Anticancer Effect of Cycas media: Molecular Basis Through Modulation of PI3K/AKT/mTOR Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Phytochemical Elucidation of C. media by LC–ESI–MS/MS
2.2. Effect on Cytotoxicity
2.3. Cell Cycle Analysis
2.4. Tumor Volume and Tumor Inhibition Rate in Experimental Animals
2.5. In Vivo Toxicity Profile of C. media Extract
2.6. Effect on Oxidative Stress Biomarkers
2.7. Effect on PI3K/p-AkT/p-mTOR Signaling Pathway
2.8. Bacterial Susceptibility to C. media
2.9. Growth Kinetics
2.10. Membrane Integrity
3. Discussion
4. Materials and Methods
4.1. Collection, Drying, and Extraction of C. media
4.2. Cell Line Culture
4.3. MTT Cytotoxicity Assay
4.4. Cell Cycle Analysis
4.5. Experimental Animals and Study Design
4.6. Determination of Biochemical Parameters
4.6.1. Toxicity Profile
4.6.2. Evaluation of Oxidative Stress
4.6.3. Western Blot Assay for PI3K, p-AkT and p-mTOR
4.6.4. Gene Expression Analysis
4.7. Bacteria
4.7.1. Sensitivity to C. media
4.7.2. Minimum Inhibitory Concentration (MIC) of C. media Extract
4.7.3. Influence on the Growth of S. aureus Isolates
4.7.4. Influence on the Membrane Integrity of S. aureus Isolates
4.8. Statistics
5. Limitations of the Study and Future Prospectives
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Mathur, P.; Sathishkumar, K.; Chaturvedi, M.; Das, P.; Sudarshan, K.L.; Santhappan, S.; Nallasamy, V.; John, A.; Narasimhan, S.; Roselind, F.S. Cancer Statistics, 2020: Report From National Cancer Registry Programme, India. JCO Glob. Oncol. 2020, 6, 1063–1075. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.S.; Saikia, B.J. Cancer and cure: A critical analysis. Indian J. Cancer 2016, 53, 441–442. [Google Scholar] [CrossRef] [PubMed]
- Abu-Darwish, M.S.; Efferth, T. Medicinal Plants from Near East for Cancer Therapy. Front. Pharmacol. 2018, 9, 56. [Google Scholar] [CrossRef] [PubMed]
- Seca, A.M.L.; Pinto, D. Plant Secondary Metabolites as Anticancer Agents: Successes in Clinical Trials and Therapeutic Application. Int. J. Mol. Sci. 2018, 19, 263. [Google Scholar] [CrossRef]
- El-Seadawy, H.M.; Abo El-Seoud, K.A.; El-Aasr, M.; Tawfik, H.O.; Ragab, A.E. Toxoplasmocidal and Cytotoxic Activities Guided Isolation and Characterization of an Undescribed Bioflavonoid-di-C-glucoside from Cycas rumphii Miq. Cultivated in Egypt. Plants 2022, 11, 2867. [Google Scholar] [CrossRef]
- Bera, S.; Das, B.; De, A.; Barua, A.; Das, S.; De, B.; Samanta, A. Metabolite profiling and in-vitro colon cancer protective activity of Cycas revoluta cone extract. Nat. Prod. Res. 2020, 34, 599–603. [Google Scholar] [CrossRef]
- Hari, V.; Jothieswari, D.; Maheswaramma, K. Pharmacological screening of antitumor potential on Cycas beddomei Dyer: An endangered species of Cycadaceae family. Int. J. Health Sci. 2022, 6, 9751–9763. [Google Scholar] [CrossRef]
- Du, Q.; Xing, N.; Guo, S.; Li, R.; Meng, X.; Wang, S. Cycads: A comprehensive review of its botany, traditional uses, phytochemistry, pharmacology and toxicology. Phytochemistry 2024, 220, 114001. [Google Scholar] [CrossRef]
- El-Seadawy, H.; Aboelsauod, K.; El-Aasr, M.; Ragab, A. Cycadaceae: An Important Source for Biflavonoids and Various Pharmacological Effects of Different Cycas Species. J. Adv. Med. Pharm. Res. 2023, 4, 35–41. [Google Scholar] [CrossRef]
- Tareq, A.M.; Farhad, S.; Neshar Uddin, A.B.M.; Hoque, M.; Nasrin, M.S.; Uddin, M.M.R.; Hasan, M.; Sultana, A.; Munira, M.S.; Lyzu, C.; et al. Chemical profiles, pharmacological properties, and in silico studies provide new insights on Cycas pectinata. Heliyon 2020, 6, e04061. [Google Scholar] [CrossRef] [PubMed]
- Moawad, A.; Hetta, M.; Zjawiony, J.K.; Jacob, M.R.; Hifnawy, M.; Marais, J.P.; Ferreira, D. Phytochemical investigation of Cycas circinalis and Cycas revoluta leaflets: Moderately active antibacterial biflavonoids. Planta Medica 2010, 76, 796–802. [Google Scholar] [CrossRef] [PubMed]
- Afifi, N.; Moawad, A.; Hassan, M.; El Amir, D.; Elwekeel, A.; Saleh, E. Phytochemical content and biological activity of the genus Cycas, Family Cycadaceae: A review. Pharm. Sci. Asia 2021, 48, 300–319. [Google Scholar] [CrossRef]
- Moawad, A.; Hetta, M.; Zjawiony, J.K.; Ferreira, D.; Hifnawy, M. Two new dihydroamentoflavone glycosides from Cycas revoluta. Nat. Prod. Res. 2014, 28, 41–47. [Google Scholar] [CrossRef]
- Negm, W.A.; El-Rahim, A.; Ibrahim, A.R.; Aboelsauod, K.; Attia, G.; Ragab, A. A New Cytotoxic and Antioxidant Amentoflavone Monoglucoside from Cycas revoluta Thunb Growing in Egypt. J. Pharm. Sci. Res. 2016, 8, 343–350. [Google Scholar]
- Sun, K.; Luo, J.; Guo, J.; Yao, X.; Jing, X.; Guo, F. The PI3K/AKT/mTOR signaling pathway in osteoarthritis: A narrative review. Osteoarthr. Cartil. 2020, 28, 400–409. [Google Scholar] [CrossRef]
- Kim, D.H.; Sarbassov, D.D.; Ali, S.M.; King, J.E.; Latek, R.R.; Erdjument-Bromage, H.; Tempst, P.; Sabatini, D.M. mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell 2002, 110, 163–175. [Google Scholar] [CrossRef]
- Mendonça, D.B.; Nguyen, J.T.; Haidar, F.; Fox, A.L.; Ray, C.; Amatullah, H.; Liu, F.; Kim, J.K.; Krebsbach, P.H. MicroRNA-1911-3p targets mEAK-7 to suppress mTOR signaling in human lung cancer cells. Heliyon 2020, 6, e05734. [Google Scholar] [CrossRef]
- Nguyen, J.T.; Haidar, F.S.; Fox, A.L.; Ray, C.; Mendonça, D.B.; Kim, J.K.; Krebsbach, P.H. mEAK-7 Forms an Alternative mTOR Complex with DNA-PKcs in Human Cancer. iScience 2019, 17, 190–207. [Google Scholar] [CrossRef]
- Nguyen, J.T.; Ray, C.; Fox, A.L.; Mendonça, D.B.; Kim, J.K.; Krebsbach, P.H. Mammalian EAK-7 activates alternative mTOR signaling to regulate cell proliferation and migration. Sci. Adv. 2018, 4, eaao5838. [Google Scholar] [CrossRef]
- Sarbassov, D.D.; Guertin, D.A.; Ali, S.M.; Sabatini, D.M. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 2005, 307, 1098–1101. [Google Scholar] [CrossRef] [PubMed]
- Miricescu, D.; Totan, A.; Stanescu-Spinu, I.-I.; Badoiu, S.C.; Stefani, C.; Greabu, M. PI3K/AKT/mTOR Signaling Pathway in Breast Cancer: From Molecular Landscape to Clinical Aspects. Int. J. Mol. Sci. 2021, 22, 173. [Google Scholar] [CrossRef] [PubMed]
- Shiau, J.-P.; Chuang, Y.-T.; Cheng, Y.-B.; Tang, J.-Y.; Hou, M.-F.; Yen, C.-Y.; Chang, H.-W. Impacts of Oxidative Stress and PI3K/AKT/mTOR on Metabolism and the Future Direction of Investigating Fucoidan-Modulated Metabolism. Antioxidants 2022, 11, 911. [Google Scholar] [CrossRef] [PubMed]
- Pang, Z.; Raudonis, R.; Glick, B.R.; Lin, T.-J.; Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and alternative therapeutic strategies. Biotechnol. Adv. 2019, 37, 177–192. [Google Scholar] [CrossRef]
- Howden, B.P.; Giulieri, S.G.; Wong Fok Lung, T.; Baines, S.L.; Sharkey, L.K.; Lee, J.Y.; Hachani, A.; Monk, I.R.; Stinear, T.P. Staphylococcus aureus host interactions and adaptation. Nat. Rev. Microbiol. 2023, 21, 380–395. [Google Scholar] [CrossRef]
- Gad, D.; Abo Mansour, H.E.; Saad-Allah, K.M.; Abdallah, M.S.; Ibrahim Elberri, A.; Mosalam, E.M. Biostimulants improve the hepatoprotection of Ammi visnaga seed yield extract against carbon tetrachloride induced acute hepatitis in mice through modulation of MAPK. Saudi J. Biol. Sci. 2022, in press. [Google Scholar] [CrossRef]
- Salem, M.A.; Mohamed, O.G.; Mosalam, E.M.; Elberri, A.I.; Abdel-Bar, H.M.; Hassan, M.; Al-Karmalawy, A.A.; Tripathi, A.; Ezzat, S.M.; Abo Mansour, H.E. Investigation of the phytochemical composition, antioxidant, antibacterial, anti-osteoarthritis, and wound healing activities of selected vegetable waste. Sci. Rep. 2023, 13, 13034. [Google Scholar] [CrossRef]
- Porta, C.; Paglino, C.; Mosca, A. Targeting PI3K/Akt/mTOR Signaling in Cancer. Front. Oncol. 2014, 4, 64. [Google Scholar] [CrossRef]
- Hayes, J.D.; Dinkova-Kostova, A.T.; Tew, K.D. Oxidative Stress in Cancer. Cancer Cell 2020, 38, 167–197. [Google Scholar] [CrossRef]
- Jelic, M.D.; Mandic, A.D.; Maricic, S.M.; Srdjenovic, B.U. Oxidative stress and its role in cancer. J. Cancer Res. Ther. 2021, 17, 22–28. [Google Scholar] [CrossRef]
- Zhang, J.; Zheng, S.; Wang, S.; Liu, Q.; Xu, S. Cadmium-induced oxidative stress promotes apoptosis and necrosis through the regulation of the miR-216a-PI3K/AKT axis in common carp lymphocytes and antagonized by selenium. Chemosphere 2020, 258, 127341. [Google Scholar] [CrossRef] [PubMed]
- Ismail, A.; Hassan, H.M.; Moawad, A.S.; Abdel Fattah, S.M.; Sherif, N.H.; Abdelmohsen, U.R.; Radwan, M.M.; Rateb, M.E.; Hetta, M.H. Chemical composition and therapeutic potential of three Cycas species in brain damage and pancreatitis provoked by γ-radiation exposure in rats. J. Radiat. Res. Appl. Sci. 2020, 13, 38–52. [Google Scholar] [CrossRef]
- Liao, Z.; Yeoh, Y.-K.; Parumasivam, T.; Koh, W.Y.; Alrosan, M.; Alu’datt, M.H.; Tan, T.-C. Medium-chain dicarboxylic acids: Chemistry, pharmacological properties, and applications in modern pharmaceutical and cosmetics industries. RSC Adv. 2024, 14, 17008–17021. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Yang, X.; Han, H.; Wen, Z.; Yang, M.; Zhang, Y.; Fu, J.; Wang, X.; Yin, T.; Lu, G.; et al. Design, synthesis and biological evaluation of anilide (dicarboxylic acid) shikonin esters as antitumor agents through targeting PI3K/Akt/mTOR signaling pathway. Bioorg. Chem. 2021, 111, 104872. [Google Scholar] [CrossRef]
- Wróblewska-Łuczka, P.; Cabaj, J.; Bargieł, J.; Łuszczki, J.J. Anticancer effect of terpenes: Focus on malignant melanoma. Pharmacol. Rep. 2023, 75, 1115–1125. [Google Scholar] [CrossRef]
- Xing, X.; Ma, J.H.; Fu, Y.; Zhao, H.; Ye, X.X.; Han, Z.; Jia, F.J.; Li, X. Essential oil extracted from erythrina corallodendron L. leaves inhibits the proliferation, migration, and invasion of breast cancer cells. Medicine 2019, 98, e17009. [Google Scholar] [CrossRef]
- Lalam, C.; Petla, N.; Tantravahi, S. Antiproliferative and Antibacterial Effects of Pyroglutamic Acid Isolated from Enterococcus Faecium (Mcc-2729). Ann. Rom. Soc. Cell Biol. 2021, 25, 7624–7628. [Google Scholar]
- Montenegro, L.; Panico, A.M.; Santagati, L.M.; Siciliano, E.A.; Intagliata, S.; Modica, M.N. Solid Lipid Nanoparticles Loading Idebenone Ester with Pyroglutamic Acid: In Vitro Antioxidant Activity and In Vivo Topical Efficacy. Nanomaterials 2019, 9, 43. [Google Scholar] [CrossRef]
- Wu, X.; Koh, G.Y.; Huang, Y.; Crott, J.W.; Bronson, R.T.; Mason, J.B. The Combination of Curcumin and Salsalate is Superior to Either Agent Alone in Suppressing Pro-Cancerous Molecular Pathways and Colorectal Tumorigenesis in Obese Mice. Mol. Nutr. Food Res. 2019, 63, 1801097. [Google Scholar] [CrossRef]
- Baltazar, M.T.; Dinis-Oliveira, R.J.; Duarte, J.A.; Bastos, M.L.; Carvalho, F. Antioxidant properties and associated mechanisms of salicylates. Curr. Med. Chem. 2011, 18, 3252–3264. [Google Scholar] [CrossRef]
- Bae, S.J.; Kim, J.E.; Choi, H.J.; Choi, Y.J.; Lee, S.J.; Gong, J.E.; Seo, S.; Yang, S.Y.; An, B.-S.; Lee, H.S.; et al. α-Linolenic Acid-Enriched Cold-Pressed Perilla Oil Suppress High-Fat Diet-Induced Hepatic Steatosis through Amelioration of the ER Stress-Mediated Autophagy. Molecules 2020, 25, 2662. [Google Scholar] [CrossRef] [PubMed]
- Friedrichs, W.; Ruparel, S.B.; Marciniak, R.A.; deGraffenried, L. Omega-3 Fatty Acid Inhibition of Prostate Cancer Progression to Hormone Independence Is Associated with Suppression of mTOR Signaling and Androgen Receptor Expression. Nutr. Cancer 2011, 63, 771–777. [Google Scholar] [CrossRef] [PubMed]
- Szczepańska, P.; Rychlicka, M.; Groborz, S.; Kruszyńska, A.; Ledesma-Amaro, R.; Rapak, A.; Gliszczyńska, A.; Lazar, Z. Studies on the Anticancer and Antioxidant Activities of Resveratrol and Long-Chain Fatty Acid Esters. Int. J. Mol. Sci. 2023, 24, 7167. [Google Scholar] [CrossRef]
- Suhail, M.; Khan, M.S.; Ahmad, A.; Zughaibi, T.A.; Husain, F.M.; Rehman, M.T.; Tabrez, S. Flavonoids and PI3K/Akt/mTOR signaling cascade: A potential crosstalk in anticancer treatment. Curr. Med. Chem. 2021, 28, 8083–8097. [Google Scholar]
- Zughaibi, T.A.; Suhail, M.; Tarique, M.; Tabrez, S. Targeting PI3K/Akt/mTOR Pathway by Different Flavonoids: A Cancer Chemopreventive Approach. Int. J. Mol. Sci. 2021, 22, 12455. [Google Scholar] [CrossRef]
- Zhang, H.W.; Hu, J.J.; Fu, R.Q.; Liu, X.; Zhang, Y.H.; Li, J.; Liu, L.; Li, Y.N.; Deng, Q.; Luo, Q.S.; et al. Flavonoids inhibit cell proliferation and induce apoptosis and autophagy through downregulation of PI3Kγ mediated PI3K/AKT/mTOR/p70S6K/ULK signaling pathway in human breast cancer cells. Sci. Rep. 2018, 8, 11255. [Google Scholar] [CrossRef]
- Lai, C.; Huang, M.; Xiong, Q.; Liang, Y.; Jiang, Y.; Zhang, J. Green and efficient approach to extract bioactive flavonoids with antioxidant, antibacterial, antiglycation, and enzyme inhibitory activities from navel orange peel. Sustain. Chem. Pharm. 2024, 38, 101479. [Google Scholar] [CrossRef]
- Tao, H.; Li, L.; He, Y.; Zhang, X.; Zhao, Y.; Wang, Q.-M.; Hong, G. Flavonoids in vegetables: Improvement of dietary flavonoids by metabolic engineering to promote health. Crit. Rev. Food Sci. Nutr. 2022, 64, 3220–3234. [Google Scholar] [CrossRef]
- Senarath, R.M.U.S.; Catanes, J.G.; Malalavidhane, T.S. Fatty Acid Profile of Young Leaflets of Cycas circinalis L. and the Effect on Selected Serum Parameters in Wistar Rats. J. Multidiscip. Stud. 2014, 3, 1–14. [Google Scholar]
- Marak, C.C.; Marak, B.N.; Singh, V.P.; Gurusubramanian, G.; Roy, V.K. Phytochemical analysis, in silico study and toxicity profile of Cycas pectinata Buch.-Ham seed in mice. Drug Chem. Toxicol. 2023, 46, 330–342. [Google Scholar] [CrossRef]
- Babu, S.K.; Kumar Jagadesan, V.; Ramasamy, S. An acute oral toxicity study of Cycas circinalis L. and Ionidium suffruticosum (ging) in wister albino rats. Int. J. Pharm. Sci. Rev. Res. 2012, 17, 97–100. [Google Scholar]
- Negm, W.A.; Elekhnawy, E.; Mahgoub, S.; Ibrahim, H.A.; Ibrahim Elberri, A.; Abo Mansour, H.E.; Mosalam, E.M.; Moglad, E.; Alzahraa Mokhtar, F. Dioon rzedowskii: An antioxidant, antibacterial and anticancer plant extract with multi-faceted effects on cell growth and molecular signaling. Int. Immunopharmacol. 2024, 132, 111957. [Google Scholar] [CrossRef] [PubMed]
- Duarte, N.B.A.; Takahashi, J.A. Plant spices as a source of antimicrobial synergic molecules to treat bacterial and viral co-infections. Molecules 2022, 27, 8210. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Koh, J.-J.; Liu, S.; Lakshminarayanan, R.; Verma, C.S.; Beuerman, R.W. Membrane active antimicrobial peptides: Translating mechanistic insights to design. Front. Neurosci. 2017, 11, 73. [Google Scholar] [CrossRef]
- Attallah, N.G.; El-Sherbeni, S.A.; El-Kadem, A.H.; Elekhnawy, E.; El-Masry, T.A.; Elmongy, E.I.; Altwaijry, N.; Negm, W.A. Elucidation of the Metabolite Profile of Yucca gigantea and Assessment of its Cytotoxic, Antimicrobial, and Anti-Inflammatory Activities. Molecules 2022, 27, 1329. [Google Scholar] [CrossRef]
- Elmongy, E.I.; Negm, W.A.; Elekhnawy, E.; El-Masry, T.A.; Attallah, N.G.; Altwaijry, N.; Batiha, G.E.-S.; El-Sherbeni, S.A. Antidiarrheal and antibacterial activities of Monterey cypress phytochemicals: In vivo and in vitro approach. Molecules 2022, 27, 346. [Google Scholar] [CrossRef]
- Alqahtani, M.J.; Elekhnawy, E.; Negm, W.A.; Mahgoub, S.; Hussein, I.A.J.J.o.F. Encephalartos villosus Lem. Displays a strong in vivo and in vitro antifungal potential against Candida glabrata clinical isolates. J. Fungi 2022, 8, 521. [Google Scholar] [CrossRef]
- Alshuniaber, M.A.; Krishnamoorthy, R.; AlQhtani, W.H. Antimicrobial activity of polyphenolic compounds from Spirulina against food-borne bacterial pathogens. Saudi J. Biol. Sci. 2021, 28, 459–464. [Google Scholar] [CrossRef]
- Scudiero, D.A.; Shoemaker, R.H.; Paull, K.D.; Monks, A.; Tierney, S.; Nofziger, T.H.; Currens, M.J.; Seniff, D.; Boyd, M.R. Evaluation of a soluble tetrazolium/formazan assay for cell growth and drug sensitivity in culture using human and other tumor cell lines. Cancer Res. 1988, 48, 4827–4833. [Google Scholar]
- Shahabuddin, M.S.; Nambiar, M.; Moorthy, B.T.; Naik, P.L.; Choudhary, B.; Advirao, G.M.; Raghavan, S.C. A novel structural derivative of natural alkaloid ellipticine, MDPSQ, induces necrosis in leukemic cells. Investig. New Drugs 2011, 29, 523–533. [Google Scholar] [CrossRef]
- Alamoudi, J.A.; El-Masry, T.A.; Nasr, M.; Ibrahim, I.T.; Ibrahim, H.A.; Saad, H.M.; El-Nagar, M.M.F.; Alshawwa, S.Z.; Alrashidi, A.; El Zahaby, E.I. Fabrication of Nanocrystals for Enhanced Distribution of a Fatty Acid Synthase Inhibitor (Orlistat) as a Promising Method to Relieve Solid Ehrlich Carcinoma-Induced Hepatic Damage in Mice. Pharmaceuticals 2024, 17, 96. [Google Scholar] [CrossRef] [PubMed]
- El-Ashmawy, N.E.; Khedr, N.F.; El-Bahrawy, H.A.; Abo Mansour, H.E. Ginger extract adjuvant to doxorubicin in mammary carcinoma: Study of some molecular mechanisms. Eur. J. Nutr. 2018, 57, 981–989. [Google Scholar] [CrossRef] [PubMed]
- El-Ashmawy, N.E.; Khedr, N.F.; El-Bahrawy, H.A.; Abo Mansour, H.E. Metformin augments doxorubicin cytotoxicity in mammary carcinoma through activation of adenosine monophosphate protein kinase pathway. Tumor Biol. 2017, 39, 1010428317692235. [Google Scholar] [CrossRef] [PubMed]
- El-Ashmawy, N.E.; Khedr, E.G.; Ebeid, E.-Z.M.; Salem, M.L.; Zidan, A.-A.A.; Mosalam, E.M. Enhanced anticancer effect and reduced toxicity of doxorubicin in combination with thymoquinone released from poly-N-acetyl glucosamine nanomatrix in mice bearing solid Ehrlish carcinoma. Eur. J. Pharm. Sci. 2017, 109, 525–532. [Google Scholar] [CrossRef]
- Mosalam, E.M.; Zidan, A.A.; Mehanna, E.T.; Mesbah, N.M.; Abo-Elmatty, D.M. Thymoquinone and pentoxifylline enhance the chemotherapeutic effect of cisplatin by targeting Notch signaling pathway in mice. Life Sci. 2020, 244, 117299. [Google Scholar] [CrossRef]
- Alherz, F.A.; Negm, W.A.; Elekhnawy, E.; El-Masry, T.A.; Haggag, E.M.; Alqahtani, M.J.; Hussein, I.A. Silver nanoparticles prepared using encephalartos laurentianus de wild leaf extract have inhibitory activity against candida albicans clinical isolates. J. Fungi 2022, 8, 1005. [Google Scholar] [CrossRef]
- Attallah, N.G.; Al-Fakhrany, O.M.; Elekhnawy, E.; Hussein, I.A.; Shaldam, M.A.; Altwaijry, N.; Alqahtani, M.J.; Negm, W.A. Anti-biofilm and antibacterial activities of Cycas media R. Br secondary metabolites: In silico, in vitro, and in vivo approaches. Antibiotics 2022, 11, 993. [Google Scholar] [CrossRef]
- Sonbol, F.I.; El-Banna, T.; Abd El-Aziz, A.A.; El-Ekhnawy, E. Impact of triclosan adaptation on membrane properties, efflux and antimicrobial resistance of Escherichia coli clinical isolates. J. Appl. Microbiol. 2019, 126, 730–739. [Google Scholar] [CrossRef]









| No. | Rt (min) | Precursor m/z | Error ppm | Name | Structure | Formula | Adduct Ion | MS/MS Spectrum | Ontology |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 1.10 | 117.0189 | −1.1 | Succinic Acid | ![]() | C4H6O4 | [M-H]- | 117.0180,99.0140, 75.3908,73.0291, 55.0200 | Dicarboxylic acids and derivatives |
| 2 | 1.10 | 265.0700 | 10 | 1,4-dihydroxy-6,6,9a-trimethyl-4,5,5a,7,8,9-hexahydro-1H-benzo[e][2]benzofuran-3-one | ![]() | C15H22O4 | [M-H]- | 265.1468, 264.2965, 112.9858, 96.9597, 79.9573 | Naphthofurans |
| 3 | 1.16 | 128.0345 | −1.6 | Pyroglutamic Acid | ![]() | C5H7NO3 | [M-H]- | 128.0339, 85.9955, 82.0320 | Alpha amino acids and derivatives |
| 4 | 1.27 | 123.0451 | −0.5 | Salicylic Alcohol | ![]() | C7H8O2 | [M-H]- | 123.0446, 122.0363, 95.0104, 77.0429, 67.0158 | Benzyl alcohols |
| 5 | 1.32 | 181.0710 | −0.7 | Mannitol | ![]() | C6H14O6 | [M-H]- | 181.0716, 163.0609, 119.0347, 113.0240, 101.0240, 89.0251, 73.0313, 71.0134, 59.0140 | Sugar alcohols |
| 6 | 1.44 | 269.0869 | 1 | Dalbergione, 4-Methoxy-4′-Hydroxy- | ![]() | C16H14O4 | [M-H]- | 269.0829, 255.0632, 254.0579, 253.0507, 237.0544, 225.0539, 92.9273 | Dalbergiones |
| 7 | 5.93 | 121.0293 | 0.4 | 3-Hydroxybenzaldehyde | ![]() | C7H6O2 | [M-H]- | 121.0298, 120.0249, 108.0225, 93.0362, 92.0260, 91.0163 | Hydroxybenzaldehydes |
| 8 | 6.85 | 541.2435 | −0.7 | methyl (2S,3R,4S)-3-ethenyl-4-[2-(3,4,5-trihydroxybenzoyl)oxyethyl]-2-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-2H-pyran-5-carboxylate | ![]() | C24H30O14 | [M-H]- | 541.1399, 473.1713, 405.1728, 347.2330, 337.1846, 279.2397, 170.9432, 102.9612 | Terpene glycosides |
| 9 | 6.93 | 227.0830 | 0.3 | Aspernigrin A | ![]() | C13H12N2O2 | [M-H]- | 227.0827, 210.0779, 209.0721, 184.0767, 143.0517, 115.0550, 109.0179, 65.9984 | Nicotinamides |
| 10 | 7.24 | 447.0951 | 0.9 | Kaempferol-3-O-glucoside | ![]() | C21H20O11 | [M-H]- | 447.0933, 285.0426, 284.0321, 255.0317, 227.0353 | Flavonoid-3-O-glycosides |
| 11 | 7.33 | 195.9125 | −0.3 | 3,5,6-Trichloro-2-pyridinol | ![]() | C5H2Cl3NO | [M-H]- | 195.9134, 152.9770, 112.9862, 84.9911 | Polyhalopyridines |
| 12 | 7.71 | 431.0983 | 0.3 | Apigetrin | ![]() | C21H20O10 | [M-H]- | 431.0984, 429.7303, 311.0560, 269.0454, 268.0374, 240.0424, 211.0428, 151.0095, 102.9557 | Glycosyloxyflavone |
| 13 | 7.81 | 287.0559 | −0.5 | Dihydrokaempferol | ![]() | C15H12O6 | [M-H]- | 287.0569, 259.0610, 255.1236, 243.0660, 215.0712, 201.0556, 177.0559, 151.0042, 125.0243, 83.0138, 57.0346 | Flavanone O-glycosides |
| 14 | 7.88 | 327.1811 | 0.6 | Spiculisporic Acid | ![]() | C17H28O6 | [M-H]- | 327.1796, 283.1905, 265.1798, 255.1962, 239.2008, 221.1908, 211.2069, 124.0161 | Tricarboxylic acids and derivatives |
| 15 | 7.96 | 433.1140 | 1.2 | Engeletin | ![]() | C21H22O10 | [M-H]- | 433.1170, 389.1336, 321.1472, 305.1732, 257.1591, 221.1964, 112.9841 | flavonoids |
| 16 | 9.70 | 293.1760 | 0.6 | 13-Oxo-9,11-octadecadienoic Acid | ![]() | C18H30O3 | [M-H]- | 293.2109, 275.2029, 236.1047, 208.9180, 195.1355, 183.1387, 171.1040, 102.9558, 94.9244, 92.9231 | Linoleic acid and derivatives |
| 17 | 10.04 | 537.0833 | 0.9 | Agathisflavone | ![]() | C30H18O10 | [M-H]- | 537.0814, 443.0404, 417.0619, 399.0517, 375.0504, 331.0621, 159.0447, 117.0342 | Biflavonoids and polyflavonoids |
| 18 | 10.09 | 537.0827 | 0.9 | Amentoflavone | ![]() | C30H18O10 | [M-H]- | 537.0814, 443.0404, 417.0619, 399.0517, 375.0504, 333.0403, 331.0621, 307.0619, 203.0348, 159.0447, 117.0342 | Hydroxyflavone |
| 19 | 10.27 | 357.1330 | 0.4 | Matairesinol | ![]() | C20H22O6 | [M-H]- | 357.1361, 342.1190, 220.8766, 151.0404, 136.0181, 112.9855, 104.9535, 94.9245 | Dibenzylbutyrolactone lignans |
| 20 | 10.64 | 269.0452 | 0.2 | Aloe-emodin | ![]() | C15H10O5 | [M-H]- | 269.0456, 225.0597, 151.0040, 149.0234, 117.0343 | Anthraquinones |
| 21 | 11.67 | 551.0984 | 0.9 | Bilobetin | ![]() | C31H20O10 | [M-H]- | 551.0982, 457.0592, 431.0785, 413.0678, 389.0669, 345.0790 | Flavonoids |
| 22 | 13.47 | 297.1535 | 10 | Aurapten | ![]() | C19H22O3 | [M-H]- | 297.1526, 198.0321, 183.0132, 170.0015, 119.0497, 102.9575 | Terpene lactones |
| 23 | 15.17 | 565.1140 | 0.9 | Isoginkgetin | ![]() | C32H22O10 | [M-H]- | 565.1138, 533.0879, 471.0707, 445.0926, 415.0446, 403.0810, 389.0672, 374.0446, 151.0037 | Biflavonoid |
| 24 | 16.27 | 419.2813 | 0.9 | (1S,4S,5R,9S,10R,13R,14R)-14-hydroxy-5,9-dimethyl-14-{[(3-methylbutanoyl)oxy]methyl}tetracyclo [11.2.1.01,10.04,9]hexadecane-5-carboxylic acid | ![]() | C25H40O5 | [M-H]- | 419.2803, 163.0418, 145.0301, 119.0511, 117.0335, 112.9823 | Kaurane diterpenoids |
| 25 | 16.45 | 297.2441 | −0.4 | Nephrosteranic acid | ![]() | C17H30O4 | [M-H]- | 297.0773, 265.1813, 253.2146, 235.0776, 228.9046, 221.1908, 128.9603, 112.9846, 102.9567, 92.9283 | lactone |
| 26 | 18.13 | 581.1453 | −1 | Oliveriflavone | ![]() | C33H26O10 | [M-H]- | 581.1444, 549.1185, 415.1158, 405.0975, 390.0802, 239.0690, 165.0206 | Flavonoids |
| 27 | 19.49 | 277.2180 | 0.6 | Linolenic Acid | ![]() | C18H30O2 | [M-H]- | 278.2198, 277.2172, 275.1969, 233.2271, 158.9255, 92.9304, 59.0142 | Lineolic acid and derivatives |
| 28 | 21.79 | 279.2711 | 1 | Linoleic Acid | ![]() | C18H32O2 | [M-H]- | 280.2361, 279.2330, 261.2231, 243.2082, 83.0574, 71.0126, 59.0137 | Lineolic acid and derivatives |
| 29 | 22.64 | 455.3549 | 0.8 | Ursolic Acid | ![]() | C30H48O3 | [M-H]- | 455.3532, 453.8744, 425.2720, 409.2371, 392.2421, 311.1802, 255.2156 | Triterpenoids |
| 30 | 23.44 | 255.2335 | 0.3 | Palmitic Acid | ![]() | C16H32O2 | [M-H]- | 255.1387, 237.2210, 102.9529 | Long-chain fatty acids |
| 31 | 24.21 | 281.2494 | 1.9 | Vaccenic Acid | ![]() | C18H34O2 | [M-H]- | 282.2533, 281.2491, 263.2374, 183.1453, 112.9852, 97.0656, 59.0188 | Long-chain fatty acids |
| 32 | 24.38 | 317.2484 | 0.5 | Urushiol II | ![]() | C21H34O2 | [M-H]- | 318.2525, 317.2500, 299.2453, 248.9615, 180.9711, 112.9863 | Catechols |
| 33 | 25.48 | 269.2500 | 0.5 | Heptadecanoic Acid | ![]() | C17H34O2 | [M-H]- | 270.2537, 269.2488, 251.2356, 210.8343, 92.9280 | Long-chain fatty acids |
| Bacterial Isolates | MICs (µg/mL) | Bacterial Isolates | MICs (µg/mL) |
|---|---|---|---|
| S1 | 64 | S10 | 64 |
| S2 | 64 | S11 | 32 |
| S3 | 128 | S12 | 32 |
| S4 | 32 | S13 | 64 |
| S5 | 64 | S14 | 64 |
| S6 | 128 | S15 | 128 |
| S7 | 64 | S16 | 128 |
| S8 | 32 | S17 | 32 |
| S9 | 64 | S18 | 32 |
| Forward | Reverse | |
|---|---|---|
| SOD | TTGGCCGTACAATGGTGGTC | AGTTTAATGGTTTGAGGGTAGCA |
| GPX4 | TACACCGAGATGAACGATCTG | ATTCTTGCCATTCTCCTGGT |
| β-actin | ACTATTGGCAACGAGCGGTT | AATGCCTGGGTACATGGTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alqahtani, J.; Mosalam, E.M.; Abo Mansour, H.E.; Elberri, A.I.; Ibrahim, H.A.; Mahgoub, S.; Hussein, I.A.; Hawwal, M.F.; Al Hmoudi, M.; Moglad, E.; et al. Anticancer Effect of Cycas media: Molecular Basis Through Modulation of PI3K/AKT/mTOR Signaling Pathway. Molecules 2024, 29, 5013. https://doi.org/10.3390/molecules29215013
Alqahtani J, Mosalam EM, Abo Mansour HE, Elberri AI, Ibrahim HA, Mahgoub S, Hussein IA, Hawwal MF, Al Hmoudi M, Moglad E, et al. Anticancer Effect of Cycas media: Molecular Basis Through Modulation of PI3K/AKT/mTOR Signaling Pathway. Molecules. 2024; 29(21):5013. https://doi.org/10.3390/molecules29215013
Chicago/Turabian StyleAlqahtani, Jawaher, Esraa M. Mosalam, Hend E. Abo Mansour, Aya Ibrahim Elberri, Hanaa A. Ibrahim, Sebaey Mahgoub, Ismail A. Hussein, Mohammed F. Hawwal, Maryam Al Hmoudi, Ehssan Moglad, and et al. 2024. "Anticancer Effect of Cycas media: Molecular Basis Through Modulation of PI3K/AKT/mTOR Signaling Pathway" Molecules 29, no. 21: 5013. https://doi.org/10.3390/molecules29215013
APA StyleAlqahtani, J., Mosalam, E. M., Abo Mansour, H. E., Elberri, A. I., Ibrahim, H. A., Mahgoub, S., Hussein, I. A., Hawwal, M. F., Al Hmoudi, M., Moglad, E., Ahmed, R., Mokhtar, F. A., Elekhnawy, E., & Negm, W. A. (2024). Anticancer Effect of Cycas media: Molecular Basis Through Modulation of PI3K/AKT/mTOR Signaling Pathway. Molecules, 29(21), 5013. https://doi.org/10.3390/molecules29215013


































