; Li, Z.; Zhang, Y.; Zhu, S.; Jiang, H.; Cui, Z.; Wu, S. Biomimetic bacteriophage-like particles formed from probiotic extracts and NO donors for eradicating multidrug-resistant Staphylococcus aureus. Adv. Mater. 2022, 34, e2206134. [Google Scholar] [CrossRef] [Scilit]
  7. Shen, Y.; Liu, Y.; Zhang, Y.; Cripe, J.; Conway, W.; Meng, J.; Hall, G.; Bhagwat, A.A. Isolation and characterization of Listeria monocytogenes isolates from ready-to-eat foods in Florida. Appl. Environ. Microb. 2006, 72, 5073–5076. [Google Scholar] [CrossRef] [Scilit]
  8. O’Hara, F.P.; Suaya, J.A.; Ray, G.T.; Baxter, R.; Brown, M.L.; Mera, R.M.; Close, N.M.; Thomas, E.; Amrine-Madsen, H. spa typing and multilocus sequence typing show comparable performance in a macroepidemiologic study of Staphylococcus aureus in the United States. Microb. Drug Resist. 2016, 22, 88–96. [Google Scholar] [CrossRef] [Scilit]
  9. Akineden, Ö.; Murata, K.J.; Gross, M.; Usleber, E. Microbiological quality of raw dried pasta from the German market with special emphasis on Cronobacter species. J. Food Sci. 2021, 80, 2860–2867. [Google Scholar] [CrossRef] [Scilit]
  10. Li, S.; Sun, S.; Yang, C.; Chen, H.; Yin, Y.; Li, H.; Zhao, C.; Wang, H. The changing pattern of population structure of Staphylococcus aureus from bacteremia in China from 2013 to 2016: ST239-030-MRSA replaced by ST59-t437. Front. Microbiol. 2018, 9, 332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Song, Q.; Zhu, Z.; Chang, Y.; Shen, X.; Gao, H.; Yang, Y. Prevalence and characteristics of enterotoxin B-producing Staphylococcus aureus isolated from food sources: A particular cluster of ST188 strains was identified. J. Food Sci. 2016, 81, 715–718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Zhou, W.; Jin, Y.; Chen, P.; Ge, Q.; Dong, X.; Chen, Y.; Jiang, M.; Xiao, Y. Reshaping the battlefield: A decade of clonal wars among Staphylococcus aureus in China. Drug Resist. Updates 2025, 78, 101178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Wang, Y.; Liu, Q.; Liu, Q.; Gao, Q.; Lu, H.; Meng, H.; Xie, Y.; Huang, Q.; Ma, X.; Wang, H.; et al. Phylogenetic analysis and virulence determinant of the host-adapted Staphylococcus aureus lineage ST188 in China. Emerg. Microbes Infect. 2018, 7, 45. [Google Scholar] [CrossRef] [Scilit]
  14. Gu, J.; Shen, S.; Xiong, M.; Zhao, J.; Tian, H.; Xiao, X.; Li, Y. ST7 becomes one of the most common Staphylococcus aureus clones after the COVID-19 epidemic in the city of Wuhan, China. Infect. Drug Resist. 2023, 16, 843–852. [Google Scholar] [CrossRef] [Scilit]
  15. Zhu, H.; Luo, H.; Zhong, Q.; Cao, X.; Gu, S.; Peng, S.; Xiao, Y.; Chen, Y.; Hang, Y.; Fang, X.; et al. Comparison of molecular characteristics between methicillin-resistant and -susceptible Staphylococcus aureus clinical isolates by whole-genome sequencing. Infect. Drug Resist. Updates 2022, 15, 2949–2958. [Google Scholar]
  16. Tang, Z.; Hu, J.; Chen, J.; Lu, Y.; Lu, Y.; Kong, L.; Diao, L.; Zhang, F.; Xiong, W.; Zeng, Z. Relationship between biofilm formation and molecular typing of Staphylococcus aureus from animal origin. Sci. Agric. Sin. 2022, 55, 602–612. [Google Scholar]
  17. Petinaki, E.; Spiliopoulou, I. Methicillin-resistant Staphylococcus aureus among companion and food-chain animals: Impact of human contacts. Clin. Microbiol. Infect. 2012, 18, 626–634. [Google Scholar] [CrossRef] [Scilit]
  18. David, M.Z.; Siegel, J.; Lowy, F.D.; Zychowski, D.; Taylor, A.; Lee, C.J.; Boyle-Vavra, S.; Daum, R.S. Asymptomatic carriage of sequence type 398, spa type t571 methicillin-susceptible Staphylococcus aureus in an urban jail: A newly emerging, transmissible pathogenic strain. J. Clin. Microbiol. 2013, 51, 2443–2447. [Google Scholar] [CrossRef] [Scilit]
  19. Li, G.; Wu, C.; Wang, X.; Meng, J. Prevalence and characterization of methicillin susceptible Staphylococcus aureus ST398 isolates from retail foods. Int. J. Food Microbiol. 2015, 196, 94–97. [Google Scholar] [CrossRef] [Scilit]
  20. Pérez-Boto, D.; D’Arrigo, M.; García-Lafuente, A.; Bravo, D.; Pérez-Baltar, A.; Gaya, P.; Medina, M.; Arqués, J.L. Staphylococcus aureus in the processing environment of cured meat products. Foods 2023, 12, 2161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Song, M.; Bai, Y.; Xu, J.; Carter, M.Q.; Shi, C.; Shi, X. Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. Int. J. Food Microbiol. 2015, 195, 1–8. [Google Scholar] [CrossRef] [Scilit]
  22. Rong, D.; Liu, Z.; Huang, J.; Zhang, F.; Wu, Q.; Dai, J.; Li, Y.; Zhao, M.; Li, Q.; Zhang, J.; et al. Prevalence and characterization of Staphylococcus aureus and Staphylococcus argenteus isolated from rice and flour products in Guangdong, China. Int. J. Food Microbiol. 2023, 406, 110348. [Google Scholar] [CrossRef] [Scilit]
  23. Schnitt, A.; Lienen, T.; Wichmann-Schauer, H.; Cuny, C.; Tenhagen, B.A. The occurrence and distribution of livestock-associated methicillin-resistant Staphylococcus aureus ST398 on German dairy farms. J. Dairy Sci. 2020, 103, 11806–11819. [Google Scholar] [CrossRef] [Scilit]
  24. Chen, H.; Yin, Y.; Li, X.; Li, S.; Gao, H.; Wang, X.; Zhang, Y.; Liu, Y.; Wang, H. Whole-genome analysis of livestock-associated methicillin-resistant Staphylococcus aureus sequence type 398 strains isolated from patients with bacteremia in China. J. Infect. Dis. 2020, 221, 220–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Van Belkum, A.; Melles, D.C.; Peeters, J.K.; Van Leeuwen, W.B.; Van Duijkeren, E.; Huijsdens, X.W.; Spalburg, E.; De Neeling, A.J.; Verbrugh, H.A. Methicillin-resistant and -susceptible Staphylococcus aureus sequence type 398 in pigs and humans. Emerg. Infect. Dis. 2008, 14, 479–483. [Google Scholar] [CrossRef]
  26. Van Wamel, W.J.; Hansenová Manásková, S.; Fluit, A.C.; Verbrugh, H.; de Neeling, A.J.; Van Duijkeren, E.; Van Belkum, A. Short term micro-evolution and PCR-detection of methicillin-resistant and -susceptible Staphylococcus aureus sequence type 398. Eur. J. Clin. Microbiol. Infect. Dis. 2010, 29, 119–122. [Google Scholar] [CrossRef] [Scilit]
  27. Feil, E.J.; Nickerson, E.K.; Chantratita, N.; Wuthiekanun, V.; Srisomang, P.; Cousins, R.; Pan, W.; Zhang, G.; Xu, B.; Day, N.P.; et al. Rapid detection of the pandemic methicillin-resistant Staphylococcus aureus clone ST 239, a dominant strain in Asian hospitals. J. Clin. Microbiol. 2008, 46, 1520–1522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Stegger, M.; Lindsay, J.A.; Moodley, A.; Skov, R.; Broens, E.M.; Guardabassi, L. Rapid PCR detection of Staphylococcus aureus clonal complex 398 by targeting the restriction-modification system carrying sau1-hsdS1. J. Clin. Microbiol. 2011, 49, 732–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Pang, R.; Xie, T.; Wu, Q.; Li, Y.; Lei, T.; Zhang, J.; Ding, Y.; Wang, J.; Xue, L.; Chen, M.; et al. Comparative genomic analysis reveals the potential risk of Vibrio parahaemolyticus isolated from ready-to-eat foods in China. Front. Microbiol. 2019, 10, 186. [Google Scholar] [CrossRef] [Scilit]
  30. Zhou, Z.; Charlesworth, J.; Achtman, M. HierCC: A multi-level clustering scheme for population assignments based on core genome MLST. Bioinformatics 2021, 37, 3645–3646. [Google Scholar] [CrossRef] [Scilit]
  31. Ogihara, S.; Inoue, O.; Yamagami, T.; Yanagimoto, K.; Uematsu, K.; Hisada, Y.; Uchida, T.; Ohta, M.; Suzuki-Inoue, K. Clinical characteristics and molecular analysis of USA300 and ST 764 methicillin-resistant Staphylococcus aureus isolates from outpatients in Japan by PCR-based open reading frame typing. J. Infect. Chemother. 2021, 27, 466–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Ye, Q.; Shang, Y.; Chen, M.; Pang, R.; Li, F.; Wang, C.; Xiang, X.; Zhou, B.; Zhang, S.; Zhang, J.; et al. Identification of new serovar-specific detection targets against Salmonella B serogroup using large-scale comparative genomics. Food Control 2021, 124, 107862. [Google Scholar] [CrossRef] [Scilit]
  33. Schiebel, J.; Böhm, A.; Nitschke, J.; Burdukiewicz, M.; Weinreich, J.; Ali, A.; Roggenbuck, D.; Rödiger, S.; Schierack, P. Genotypic and phenotypic characteristics associated with biofilm formation by human clinical Escherichia coli isolates of different pathotypes. Appl. Environ. Microbiol. 2017, 83, e01660-17. [Google Scholar] [CrossRef] [Scilit]
  34. Wardyn, S.E.; Smith, T.C. False positives and negatives obtained with PCR-based identification of Staphylococcus aureus clonal complex 398. J. Clin. Microbiol. 2014, 52, 701–702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. McInerney, J.O.; McNally, A.; O’Connell, M.J. Why prokaryotes have pangenomes. Nat. Microbiol. 2017, 2, 17040. [Google Scholar] [CrossRef] [Scilit]
  36. Buchanan, C.J.; Webb, A.L.; Mutschall, S.K.; Kruczkiewicz, P.; Barker, D.; Hetman, B.M.; Gannon, V.; Abbott, D.W.; Thomas, J.E.; Inglis, G.D.; et al. A genome-wide association study to identify diagnostic markers for human pathogenic Campylobacter jejuni strains. Front. Microbiol. 2017, 8, 1224. [Google Scholar] [CrossRef] [Scilit]
  37. Kim, E.; Yang, S.M.; Won, J.E.; Kim, D.Y.; Kim, D.S.; Kim, H.Y. Real-time PCR method for the rapid detection and quantification of pathogenic Staphylococcus species based on novel molecular target genes. Foods 2021, 10, 2839. [Google Scholar] [CrossRef] [Scilit]
  38. Zhang, Y.; Liu, X.; Luo, J.; Liu, H.; Li, Y.; Liu, J.; Zhu, L.; Wang, J.; Zeng, H. Dual recombinase polymerase amplification system combined with lateral flow immunoassay for simultaneous detection of Staphylococcus aureus and Vibrio parahaemolyticus. J. Pharm. Biomed. Anal. 2025, 255, 116621. [Google Scholar] [CrossRef] [Scilit]
  39. Savas, S.; Kılıç, Y.; Gharibzahedi, S.M.T.; Altintas, Z. A novel smartphone-based nanozyme-enhanced electrochemical immunosensor for ultrasensitive direct detection of Staphylococcus aureus in milk and blood serum. Sens. Bio-Sens. Res. 2025, 49, 100822. [Google Scholar] [CrossRef] [Scilit]
  40. Trindade, P.A.; McCulloch, J.A.; Oliveira, G.A.; Mamizuka, E.M. Molecular techniques for MRSA typing: Current issues and perspectives. Braz. J. Infect. Dis. 2003, 7, 32–43. [Google Scholar] [CrossRef] [Scilit]
  41. Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Basic Local Alignment Search Tool. Available online: https://www.ncbi.nlm.nih.gov/genome/ (accessed on 10 January 2025).
Figure 2. The mPCR results for detection of predominant S. aureus STs in artificially contaminated milk. (A) Feasibility analysis of mPCR method, lanes 1–3: target ST7, lanes 4–6: target ST398, lanes 7–9: target ST188, lanes 10–12: ST7 + ST398, lanes 13–15: ST7 + ST188, lanes 16–18: ST188 + ST398, lanes 19–21: ST7 + ST188 + ST398. (B) Sensitivity of mPCR for simultaneous detection of predominant S. aureus STs, lanes 1–8: Mixture of predominant S. aureus STs’ template DNA from 108 to 101 CFU/mL. M: DL2000 DNA marker, C: negative control.
Figure 2. The mPCR results for detection of predominant S. aureus STs in artificially contaminated milk. (A) Feasibility analysis of mPCR method, lanes 1–3: target ST7, lanes 4–6: target ST398, lanes 7–9: target ST188, lanes 10–12: ST7 + ST398, lanes 13–15: ST7 + ST188, lanes 16–18: ST188 + ST398, lanes 19–21: ST7 + ST188 + ST398. (B) Sensitivity of mPCR for simultaneous detection of predominant S. aureus STs, lanes 1–8: Mixture of predominant S. aureus STs’ template DNA from 108 to 101 CFU/mL. M: DL2000 DNA marker, C: negative control.
Molecules 30 03889 g002
Figure 3. The qPCR results for quantitative detection of predominant S. aureus STs in artificially contaminated milk. (A) Amplification curve analysis of qPCR methods. (B) Resolution melting analysis of qPCR methods; (CE) Establishment of standard curves by cycle threshold (Ct) values against the log numbers of cells of three S. aureus STs, S. aureus ST7, ST188 and ST398, in a range of 103~109 CFU/mL, respectively. All results were collected in triplicate.
Figure 3. The qPCR results for quantitative detection of predominant S. aureus STs in artificially contaminated milk. (A) Amplification curve analysis of qPCR methods. (B) Resolution melting analysis of qPCR methods; (CE) Establishment of standard curves by cycle threshold (Ct) values against the log numbers of cells of three S. aureus STs, S. aureus ST7, ST188 and ST398, in a range of 103~109 CFU/mL, respectively. All results were collected in triplicate.
Molecules 30 03889 g003
Figure 4. Anti-interference evaluation of mPCR (A) and qPCR (B) assays for detection of three predominant S. aureus STs. Lanes 1–6: non-target S. aureus ST8 of 103~108 CFU/mL mixed with three predominant S. aureus STs (initial concentration of 107 CFU/mL), respectively, M: DL2000 DNA marker, Ct values: cycle threshold (Ct) values.
Figure 4. Anti-interference evaluation of mPCR (A) and qPCR (B) assays for detection of three predominant S. aureus STs. Lanes 1–6: non-target S. aureus ST8 of 103~108 CFU/mL mixed with three predominant S. aureus STs (initial concentration of 107 CFU/mL), respectively, M: DL2000 DNA marker, Ct values: cycle threshold (Ct) values.
Molecules 30 03889 g004
Table 1. Presence profile of novel and reported S. aureus ST-specific genes for target and non-target strains.
Table 1. Presence profile of novel and reported S. aureus ST-specific genes for target and non-target strains.
TargetTarget GenesPresence Profile inSource
Target StrainNon-Target Strain
S. aureus ST7group_1049810 (100%)0 (0%)This study
group_1049910 (100%)0 (0%)This study
S. aureus ST188group_94193 (100%)0 (0%)This study
group_94153 (100%)0 (0%)This study
S. aureus ST398group_991134 (100%)0 (0%)This study
A0734 (100%)2 (0.4%)[26]
C0134 (100%)21 (4.2%)[26]
sau1-hsdS134 (100%)18 (3.6%)[28]
Table 2. ST-specific target information, primer set sequences and PCR detection sensitivity results.
Table 2. ST-specific target information, primer set sequences and PCR detection sensitivity results.
TargetName of Target GeneEncoded Protein* Gene LocationPrimer Set NameSequence (5′-3′)Product Size (bp)LOD in Pure Culture (cfu/mL)
S. aureus ST7group_10498hypothetical protein2366410~2366754ST-1 (F)GTTACATCAGATCAAGCAGAG1198.6 × 103
ST-1 (R)GCATTTAGAAAAGCAGTGG
group_10499hypothetical protein2366764~2367651ST-2 (F)CGACTATCAGTTTTACAATCC3698.6 × 104
ST-2 (R)CGTATAGACCTAACCCAGC
S. aureus ST188group_9419hypothetical protein2475310~2475726ST-3 (F)GATGTTATTCCTATCGCAACG2381.2 × 104
ST-3 (R)GAACGCCACTACTTTCACTTT
group_9415hypothetical protein2445882~2446304ST-4 (F)GCCCTATAACTTTACGACGCAG3881.2 × 103
ST-4 (R)CCAACTATTGATTTGATTTACCACG
S. aureus ST398group_9911hypothetical protein2275068~2275370ST-5 (F)CTTCTACGATGCCTTAGC2316.4 × 104
ST-5 (R)TGTTCAATGACGGTTTCT
* Reference strains are S. aureus FORC59, S. aureus 08-02300 and S. aureus subsp. aureus ST398.
Table 3. Bacterial strains used in this study and specificity results for target primers used in PCR amplification.
Table 3. Bacterial strains used in this study and specificity results for target primers used in PCR amplification.
No.Bacterial SpeciesStrainsST TypeNumber of StrainsSource *Special Target for PCR Results
ST7ST188ST398
1–23S. aureus7-1, 22-0, 22-1, 42-0, 42-1, 42-2, 44-1, 151-0, 151-1, 173-0, 177-0, 178-1, 178-2, 192-0, 192-1, 201-0, 201-1, 201-2, 202-1, 203-0, 203-2, 306-1, 322-1723a+
1–2365-1, 65-2, 126-0, 126-1, 153-0, 1475-1, 1863-1, 510A-1, 545-1, 636-1, 663-1, 742-1, 3055-1, 3151-1, 3151C1, 3153-1, 3153A1, 3153A2, 3153B3, 3185-1, 3188-1, 3231-1, 3260-118823a+
1–819-0, 67-0, 229-0, 436, 489, 531, 548, 549, 646, 706, 976, 1003, 1023, 1142, 1198, 1255, 1272, 1352B, 1387-1C, 1492, 1494, 1723, 1772, 1823-0, 1879, 1929-0, 1973-0, 1973-1, 2011-1, 2092-0, 2094-0, 2094-1, 2152-0, 2155-0, 2180-0, 2183-0, 2194-1, 2197-0, 2429-1, 2517-0, 2517-1, 2553-0, 2553-2, 2566-1, 2566-2, 2651-0, 2651-1, 2680-0, 2831, 3026, 3122, 3152, 3224, 3373, 3375, 3677, 3678, 3728A1, 3755, 3755A1, 3838B1, 3838C2, 3981, 3988, 3993, 3993A1, 4022C2, 4051, 4051A3, 4076A1, 4123, 4173, 4174, 4260A1, 4266C1, 4275, 4291A1, 697A, 2816-5, 2816-8, 2831-339881a+
116-011a
2396101a
3922-010851a
41393121a
52753-213011a
638951331a
717151a
84142116351a
93456B116591a
102874B119201a
111843201a
123098221a
13486251a
1426025921a
15102529901a
16353301a
17114830551a
184213331a
193652C133551a
202194-236851a
2130434031a
22157-040621a
23392946911a
242630-146921a
25370446931a
26392946941a
274029C251a
2829-05041a
2952-05221a
3010225371a
311831-05731a
32368591a
3324-06301a
341813-06721a
352039-06921a
3624-2721a
371-181a
38631881a
391-091a
40223-29061a
413251B19431a
4273-19441a
433675C19501a
4411909651a
45707971a
46S. epidermidis612-1/1a
47S. hominis0651-3/1a
48S. haemolyticus0770-1/1a
49S. capitis0640-3/1a
50S. warneri0629-1/1a
51S. saprophyticus1045-1/1a
52S. sciuri0729-7/1a
53S. lugdunensis0791-2/1a
54S. cohnii0616-5/1a
55S. pasteuri0821-1/1a
56S. gallinarum2483-1/1a
57S. hyicus0747-6/1a
58S. equorum1217-4/1a
59S. schleiferi2926B2-2/1a
60S. succinus1580-1/1a
61S. lentus1091-2/1a
62Shigella sonnei0639-1/1a
63L. monocytogenesATCC19114/1b
64V. parahemolyticusATCC33847/1b
65P. aeruginosaATCC15442/1b
66Escherichia coliCMCC44103/1c
67P. mirabilisCMCC49005/1c
68S. enteritidisCMCC50335/1c
69C. sakazakiiATCC29544/1b
70B. cereusATCC14579/1b
71C. jejuniATCC6633/1b
* a, our laboratory isolate. b, ATCC, American Type Culture Collection, USA. c, CMCC, China Medical Culture Collection, China. (+/−) indicate positive and negative signals.
Table 4. mPCR and qPCR assay results for natural food samples.
Table 4. mPCR and qPCR assay results for natural food samples.
No.SampleTest Results for
ST7ST188ST398
Conventional MLSTmPCRqPCRConventional MLSTmPCRqPCRConventional MLSTmPCRqPCR
1Milk
(n = 10)
2
3
4
5
6
7
8
9
10
11pork meat
(n = 10)
12
13
14
15
16
17
18+++
19
20
21wet rice noodle
(n = 10)
22
23
24+++
25
26
27
28
29
30
Table 5. Statistical analysis between mPCR/qPCR assays and standard MLST method in actual samples detection.
Table 5. Statistical analysis between mPCR/qPCR assays and standard MLST method in actual samples detection.
Species StrainNumber of SamplesStandard MLST MethodmPCR MethodqPCR MethodSensitivity (%)Specificity (%)Efficiency
(%)
+++
S. aureus ST730030030030100100100
S. aureus ST18830228228228100100100
S. aureus ST39830030030030100100100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhou, B.; Nie, X.; Mao, X.; Chen, J.; Chen, J.; Ma, B.; Wu, X. Novel ST-Specific Molecular Target-Based Method for Simultaneous and Quantitative Detection of Staphylococcus aureus ST7, ST188 and ST398. Molecules 2025, 30, 3889. https://doi.org/10.3390/molecules30193889

AMA Style

Zhou B, Nie X, Mao X, Chen J, Chen J, Ma B, Wu X. Novel ST-Specific Molecular Target-Based Method for Simultaneous and Quantitative Detection of Staphylococcus aureus ST7, ST188 and ST398. Molecules. 2025; 30(19):3889. https://doi.org/10.3390/molecules30193889

Chicago/Turabian Style

Zhou, Baoqing, Xiang Nie, Xudong Mao, Jiaxin Chen, Jiawen Chen, Bingfeng Ma, and Xin Wu. 2025. "Novel ST-Specific Molecular Target-Based Method for Simultaneous and Quantitative Detection of Staphylococcus aureus ST7, ST188 and ST398" Molecules 30, no. 19: 3889. https://doi.org/10.3390/molecules30193889

APA Style

Zhou, B., Nie, X., Mao, X., Chen, J., Chen, J., Ma, B., & Wu, X. (2025). Novel ST-Specific Molecular Target-Based Method for Simultaneous and Quantitative Detection of Staphylococcus aureus ST7, ST188 and ST398. Molecules, 30(19), 3889. https://doi.org/10.3390/molecules30193889

Article Metrics

Back to TopTop