Skip to Content
MoleculesMolecules
  • Article
  • Open Access

30 March 2023

Targeting HIV-1 Reverse Transcriptase Using a Fragment-Based Approach

,
,
,
,
,
,
,
,
1
Medicinal Chemistry, Monash Institute of Pharmaceutical Sciences, Monash University, Parkville, VIC 3052, Australia
2
Center for Advanced Biotechnology and Medicine, Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ 08854, USA
3
Retroviral Biology and Antivirals Laboratory, Disease Elimination Program, Life Sciences Discipline, Burnet Institute, Melbourne, VIC 3004, Australia
4
Division of Infectious Diseases, Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261, USA

Abstract

Human immunodeficiency virus type I (HIV-1) is a retrovirus that infects cells of the host’s immune system leading to acquired immunodeficiency syndrome and potentially death. Although treatments are available to prevent its progression, HIV-1 remains a major burden on health resources worldwide. Continued emergence of drug-resistance mutations drives the need for novel drugs that can inhibit HIV-1 replication through new pathways. The viral protein reverse transcriptase (RT) plays a fundamental role in the HIV-1 replication cycle, and multiple approved medications target this enzyme. In this study, fragment-based drug discovery was used to optimize a previously identified hit fragment (compound B-1), which bound RT at a novel site. Three series of compounds were synthesized and evaluated for their HIV-1 RT binding and inhibition. These series were designed to investigate different vectors around the initial hit in an attempt to improve inhibitory activity against RT. Our results show that the 4-position of the core scaffold is important for binding of the fragment to RT, and a lead compound with a cyclopropyl substitution was selected and further investigated. Requirements for binding to the NNRTI-binding pocket (NNIBP) and a novel adjacent site were investigated, with lead compound 27—a minimal but efficient NNRTI—offering a starting site for the development of novel dual NNIBP-Adjacent site inhibitors.

1. Introduction

Human immunodeficiency virus type 1 (HIV-1) is a retrovirus that targets cells of the immune system of the human host. If untreated, HIV-1 infection leads to acquired immunodeficiency syndrome (AIDS) and eventually death. While advances in treatment have made HIV-1 a manageable chronic condition in many cases, the continued emergence of drug-resistant variants as well as drug intolerance and drug toxicity pose substantial threats to our current therapies [1]. Therefore, the proactive discovery of new and effective drug classes with distinct drug resistance profiles to existing antiretrovirals is crucial, especially for heavily treatment-experienced individuals who have limited options for HIV treatment [2].
HIV-1 reverse transcriptase (RT) is a virally encoded enzyme that transcribes the viral RNA genome into a proviral DNA precursor prior to integration into the host genome. RT is an important target for anti-HIV drugs, and nearly 50% of U.S. Food and Drug Administration approved antiretroviral therapies target this enzyme. RT inhibitors belong to two major classes: nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs) and non-nucleoside reverse transcriptase inhibitors (NNRTIs) [3]. NRTIs are analogues of the natural dNTP substrate and bind to the active site of RT. NNRTIs bind to a site that is proximal but distinct from the active site and act by an allosteric inhibition mechanism, locking RT into a non-active state [3]. Although these two classes of drugs are effective for HIV-1 treatment and prevention, continued efforts to minimize drug resistance and side effects associated with lifelong antiretroviral therapy are desirable by identification of new druggable sites on RT and continued development of new compounds [4].
One relatively recent approach to discovering new druggable sites and compounds is fragment-based drug discovery (FBDD). FBDD aims to develop small molecule drugs with good pharmaceutical properties starting with chemical building blocks of drugs that are subsequently elaborated into larger more potent inhibitors [5,6]. In FBDD, libraries of low molecular weight chemical compounds, typically 300 Da or less, are screened using biophysical methods for binding to the protein target, with the notion that smaller molecules can make efficient binding interactions [7]. In 2013, Bauman et al. [7] reported an X-ray crystallographic fragment screen targeted towards HIV-1 RT. The screening library consisted of 775 commercially available compounds that were grouped into 143 cocktails. The library was screened against crystals of a crystallographically optimized HIV-1 RT variant (RT52A) in complex with the NNRTI inhibitor rilpirivine (RPV). Thirty-four fragments were identified that bound to 16 different locations on the enzyme. Seven of the binding sites had not been previously observed and have been named the NNRTI Adjacent, Knuckles, Incoming Nucleotide Binding, 399, 428, 507 and RNase H Primer Grip Adjacent binding sites (Figure 1). Of the new sites, compounds bound to four sites (Knuckles, Incoming Nucleotide Binding, 507 and NNRTI Adjacent) were reported to be inhibitory against HIV-1 RT in a dual activity assay assessing DNA polymerization and RNase H activities [7]. These sites afforded exciting new opportunities for drug development.
Figure 1. Overview of fragment hit locations in newly identified sites by Bauman et al. [7]. Legend: HIV-1 RT p66 subunit with fingers (blue), palm (red), thumb (green), connection (yellow) and RNase H (orange); p51 shown in gray; rilpivirine bound to the NNRTI-binding pocket (NNIBP) is shown as yellow spheres; bound fragments are shown as cyan spheres. Each binding site is circled and color coded according to its name (i.e., purple corresponds to Knuckles). Site, compound, and potency information in Table S1. Created with PyMOL and BioRender.com.
In particular, the NNRTI Adjacent site is a potentially attractive target for the design of novel inhibitors targeting both this site and the NNRTI-binding pocket (NNIBP) since the key residues of the pocket are conserved [7]. Accordingly, the goal of this work was to follow a systematic fragment development process to elaborate the promising hit compound B-1 in an effort to target the NNRTI Adjacent site.
The Bauman et al. study reported compound B-1 to have an IC50 of 350 μM and a ligand efficiency (LE) of 0.34 kcal/mol [7] (Table S1). LE is an expression of binding energy accounting for a compound’s size, whereby 0.30 kcal/mol or greater is considered efficient (further defined below). The fragment screen showed that this compound binds to the NNRTI Adjacent site, a region neighboring the NNIBP (Figure 1), where it makes a hydrogen bond with the backbone carbonyl oxygen of isoleucine (Ile180) and hydrophobic interactions with proline and isoleucine residues (Pro140 and Ile180). The side chains of two glutamine residues (Gln161 and Gln182) reposition to accommodate the fragment, allowing the formation of a hydrogen-bonding interaction with the glutamine (Gln182) backbone amide which was proposed to be responsible for RT inhibition by this fragment (see Figure 2b in [7]).
In this study, we aimed to optimize the binding and HIV-1 RT inhibitory activity of compound B-1 in pursuit of a novel RT drug candidate which overcomes drug resistance and minimizes side effects associated with current antiretroviral therapies. Three series of compounds were designed, synthesized and evaluated for their HIV-1 RT binding and inhibition. A derivative 27 with an alkyne extension at the 4-position yielded an IC50 value of 11 μM against wild-type (WT) RT and 34 μM against the K103N/Y181C mutant RT—a variant that is resistant to many NNRTIs [8].

2. Results

2.1. Compound Synthesis

Beginning with compound B-1 as a core structure, we designed and synthesized three series of compounds (Figure 2) to identify positions that could be substituted to improve affinity for HIV-1 RT. Series 1 investigated substitution at positions 4–7 around the pyrazolopyridine ring. Series 2 modified the ethyl ester. Substitution at the 4-position was found to better inhibit RT (discussed in the following inhibition and binding section), which led to the synthesis of a set of 4-alkynes (Series 3).
Figure 2. The compound B-1 and the structural features of the three series synthesized in this study; Series 1 with changes around the core depicted in blue, Series 2 with changes to the ester depicted in orange and Series 3 with various alkyne extensions depicted in green.
Pyrazolopyridines with substitution on the pyridine ring (2–16) were prepared using the method by Kendall et al. [9,10], by N-amination of the substituted pyridines followed by 1,3-dipolar cycloaddition (Scheme 1). N-Amination of the pyridine starting materials was performed with commercially available O-(2,4-dinitrophenyl)hydroxylamine (DNPH) as it is more stable, easier to handle and more efficient than other reagents [11]. Acetonitrile was initially used as the solvent for this step following Kendall’s method. A method described by Legault and Charette using THF and water mixture (1:1) gave improved yields and faster reaction times [11]. Other studies speculate that the presence of water as co-solvent increases reaction speed by stabilizing the transition state [12]. This led to the inclusion of water in this reaction where maximum conversion was observed in MeCN:H2O (1:1) at a temperature of 60 °C. The N-aminopyridines were used without any purification and elaborated to pyrazolopyridines by 1,3-dipolar cycloaddition reaction with ethyl propiolate. The pyrazolopyridines were obtained in moderate yields of 15–55%, depending on the reactivity of the substituted pyridine starting materials. It was found that pyridines with electron-withdrawing substituents were not reactive enough to undergo the N-amination reaction. Notably, two regioisomers were formed when 3-substituted pyridines were used as the starting material, providing mixtures of 4- and 6-substituted pyrazolo[1,5-a]pyridines. In these cases, the two regioisomers were separated by column chromatography and distinguished using 1H NMR.
Scheme 1. The synthesis of Series 1 analogues. Reagents and conditions: (i) DNPH, MeCN:H2O (1:1) or THF:H2O (1:1), 40 °C–60 °C, overnight; (ii) ethyl propiolate, K2CO3, DMF, rt, overnight.
A selection of amides and esters were synthesized to investigate the importance of the ethyl ester present in compound B-1 (Scheme 2). Acid 17 was prepared by hydrolysis of ester 6. Methyl ester 18 was prepared by transesterification of ethyl ester 6 using dipotassium phosphate and methanol. Compound 19 was made by esterification of acid 17 using sulfuric acid and propanol. Amides 20–22 were synthesized from acid 17 using standard amide coupling conditions.
Scheme 2. The synthesis of Series 2 analogues. Reagents and conditions: (i) K2HPO4, MeOH, 80 °C, overnight; (ii) LiOH. H2O, THF:MeOH:H2O (4:1:1), rt, 5 h. (iii) H2SO4, propanol, 85 °C, overnight; (iv) RNH2, HBTU, DIPEA, DMF, rt, 4 h.
Finally, a series of 4-alkynyl analogues (23–29) was prepared using a modification of the method by Schilz [13], using tetrakis(triphenylphosphine)palladium(0) as the catalyst, copper iodide as the co-catalyst and diisopropylamine as the base and solvent (Scheme 3). Couplings were performed at 80 °C with complete conversion observed overnight.
Scheme 3. The synthesis of Series 3 analogues. Reagents and conditions: (i) Pd(PPh3)4, CuI, diisopropylamine, 80 °C, overnight.

2.2. Inhibition and Binding Affinity of Pyrazolo[1,5-a]pyridine Analogues

The inhibitory activity of all compounds was evaluated in vitro in assays that measure the DNA-dependent DNA polymerase (DDDP) activity of HIV-1 RT. Compounds were tested against recombinant WT and drug-resistant HIV-1 RT mutants (K103N, Y181C or K103N/Y181C). Inhibition of WT RT DDDP activity was initially evaluated by testing three concentrations of compound in two independent assays using nevirapine (an FDA approved NNRTI) as the positive control [3]. Compounds that demonstrated WT RT inhibitory activity at concentrations less than 1 mM were then subjected to a second assay to calculate the compound IC50 value from dose–response curves generated from at least five serial dilutions in at least two independent assays [14]. The IC50 value of nevirapine was determined in parallel to control for the performance of the assay. As part of the evaluation cascade, compounds with IC50 values lower than 200 µM against WT RT were also tested against NNRTI-resistant recombinant RT mutants, K103N, Y181C or K103N/Y181C. These RT mutations either reduce the rate of entry of NNRTIs to the binding pocket (K103N) or remove aromatic interactions that favor binding (Y181C) [3]. Initially, compound IC50 values were determined in an assay that quantifies DDDP activity mediated by HIV-1 RT using a radiolabeled 33PdTTP substrate [14] and more recently using a nonradioactive PicoGreen-based spectrophotometric assay [15]. Accordingly, we first confirmed that the nevirapine IC50 value for inhibiting recombinant HIV-1 RT obtained in the non-radioactive assay was similar to the assay using 33PdTTP. The nevirapine IC50 ± SEM for inhibiting WT RT using the nonradioactive DDDP assay was 0.44 ± 0.03 µM (n = 3), which was not significantly different compared to the IC50 value reported using the 33PdTTP assay (0.44 ± 0.08 µM, p = 0.7, n = 3, Mann–Whitney test) [14], providing confidence that IC50 data generated by both assays are comparable. Inhibitory activities of Series 1 and 3 are summarized in Table 1 and Table 2. The activities of Series 2, which was largely inactive, are shown in the supporting information (Table S2).
Table 1. HIV-1 RT inhibition, dissociation constants and ligand efficiencies of substituted ethyl 3-carboxypyrazolopyridine analogues (Series 1).
Table 2. HIV-1 RT inhibition, dissociation constants and ligand efficiencies of substituted 4-alkyne pyrazolopyridine analogues (Series 3).
Compound binding to recombinant HIV-1 RT was measured by surface plasmon resonance (SPR). SPR is an optical biosensor detection method that involves passing an analyte (often a fragment) in a buffer solution over a gold surface chip with an immobilized protein (RT enzyme) and detecting the change in plasmon resonance angle which is dependent on the refractive index of the medium near the surface [16,17]. As compounds bind to the target protein, the refractive index changes proportionally to the extent of binding. This can then be used to measure the association and dissociation kinetics of binding as well as the compound’s affinity for binding [17,18,19,20]. SPR is a label-free method that does not require large amounts of protein and is often used for primary screening of fragments. Binding affinities of compounds are summarized in Table 1, Table 2 and Table S2 with SPR curves shown for compounds 2, 6 and 27 in Figure S1.
Due to their small size, fragments bind weakly; however, they are capable of binding efficiently to the target protein on a per-atom basis. Binding efficiency can be quantified by the ligand efficiency (LE) metric [21]. LE is the free energy of binding of a ligand (ΔG) divided by the number of non-hydrogen (heavy) atoms (N) where ΔG is calculated using the equation ΔG = −RTlnKi [6]. Using the RT inhibition (IC50), LE can be calculated using the equation LE = −1.4(logIC50)/N [22]. Compounds with LE values greater than 0.3 kcal/mol/HA are generally regarded as efficient binders [23,24,25]. LE values for binding to WT RT are shown in Table 1 and Table 2. Notably, nearly all of the active compounds bind efficiently (LE > 0.3 kcal/mol/HA), and compound 27 binds with LE = 0.37 kcal/mol/HA.
Table 1 shows RT inhibition and SPR dissociation constants for Series 1. The hit compound B-1 for the NNRTI Adjacent site was found to have a lower potency when tested in the DNA-dependent DNA polymerase (DDDP) activity assay used in this study compared to data from Bauman et al. which used an assay that detects inhibition of both DNA polymerase and RNase H activity [6]. Substitution at some sites on the pyridine greatly reduced inhibition. However, incorporation of bromo or methyl substituents at the 4-position improved inhibition of the WT enzyme, and this activity was somewhat maintained in the mutant strains where no significant differences were observed for the compound 6 IC50 value for WT RT compared to the K103N (p = 0.1, n ≥ 2) or the Y181C (p = 0.4, n ≥ 2 Mann–Whitney test) RT mutants. Notably, compounds 6 and 9 have IC50 values of about 150 µM, where the IC50 values of 5 and 6 were significantly different (p = 0.037, n = 3, Kruskal–Wallis test). These data suggest that the 4-position of the pyrazolo[1,5-a]pyridine core is important for inhibition of HIV-1 RT.
Series 2 compounds, which investigated modifications of the ethyl ester present in compound B-1, were nearly all inactive (Table S2) in the RT inhibition assay. The fact that small structural changes (e.g., changing the ethyl ester to an ethyl amide or propyl or methyl ester) in this region greatly reduced the IC50 values suggests that the presence of the ethyl ester is essential for RT inhibition.
The activities of the compounds in Series 3, which all contain an alkyne substituent in the 4-position, are shown in Table 2. A number of these compounds have IC50 values under 50 μM against recombinant WT RT as well as the K103N/Y181C NNRTI drug-resistant mutant. Notably the 4-cyclopropylalkyne 27 had an IC50 value of 11 μM for WT RT and was amongst the most potent compounds compared to 28 (p = 0.035, Kruskal–Wallis test), as well as demonstrating similar activity for inhibiting the K103N/Y181C RT mutant (p = 0.2, n ≥ 2, Mann–Whitney test). Compound 27 also demonstrated the strongest binding to both WT and mutant RT as determined by SPR (Table 2). Accordingly, this compound was selected for crystallographic studies.

2.3. Crystallography

To understand the structural basis for the improved activity of compound 27, we determined a co-crystal structure of 27 in complex with RT52A. Initially, we attempted to co-crystallize compound 27 (anticipating its binding to the NNRTI Adjacent site) with the NNRTI rilpivirine. However, compound 27 was not observed in these experiments. Accordingly, we next solved the structure of compound 27 complexed with RT52A in the absence of an NNRTI. The structure was solved by molecular replacement using a high-resolution RT-RPV complex [26], (PDB ID 4G1Q) as the search model, and was subsequently refined to 2.42 Å resolution (Table S3). Unexpectedly, the structure showed that 27 does not bind to the NNRTI Adjacent site [7] but instead occupies the NNRTI-binding pocket (NNIBP) of RT (Figure 3). A Polder OMIT map (green mesh, Figure 3), calculated by excluding the bulk solvent around the omitted region, clearly showed the difference in electron density for 27 in the NNIBP. The cyclopropyl group of 27 is directed into the hydrophobic tunnel of the NNIBP, where it makes interactions with Y181, Y188 and W229. The N1 nitrogen of the pyrazolo[1,5-a]pyridine ring forms a hydrogen-bonding interaction with a water molecule mediating interaction with K103 (Figure S3). The terminal methyl of the ethyl ester group forms an additional hydrophobic interaction with V179. The much greater affinity of RPV for the NNIBP compared to 27 (0.73 nM [27] vs. 11 μM) helps explain why RPV and not 27 was observed in co-crystallization experiments of RT with 27 and RPV.
Figure 3. Crystal structure of HIV-1 RT in complex with the elaborated compound 27 (PDB ID 8FFX). Atomic model of 27 (magenta) bound to HIV-1 RT residues (blue) in the NNRTI-binding pocket. Pocket residues forming hydrophobic interactions shows as sticks. Polder mFo–DFc (OMIT) map density (green mesh, 3σ) of 27. Created using PyMOL and BioRender.com.
Next, we sought to understand what structural features, if any, contributed to not observing 27 in the NNRTI Adjacent site. Inspection of the NNRTI Adjacent site in the RT52A-27 complex reveals extensive structural rearrangement that would preclude binding of 27 to the NNRTI Adjacent pocket (Figure 4). A superposition of WT RT bound to RPV with B-1 in the NNRTI Adjacent site (PDB ID: 4KFB) onto the RT-27 structure suggests that G161 and Q182 move downward into the NNRTI Adjacent site, where the ethyl ester group of B-1 resides, and P140 of the p51 subunit moves upward, which would block binding of the cyclopropylethyne group 27 in the site (Figure 4). Moreover, a favorable water bridge interaction is observed between the carbonyl of 27 and K103 (Figure S3). Effectively, the NNIBP acts more as a “sink” likely providing a more favorable binding site for 27, though not as favorable as for RPV as noted above.
Figure 4. Comparison of the NNRTI Adjacent site of superposed RT-27 (PDB ID 8FFX, blue) and RT-RPV-B-1 (PDB ID 4KFB, orange) structures. Rilpivirine (RPV) is depicted in the neighboring NNIBP (orange). Nitrogen atoms are blue and oxygen atoms are red.

2.4. Combination Assay

Compound 27 demonstrated a nonsignificant 3.0-fold decrease in susceptibility to the K103N/Y181C NNRTI-resistant mutant compared to WT RT (Table 2). Re-testing of compound B-1 in the non-radioactive PicoGreen RT assay revealed IC50 values of 96 µM and 208 µM against WT RT and the K103N/Y181C NNRTI drug-resistant RT mutant (p = 0.1, n = 3, Mann–Whitney test), respectively (Figure S2). Thus, compound B-1 shows a nonsignificant decrease in susceptibility to the NNRTI drug-resistant mutant compared to WT RT. The PicoGreen RT assay uses a different DNA template compared to the radioactive assay, where the latter employs activated calf thymus DNA which may account for the difference observed for RT inhibitory activity of compound B-1 in the two assays. Taking together the X-ray crystallographic data and their ability to retain inhibitory activity against the NNRTI-resistant mutants, we hypothesized that compounds B-1 and 27 bind to more than one site on the HIV-1 RT.
To investigate this further, we determined whether compound B-1 and 27 in combination with the NNRTI, nevirapine, demonstrate additive, antagonistic or synergistic inhibition of HIV-1 RT. If compounds bind solely to the NNIBP, we would expect to see additive inhibition of RT activity in combination with nevirapine [8]. Combination assays were performed using the non-radioactive DDDP assay with drug combinations tested at fixed ratios. As a control for additivity, we tested the NNRTIs, nevirapine and doravirine (DOR) in combination [8]. While the combination of NVP and DOR was additive, the combinations of NVP and B-1 and NVP and 27 displayed moderate antagonism for inhibiting HIV-1 RT DDDP activity (Table 3). These data indicate that B-1 and 27 do not behave similarly to classical NNRTIs and that they may also bind to sites that are distinct from the NNRTI-binding pocket. Since these compounds displayed moderate antagonism, it is likely that binding to one site may impede the ability to bind to the second site. Given the proximity of the NNIBP to the NNRTI Adjacent site, it is possible that compounds are binding to both sites; however, this would need to be independently verified in a future work.
Table 3. Compounds B-1 and 27 in combination with nevirapine antagonistically inhibit HIV-1 RT.

3. Discussion

3.1. SAR

The initial fragment hit reported by Bauman et al., (ethyl pyrazolo[1,5-a]pyridine-3-carboxylate, B-1) [7], was found in their RT activity assay to have an IC50 value of 350 µM for the WT RT construct RT35A with a ligand efficiency of 0.34 kcal/mol/HA. In the current study, we have used a range of synthetic techniques to elaborate compound B-1. Three focused fragment libraries were designed, synthesized and characterized. Series 1 (Table 1) explored the effects of different substitutions around the pyridine ring. Compounds 2, 5, 6, 9 and 10 showed markedly improved binding and/or inhibitory activities, highlighting the importance of the 4-position. Series 2 (Table S2) investigated changes to the ethyl ester group. In this case, all changes to the ester (change in alkyl chain size, conversion to an amide) abolished inhibition and binding activities. This suggests that the ester group makes close contact and strong interactions with its binding site. Following on from the improved activities of 4-substituted compounds, Series 3 was designed. The 4-bromo substituted compound, 6, was used as a starting material to prepare a series of alkynes through Sonogashira couplings (Table 2). Compounds 26, 27, 28 and 29 from this series demonstrated further improvements in activity, all having IC50 values less than 100 μM, which is a >20-fold improvement on parent compound B-1, which had an IC50 >1000 μM in the radioactive RT assay. Notably, compound 27 was among the most potent in both the RT inhibition and the SPR assay with an IC50 of 11 ± 1 μM and 34 ± 8 μM (p = 0.2) and KD of 79 ± 7 μM and 187 ± 15 μM against WT HIV-1 RT and the K103N/Y181C double mutant, respectively. The 2–3-fold decrease in binding and non-significant change in RT inhibition mediated by 27 is encouraging, considering the small size of the compound. Compound 27 binds efficiently to WT RT with an LE of 0.40 kcal/mol/HA. To establish that the fragment series represented unique compounds, a Tanimoto similarity search was conducted against 1524 HIV-1 RT inhibitors recorded in the Binding Database (www.bindingdb.org, accessed on 9 November 2021). Of the 1524 RT inhibitors, no compound had a Tanimoto similarity score greater than 0.63. Compound 27 was selected as the lead compound to be further investigated, with crystallography and combination studies.

3.2. Structural Analysis

The X-ray structure of Bauman et al. demonstrated the ability of compound B-1 to bind in the NNRTI Adjacent site when the drug RPV is present in the NNIBP, while displaying significant inhibition of RT polymerase activity in the absence of RPV (Table S1) [7]. However, contrary to our initial expectations, the structure of the elaborated compound 27 in complex with RT52A (in the absence of RPV) showed that the compound bound in the NNIBP (Figure 3). We surmise that, with the exception of RPV or NNRTIs with central moieties extending towards the solvent, e.g., K07-15, PDB ID 7KWU [28], NNRTIs do not induce opening of the NNRTI Adjacent site, which stays occluded and prevents binding of ligands. Of note, mining of the literature revealed that the similar shaped fragment, bromoindanone, was found as a putative NNRTI hit in an SPR fragment screening campaign targeting HIV-1 RT [29].
To understand the nature of the NNRTI Adjacent site and whether it is open to compound binding in other structures, we compared the site when either FDA approved NNRTIs or other inhibitors were bound to the NNIBP of RT. Figure 5 shows the NNIBP (left) and the NNRTI Adjacent site (right) in various inhibitor-bound structures. Each inhibitor and the associated PDB are indicated underneath each panel. Compound B-1 is superimposed into the NNRTI Adjacent site in each structure, except for PDB ID 4KFB, which captures a bound state of RT52A/RPV/1.
Figure 5. Surface representations of the NNIBP and NNRTI Adjacent sites with approved NNRTIs and investigational inhibitors. The compactness of the NNRTI Adjacent site in structures decreases from left to right (closed to open). NNRTIs and their protein bound structures are indicated in each panel, with their PDB ID in parenthesis. Lead compound B-1 (purple) is superimposed in the NNRTI Adjacent site (right). Compound in the NNRTI site are shown in a range of colors. Nitrogen atoms are blue and oxygen atoms are red.
The surface representations help to visualize that the NNRTI Adjacent site remains closed in most of the NNRTI-bound structures and unavailable for compounds to bind. In contrast, inhibitors K07-15, 25a and K-5a2 (Figure S5) revealed an NNRTI Adjacent site very similar to that observed in the RPV-bound structure (Figure 5), in which the NNRTI Adjacent site is open. To further investigate this observation, a pocket analysis was performed using the PyVOL extension in PyMOL (Table 4) [30].
Table 4. PyVOL pocket volume analysis of the NNIBP and NNRTI Adjacent site in NNRTI-bound RT structures. A minimum and maximum probe radius of 1.8 and 3.4 Å was used. Dashes indicate a closed pocket with no measurable volume.
The pocket volume analysis confirmed the surface visual analysis. Compared to RPV, K07-15, 25a or K-5a2, other approved NNRTIs complexed with HIV-1 RT have smaller NNIBP volumes and no measurable pocket volume for the NNRTI Adjacent site. Additional analysis shows that the NNIBP and the Adjacent site pocket volumes correlate with the position of the thumb in RT, which is locked into a hyperextended orientation by NNRTIs and not conducive to reverse transcription. In general, structures of RT/NNRTI with smaller NNRTI pocket volumes have lesser hyperextension in the thumb region (e.g., nevirapine, NVP; etravirine, ETR; efavirenz, EFV). However, RPV and K07-15, 25a and K-5a2, the only compounds with measurable volume for the NNRTI Adjacent site and NNIBP pocket volumes larger than 500 Å3, are accompanied by greater thumb hyperextension (Figure 6). This is consistent with further stabilization observed through NMR spectroscopy of the open conformation of RT (compared to closed in apo RT) when bound to diarylpyrimidine-based inhibitors (DAPYs), such as RPV, over EFV or NVP [31].
Figure 6. Thumb subdomain position of RT in complex with approved or investigational NNRTIs. The structure of RT bound to 27 (PDB: 8FFX) is superimposed in green in each panel. Stars indicate complexes with measurable NNRTI Adjacent Site pocket volume (Table 4). Definitions: ETR—etravirine; DOR—doravirine; NVP—nevirapine; DEL—delavirdine; EFV—efavirenz; RPV—rilpivirine. Created with PyMOL and BioRender.com.
From these analyses, we conclude that there are two important structural features that may be relevant to design effective dual-targeting inhibitors binding both the NNIBP and NNRTI Adjacent site. First, an NNRTI must possess wing substituents that open the tunnel and groove channels deep enough to expand the NNIBP sufficiently to facilitate the opening of the NNRTI Adjacent pocket in the vicinity of the NNIBP solvent-exposed entrance region. Second, an aromatic extension at the 5-position of the pyrimidine ring in DAPY compounds may further open the Adjacent site and provide a bridge between the NNIBP and Adjacent site for dual-targeting inhibitor design [28,32,33]. While compound 27 in complex with RT described in this study is a relatively weak inhibitor of RT, an overlay with K07-15 suggests the pyrazolo[1,5-a]pyridine ring may serve as a minimal scaffold to elaborate in designing novel dual-targeting inhibitors merged with the 5-position extension of K07-15 (Figure 7).
Figure 7. Superposition of WT RT (blue), compound 27 (magenta) and K07-15 compound (green) in the NNIBP. Compound B-1 (orange) is shown in the NNRTI Adjacent site (PDB 4KFB). Created with PyMOL and BioRender.com. Nitrogen atoms are blue and oxygen atoms are red.
In summary, we determined a crystal structure of 27 complexed with RT after elaborating it from compound B-1, which was previously demonstrated to target the NNRTI- Adjacent site [7]. The NNRTI Adjacent site has previously been identified as a target for enhanced NNRTI inhibition, though all leads developed had molecular weight ≥ 500 Da and borderline bioavailability properties [32,34]. The elaborated 27 acts as an NNRTI with modest inhibitory activity but retains a high ligand efficiency (0.37 kcal/mol/HA) and displays favorable bioavailability properties according to SWISSADME analysis (Figure S4) [35]. Compound 27 binding in the NNIBP is not accompanied by opening of the NNRTI Adjacent site, but crystallographic overlay with K07-15 shows a path for designing 27 derivatives to expand into the Adjacent site as a dual-targeting inhibitor with favorable pharmacokinetic properties. In this regard, the Arnold group has found additional NNRTI Adjacent fragment binders in a subsequent crystallographic fragment screening campaign that may aid in future dual-targeting inhibitor design [36].

4. Conclusions

In this work, using a fragment-based approach, we have developed a novel NNRTI minimal chemotype with high ligand efficiency. While the initial hit compound B-1 was bound in the NNRTI Adjacent site, crystallography has revealed that binding of lead compound 27 occurs in the NNIBP. Combination experiments suggest that compounds B-1 and 27 could also be binding to additional sites apart from the NNBIP that likely involve the NNRTI Adjacent site. Related to the latter, inhibitors targeting both the NNIBP and the NNRTI Adjacent site are appealing, but so far DAPY-based leads have a very large molecular weight and poor bioavailability. Structural analysis shows that compound 27—a minimal but efficient NNRTI—offers an attractive possibility to develop a new drug class of dual NNIBP-Adjacent site inhibitors, with potential to overcome drug resistance and side effects associated with current therapeutics.

5. Methods and Materials

5.1. General Chemistry Methods

Starting materials and reagents were purchased from commercial suppliers (Sigma-Aldrich, Merck, BDH laboratories, Ajax Finechem, ChemSupply, Matrix Scientific, Alfa Aesar and Chem-Impex) and were used without further purification unless otherwise stated. Anhydrous solvents were obtained from MBraun SPS-800 Solvent purification system. TLC plates were visualized under UV illumination at 254 nm. Column chromatography was achieved using Davisil silica gel—LC60A (40–63 microns).
The 1H NMR, 13C NMR and 19F NMR spectra were recorded on a Bruker Advance Nanobay III 400 MHz Ultrashield Plus spectrometer at 400.13, 100.61 and 376.50 MHz, respectively. Chemical shifts (δ) are reported in parts per million (ppm), and multiplicities are reported as follows: singlet (s), doublet (d), triplet (t), quartet (q), sextet (sex), doublet of doublets (dd) and multiplet (m). All samples were dissolved in chloroform-d (CDCl3), and the residual solvent signals were used as the internal reference. The 13C NMR assignment of carbon environments based on APT phasing is as follows: C = quaternary carbon, CH = methine carbon, CH2 = methylene carbon and CH3 = methyl carbon.
Liquid chromatography-mass spectrometry (LC-MS) was performed using either system A or B. System A: an Agilent 6100 Series Single Quad coupled to an Agilent 1200 Series high-performance liquid chromatography (HPLC) system using a Phenomenex Luna C8 (2) 50 × 4.6 mm2, 5 μm column. The following buffers were used: buffer A: 0.1% formic acid in H2O; buffer B: 0.1% formic acid in MeCN. Samples were run at a flow rate of 0.5 mL/min for 10 min: 0–4 min 5–100% buffer B in buffer A, 4–7 min 100% buffer B, 7–9 min 100–5% buffer B in buffer A and 9–10 min 5% buffer B in buffer A. Mass spectra were acquired in positive- and negative-ion modes with a scan range of 100–1000 m/z. UV detection was carried out at 254 nm. System B: an Agilent 6120 Series Single Quad coupled to an Agilent 1260 Series HPLC using a Poroshell 120 EC-C18 50 × 3.0 mm2, 2.7 μm column. The following buffers were used: buffer A: 0.1% formic acid in H2O; buffer B: 0.1% formic acid in MeCN. Samples were run at a flow rate of 0.5 mL/min for 5 min: 0–1 min 5% buffer B in buffer A, 1–2.5 min 5–100% buffer B in buffer A, 2.5–3.8 min 100% buffer B, 3.8–4 min 100–5% buffer B in buffer A and 4–5 min 5% buffer B in buffer A. Mass spectra were acquired in positive- and negative-ion modes with a scan range of 100–1000 m/z. UV detection was carried out at 214 and 254 nm.
High resolution mass spectrometry was performed on an Agilent 6224 TOP LC/MS coupled to an Agilent 1290 Infinity. All data were acquired, and reference mass was corrected by a dual-spray electrospray ionization (ESI) source where the chromatographic separation was performed using an Agilent Zorbax SB-C18 Rapid Resolution HT 2.1 × 50 mm, 1.8 μm column using an acetonitrile gradient (5% to 100%) over 3.5 min at 0.5 mL/min. Analytical high-performance liquid chromatography (HPLC) was carried out on Agilent 1260 Infinity Analytical HPLC with a Zorbax Eclipse Plus C18 rapid resolution 4.6 × 100 mm 3.5-Micron column. PP gradient was performed using a flow rate of 1 mL/min and a gradient of 5–100% B over 9 min followed by 100% B over 1 min. LC/MSD Chemstation Rev.B.04.03 coupled with Mass Hunter Easy Access Software managed the running and processing of samples. Preparative reverse-phase HPLC was carried out using a Waters Associates liquid chromatography system (Model 600 Controller and Waters 486 Tunable Absorbance Detector) with a Phenomenex Luna C8(2) 100 Å, 10 μm, 250 × 21.2 mm column with UV detection at 254 nm. A routine slow hydrophobic run was performed using a flow rate of 10 mL/min and a gradient of 20–100% B over 35 min (solvent A: 0.1% TFA in water, solvent B: 0.1% TFA in acetonitrile).

5.2. General Procedure A: Cyclization of Substituted Pyridines with Ethyl Propriolate for the Formation of Substituted Ethyl Pyrazolo[1,5-a]pyridine-3-carboxylates

To a solution of substituted pyridine (1.6 mmol) in DCM (10 mL) was added o-(2,4-dinitrophenyl)hydroxylamine (300 mg, 1.5 mmol) at 0 °C then stirred at room temperature for 2 h. The crude material was concentrated and taken up in DMF (5 mL). Ethyl propiolate (168 μL, 1.7 mmol) and potassium carbonate (260 mg, 1.9 mmol) were added and stirred at room temperature overnight. The reaction mixture was diluted with water (100 mL), extracted with ethyl acetate (2 × 100 mL), the combined organic layers were washed with water (3 × 100 mL), brine (100 mL), dried over magnesium sulfate, filtered and concentrated in vacuo to give a gel-like brown crude product. This was purified using silica gel chromatography (hexanes:ethyl acetate, 85:15) to give the desired products.

5.3. Ethyl 4-Methylpyrazolo[1,5-a]pyridine-3-carboxylate (2) and Ethyl 6-Methylpyrazolo[1,5-a]pyridine-3-carboxylate (4)

3-Methylpyridine (150 mg, 1.6 mmol) was reacted using general procedure A to produce 2 as a yellow solid (55 mg, 21%) and 4 as an orange solid (26 mg, 9%).
2: 1H NMR δ 8.34 (s, 1H), 8.32 (d, J = 1.0 Hz, 1H), 8.05 (d, J = 9.0 Hz, 1H), 7.26 (dd, J = 9.0, 1.3 Hz, 1H), 4.36 (q, J = 7.1 Hz, 2H), 2.39 (d, J = 0.6 Hz, 3H), 1.41 (t, J = 7.1 Hz, 3H). 13C NMR δ 163.8 (C), 144.7 (CH), 130.4 (CH), 127.4 (CH), 124.0 (C), 118.7 (CH), 177.4 (C), 60.0 (CH2), 18.2 (CH3), 14.7 (CH3). HR-ESMS calcd. for C11H12N2O2 [M+H]+: 205.0973; found 205.0970.
4: 1H NMR δ 8.41 (s, 1H), 8.38 (d, J = 6.9 Hz, 1H), 7.15–7.09 (m, 1H), 6.83 (t, J = 7.0 Hz, 1H), 4.34 (q, J = 7.1 Hz, 2H), 2.83 (s, 3H), 1.40 (t, J = 7.1 Hz, 3H). 13C NMR δ 163.4 (C), 159.6 (C), 146.5 (CH), 130.4 (C), 128.0 (CH), 127.4 (CH), 113.7 (CH), 107.7 (C), 60.2 (CH2), 21.7(CH3), 14.7 (CH3). HR-ESMS calcd. for C11H12N2O2 [M+H]+: 205.0972; found 205.0968.

5.4. Ethyl 5-Methylpyrazolo[1,5-a]pyridine-3-carboxylate (3)

4-Methylpyridine (150 mg, 1.6 mmol) was reacted using general procedure A to produce 3 as a brown solid (175 mg, 57%).
1H NMR δ 8.39 (d, J = 7.0 Hz, 1H), 8.34 (d, J = 7.6 Hz, 1H), 6.72 (s, 1H), 7.95–7.91 (m, 1H), 6.77 (dd, J = 7.1, 1.9 Hz, 1H), 4.38 (q, J = 7.1 Hz, 2H), 2.46 (d, J = 0.9 Hz, 3H), 1.41 (t, J = 7.1 Hz, 3H). 13C NMR δ 145.3 (CH), 141.4 (C), 138.9 (C), 128.7 (CH), 117.9 (CH), 116.5 (CH), 60.3 (CH2), 21.7 (C), 15.0 (CH3). HPLC tR = 5.49 min, >95% purity (254 nm). HR-ESMS calcd. for C11H12N2O2 [M+H]+: 205.0972; found 205.0968.

5.5. Ethyl 7-Methylpyrazolo[1,5-a]pyridine-3-carboxylate (5)

3-Methylpyridine (170 mg, 1.9 mmol) was reacted using general procedure A to produce 5 as an orange solid (133 mg, 36%).
1H NMR δ 8.44 (s, 1H), 8.08 (dd, J = 8.9, 0.5 Hz, 1H), 7.35 (dd, J = 8.8, 7.0 Hz, 1H), 6.81 (d, J = 6.9 Hz, 1H), 4.39 (q, J = 7.1 Hz, 2H), 2.80 (s, 3H), 1.42 (t, J = 7.1 Hz, 3H). 13C NMR δ 164.0 (C), 144.5 (CH), 141.5 (C), 139.4 (C), 127.6 (CH), 116.9 (CH), 113.4 (CH), 104.3 (C), 60.2 (CH2), 18.0 (CH3), 14.7 (CH3). HPLC tR = 3.39 min, > 95% purity (254 nm). HR-ESMS calcd. for C11H12N2O2 [M+H]+: 205.0972; found 205.0970.

5.6. Ethyl 5-Aminopyrazolo[1,5-a]pyridine-3-carboxylate (8)

To a solution of ethyl 5-((tert-butoxycarbonyl)amino)pyrazolo[1,5-a]pyridine-3-carboxylate (95 mg, 0.31 mmol) in DCM (3 mL) was added dropwise TFA (480 μL, 6.2 mmol) and then stirred at room temperature for 21 h. Crude mixture was concentrated to give 8 as a tan solid (100 mg, quantitative 100%).
1H NMR δ 8.46 (d, J = 7.4 Hz, 1H), 8.28 (s, 1H), 7.23 (d, J = 2.2 Hz, 1H), 6.46 (dd, J = 7.4, 2.3 Hz, 1H), 6.50–6.33 (bs, 2H), 4.35 (q, J = 7.1 Hz, 2H), 1.39 (t, J = 7.1 Hz, 3H). HPLC tR = 2.92 min, >95% purity (254 nm). HR-ESMS calcd. for C10H11N3O2 [M+H]+: 206.0924; found 206.0923.

5.7. 3-Ethyl 5-Methylpyrazolo[1,5-a]pyridine-3,5-dicarboxylate (15)

Methyl isonicotinate (220 mg, 1.6 mmol) was reacted using general procedure A to produce 15 as an orange solid (89 mg, 24%).
1H NMR δ 8.86 (dd, J = 1.9, 0.9 Hz, 1H), 8.55 (dd, J = 7.2, 0.9 Hz, 1H), 8.47 (s, 1H), 7.52 (dd, J = 7.2, 1.9 Hz, 1H), 4.42 (q, J = 7.1 Hz, 2H), 3.99 (s, 3H), 1.44 (t, J = 7.1 Hz, 3H). 13C NMR δ 165.2 (C), 163.1 (C), 145.7 (CH), 140.0 (C), 129.2 (CH), 128.8 (C), 121.8 (CH), 113.0 (CH), 106.9 (C), 60.5 (CH2), 53.0 (CH3), 14.8 (CH3). HPLC tR = 3.37 min, >95% purity (254 nm). HR-ESMS calcd. for C11H12N2O2 [M+H]+: 249.0870; found 249.0869.

5.8. Ethyl 5-((Tert-butoxycarbonyl)amino)pyrazolo[1,5-a]pyridine-3-carboxylate (16)

tert-Butyl pyridin-4-ylcarbamate (310 mg, 1.6 mmol) was reacted using general procedure A to produce 16 as a yellow solid (110 mg, 24%).
1H NMR δ 8.39 (d, J = 7.6 Hz, 1H), 8.32 (s, 1H), 7.98 (d, J = 2.1 Hz, 1H), 7.33–7.28 (m, 1H), 6.93 (s, 1H), 4.36 (q, J = 7.1 Hz, 2H), 1.54 (s, 9H), 1.40 (t, J = 7.1 Hz, 3H). 13C NMR δ 163.7 (C), 152.1 (C), 145.7 (CH), 141.8 (C), 138.8 (C), 129.6 (CH), 107.3 (CH), 104.0 (CH), 103.0 (C), 82.0 (C), 60.0 (CH2), 28.4 (CH3), 14.7 (CH3). LCMS (m/z) 305.9 [M+H]+, tR = 5.94 min, >95% purity (254 nm).

5.9. General Procedure B: Cyclization of Substituted Pyridine with Ethyl Propriolate for the Formation of Substituted Ethyl Pyrazolo[1,5-a]pyridine-3-carboxylates

O-(2,4-Dinitrophenyl)hydroxylamine (1.0 eq.) was dissolved in THF: H2O or MeCN:H2O (1:1, 20 mL), substituted pyridine (1.05 eq.) was added and stirred at 50–60 °C for 18 h. The solvent was removed in vacuo, crude material was taken up in anhydrous DMF (15 mL), and then potassium carbonate (1.5 eq.) and ethyl propiolate (1.1 eq.) were added and then stirred for 20 h. The reaction mixture was diluted with water (100 mL), extracted with ethyl acetate (2 × 100 mL); the combined organic layers were washed with water (3 × 100 mL), brine (100 mL), dried over magnesium sulphate, filtered and concentrated in vacuo. The crude material was purified using silica gel chromatography (hexanes:ethyl acetate, 85:15) to give the desired products.

5.10. Ethyl 6-Bromopyrazolo[1,5-a]pyridine-3-carboxylate (7) and Ethyl 4-Bromopyrazolo[1,5-a]pyridine-3-carboxylate (6)

o-(2,4-Dinitrophenyl)hydroxylamine (2.0 g, 10 mmol), 3-bromopyridine (1.4 g, 9.1 mmol), potassium carbonate (1.9 g, 14 mmol) and ethyl propiolate (0.99 g, 10 mmol) were reacted using general procedure B to give the title compounds: 7 as a white powder (0.45 g, 18%) and 6 as a yellow solid (0.88 mg, 36%).
6: 1H NMR δ 8.52 (dd, J = 6.9, 0.9 Hz, 1H), 8.43 (s, 1H), 7.64 (dd, J = 7.4, 0.9 Hz, 1H), 6.80 (t, J = 7.2 Hz, 1H), 4.38 (q, J = 7.1 Hz, 2H), 1.41 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.4 (C), 146.5 (CH), 138.8 (C), 132.2 (CH), 129.0 (CH), 113.5 (CH), 111.6 (C), 106.3 (C), 60.7 (CH2), 14.5 (CH3). HPLC tR = 5.50 min, >95% purity (254 nm). HR-ESMS calcd. for C10H9O2N2Br [M+H]+: 268.9920; found 268.9925.
7: 1H NMR δ 8.67 (dd, J = 1.7, 0.8 Hz, 1H), 8.36 (s, 1H), 8.06 (dd, J = 9.4, 0.8 Hz, 1H), 7.47 (dd, J = 9.4, 1.7 Hz, 1H), 4.38 (q, J = 7.1 Hz, 2H), 1.41 (t, J = 7.1 Hz, 3H). 13C NMR δ 163.2 (C), 145. (CH), 139.5 (C), 130.8 (CH), 129.7 (CH), 119.7 (CH), 108.3 (C), 104.9 (C), 60.4 (CH2), 14.6 (CH3). HPLC tR = 5.94 min, >98% purity (254 nm). HR-ESMS calcd. for C10H9O2N2Br [M+H]+: 268.9920; found 268.9918.

5.11. Ethyl 4-Bromo-7-methylpyrazolo[1,5-a]pyridine-3-carboxylate (9)

o-(2,4-Dinitrophenyl)hydroxylamine (0.10 g, 0.51 mmol), 5-bromo-2-methylpyridine (80 mg, 0.47 mmol), potassium carbonate (96 mg, 0.70 mmol) and ethyl propiolate (50 mg, 0.51 mmol) were reacted using general procedure B to produce 9 as an off-white solid (12 mg, 9%).
1H NMR δ 8.40 (s, 1H), 8.26 (d, J = 1.6 Hz, 1H), 6.93 (d, J = 1.0 Hz, 1H), 4.39 (q, J = 7.1 Hz, 2H), 2.77 (s, 3H), 1.42 (t, J = 7.1 Hz, 3H). 13C NMR δ 163.4 (C), 144.9 (CH), 141.7 (C), 140.2 (C), 122.3 (C), 119.3 (CH), 116.9 (CH), 104.2 (C), 60.3 (CH2), 17.7 (CH3), 14.7 (CH3). HPLC tR = 6.48 min, >98% purity (254 nm). HR-ESMS calcd. for C11H11O2N2Br [M+H]+: 283.0077; found 283.0086.

5.12. Ethyl 6-Bromo-4-methoxypyrazolo[1,5-a]pyridine-3-carboxylate (13) and Ethyl 4-Bromo-6-methoxypyrazolo[1,5-a]pyridine-3-carboxylate (10)

o-(2,4-Dinitrophenyl)hydroxylamine (99 mg, 0.50 mmol), 3-bromo-5-methoxypyridine (85 mg, 0.45 mmol), potassium carbonate (93 mg, 0.68 mmol) and ethyl propiolate (50 mg, 0.50 mmol) were reacted using general procedure B to give the title compounds: 10 as a white powder (14 mg, 7%) and 13 as a pale pink solid (40 mg, 30%).
10: 1H NMR δ 8.33 (s, 1H), 8.10 (d, J = 2.1 Hz), 7.47 (d, J = 2.1 Hz), 4.36 (q, J = 7.1 Hz), 3.85 (s, 3H), 1.39 (t, J = 7.1 Hz). 13C NMR δ 162.4 (C), 149.5 (C), 145.8 (CH), 145.8 (C), 134.5 (C), 126.8 (CH), 111.7 (CH), 111.3 (C), 60.6 (CH2), 56.6 (CH3), 14.7 (CH3). HPLC tR = 5.93 min, >99% purity (254 nm). HR-ESMS calcd. for C11H11O3N2Br [M+H]+: 299.0026; found 299.0030.
13: 1H NMR δ 8.31 (s, 2H), 6.72 (s, 1H), 4.34 (q, J = 7.1 Hz, 2H), 4.00 (s, 3H), 1.38 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.3 (C), 151.7 (C), 145.6 (CH), 132.7 (C), 122.9 (CH), 108.2 (CH), 108.0 (C), 106.4 (C), 60.5 (CH2), 56.5 (CH3), 14.5 (CH3). HPLC tR = 5.71 min, >94% purity (254 nm). HR-ESMS calcd. for C11H11O3N2Br [M+H]+: 299.0026; found 299.0032.

5.13. Ethyl 4-Fluoro-7-methylpyrazolo[1,5-a]pyridine-3-carboxylate (11)

o-(2,4-Dinitrophenyl)hydroxylamine (99 mg, 0.49 mmol), 5-fluoro-2-methylpyridine (50 mg, 0.45 mmol), potassium carbonate (93 mg, 0.67 mmol) and ethyl propiolate (49 mg, 0.49 mmol) were reacted using general procedure B to produce 11 as a pale yellow solid (40 mg, 40%).
1H NMR δ 8.44 (s, 1H), 7.03 (dd, J = 10.2, 7.9 Hz, 1H), 6.70 (ddd, J = 7.8, 4.5, 0.5 Hz, 1H), 4.36 (q, J = 7.1 Hz, 2H), 2.73 (s, 3H), 1.39 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.6 (C), δ 152.4 (d, J = 254.2 Hz, C), 145.2 (CH), 135.8 (d, J = 5.3 Hz, C), 132.6 (d, J = 32.1 Hz, C), 111.8 (d, J = 6.2 Hz, CH), 111.4 (d, J = 18.8 Hz, CH), 105.2 (d, J = 5.6 Hz, C), 60.5 (CH2), 17.7 (CH3), 14.5 (CH3). HPLC tR = 5.52 min, >99% purity (254 nm). HR-ESMS calcd. for C11H11O2N2F [M+H]+: 223.0877; found 223.0888.

5.14. Ethyl 4-Chloro-7-methylpyrazolo[1,5-a]pyridine-3-carboxylate (12)

o-(2,4-Dinitrophenyl)hydroxylamine (0.10 g, 0.52 mmol), 5-chloro-2-methylpyridine (60 mg, 0.47 mmol), potassium carbonate (98 mg, 0.71 mmol) and ethyl propiolate (51 mg, 0.52 mmol) were added were reacted using general procedure B to produce 12 as an off-white powder (62 mg, 55%).
1H NMR δ 8.44 (s, 1H), 7.34 (d, J = 7.6 Hz, 1H), 6.72 (d, J = 7.6 Hz, 1H), 4.37 (q, J = 7.1 Hz, 2H), 2.74 (s, 3H), 1.39 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.6 (C), 145.9 (CH), 138.4 (C), 138.0 (C), 128.2 (CH), 122.5 (C), 112.7 (CH), 106.1 (C), 60.6 (CH2), 18.1 (CH3), 14.5 (CH3). HPLC tR = 5.92 min, >94% purity (254 nm). HR-ESMS calcd. for C11H11O2N2Cl [M+H]+: 239.0582; found 239.0589.

5.15. Ethyl 5-Chloro-7-methylpyrazolo[1,5-a]pyridine-3-carboxylate (14)

O-(2,4-Dinitrophenyl)hydroxylamine (0.10 g, 0.52 mmol), 4-chloro-2-methylpyridine (60 mg, 0.47 mmol), potassium carbonate (98 mg, 0.71 mmol) and ethyl propiolate (51 mg, 0.52 mmol) were reacted using general procedure B to produce 14 as an off-white solid (15 mg, 13%).
1H NMR δ 8.41 (s, 1H), 8.06 (d, J = 1.8 Hz, 1H), 6.79 (d, J = 1.1 Hz, 1H), 4.38 (q, J = 7.1 Hz, 2H), 2.77 (s, 3H), 1.41 (t, J = 7.1 Hz, 3H). 13C NMR δ 163.4 (C), 145.1 (CH), 141.4 (C), 140.3 (C), 134.5 (C), 115.8 (CH), 114.5 (CH), 104.3 (C), 60.3 (CH2), 17.8 (CH3), 14.7 (CH3). HPLC tR = 6.33 min, >98% purity (254 nm). HR-ESMS calcd. for C11H11O2N2Cl [M+H]+: 239.0582; found 239.0588.

5.16. 4-Bromopyrazolo[1,5-a]pyridine-3-carboxylic Acid (17)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (30 mg, 0.13 mmol) was dissolved in a solution of THF:MeOH:H2O (4:1:1, 2 mL). Lithium hydroxide monohydrate (71 mg, 1.7 mmol) was added and stirred at room temperature for 24 h. Additional lithium hydroxide monohydrate was added (54 mg, 1.3 mmol) and stirred for an additional 8 h. Solvent was removed in vacuo, dissolved in ethyl acetate (10 mL) and acidified with HCl (1 M, 10 mL). The organic layer was then washed with brine, dried over magnesium sulphate, filtered and concentrated in vacuo to give 17 as a pale-yellow powder (30 mg, 96%).
1H NMR (400 MHz, (CD3)2SO) δ 12.47 (bs, 1H, OH), 8.89 (dd, J = 6.9, 0.9 Hz, 1H, H7), 8.45 (s, 1H, H2), 7.82 (dd, J = 7.5, 0.8 Hz, 1H, H5), 7.02 (t, J = 7.2 Hz, 1H, H6). 13C NMR (100 MHz, (CD3)2SO) δ 153.2 (C), 136.2 (CH), 127.9 (C), 122.7 (CH), 120.0 (CH), 104.5 (CH), 100.3 (C), 96.5 (C). HPLC tR = 3.80 min, >95% purity (254 nm). HR-ESMS calcd. for C8H5O2N2Br [M+H]+: 242.9587; found 242.9592.

5.17. Methyl 4-Bromopyrazolo[1,5-a]pyridine-3-carboxylate (18)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (50 mg, 0.19 mmol) and dipotassium phosphate (8.0 mg, 0.05 mmol) were dissolved in methanol (3 mL) and then stirred at 80 °C for 24 h. Additional dipotassium phosphate (10 mg, 0.06 mmol) was added and stirred at 80 °C for another 24 h. The reaction mix was diluted with water (20 mL), extracted twice with ethyl acetate (2 × 20 mL) and then combined organic layers were washed with water (2 × 20 mL) and brine, dried over magnesium sulphate, filtered and concentrated in vacuo. The crude material was purified using preparative reverse-phase HPLC to give 18 as a white powder (14 mg, 30%).
1H NMR (400 MHz, CDCl3) δ 8.53 (dd, J = 6.9, 1.0 Hz, 1H, H7), 8.43 (s, 1H, H2), 7.65 (dd, J = 7.5, 0.9 Hz, 1H, H5), 6.81 (t, J = 7.2 Hz, 1H, H6), 3.91 (s, 3H, H1’). 13C NMR (100 MHz, CDCl3) δ 162.8 (C), 146.5 (CH), 138.9 (C), 132.3 (CH), 129.1 (CH), 113.62 (CH), 111.6 (C), 105.9 (C), 51.8 (CH3). HPLC tR = 4.91 min, >98% purity (254 nm). HR-ESMS calcd. for C9H7O2N2Br [M+H]+: 256.9744; found 256.9747.

5.18. Propyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (19)

4-Bromopyrazolo[1,5-a]pyridine-3-carboxylic acid was dissolved in propanol (3 mL) with concentrated sulfuric acid (40 μL), and the resulting mixture was stirred at 90 °C for 24 h. Additional concentrated sulfuric acid (50 μL) was added and stirred at 90 °C for another 24 h. The mixture was cooled and neutralized with NaOH (1 M) and washed twice with ethyl acetate (2 × 20 mL). The combined organic layers were then washed with brine (20 mL), dried over magnesium sulphate, filtered and concentrated in vacuo. The crude material was purified using preparative reverse-phase HPLC to give 19 as a white powder (21 mg, 36%).
1H NMR (400 MHz, CDCl3) δ 8.52 (dd, J = 6.9, 1.0 Hz, 1H, H7), 8.43 (s, 1H, H2), 7.64 (dd, J = 7.4, 1.0 Hz, 1H, H5), 6.80 (t, J = 7.2 Hz, 1H, H6), 4.28 (t, J = 6.8 Hz, 2H, H1’), 1.86–1.76 (sex, J = 7.4 Hz, 2H, H2’), 1.03 (t, J = 7.4 Hz, 3H, H3’). 13C NMR (100 MHz, CDCl3) δ 162.5 (C), 146.5 (CH), 146.5 (C), 132.2 (CH), 129.0 (CH), 113.5 (CH), 111.7 (C), 106.4 (C), 66.4 (CH2), 22.3 (CH2), 10.7 (CH3). HPLC tR = 6.01 min, >98% purity (254 nm). HR-ESMS calcd. for C11H11O2N2Br [M+H]+: 283.0077; found 283.0082.

5.19. 4-Bromo-N-ethylpyrazolo[1,5-a]pyridine-3-carboxamide (20)

4-Bromopyrazolo[1,5-a]pyridine-3-carboxylic acid (13 mg, 0.05 mmol) was dissolved in DMF (1 mL). HBTU (2 eq.), DIPEA (4 eq.), and 70% aqueous ethylamine (4.7 mg, 0.10 mmol) were added and the solution was stirred at room temperature for 2–4 h. The crude solution was added dropwise to a mixture of water and saturated sodium bicarbonate (1:1, 30 mL), stirred for 1 h and then extracted into ethyl acetate (30 mL), washed with water (2 × 30 mL) and brine (20 mL), dried over magnesium sulphate, filtered and concentrated in vacuo to produce 20 with sufficient purity as a pale powder (12 mg, 86%).
1H NMR (400 MHz, CDCl3) δ 8.47 (d, J = 6.4 Hz, 1H, H7), 8.17 (s, 1H, H2), 7.50 (d, J = 6.9 Hz, 1H, H5), 6.74 (t, J = 7.2 Hz, 1H, H6), 6.04 (s, 1H, NH), 3.58–3.45 (m, 2H, H1’), 1.28 (t, J = 7.3 Hz, 3H, H2’). 13C NMR (100 MHz, CDCl3) δ 163.2 (C), 142.9 (CH), 136.5 (C), 129.7 (CH), 128.5 (CH), 112.7 (CH), 111.0 (C), 101.2 (C), 35.2 (CH2), 14.8 (CH3). HPLC tR = 3.76 min, >87% purity (254 nm). HR-ESMS calcd. for C10H10ON3Br [M+H]+: 268.0080; found 268.0085.

5.20. 4-Bromo-N,N-diethylpyrazolo[1,5-a]pyridine-3-carboxamide (21)

4-Bromopyrazolo[1,5-a]pyridine-3-carboxylic acid (13 mg, 0.05 mmol) was dissolved in DMF (1 mL). HBTU (2 eq.), DIPEA (4 eq.), and diethylamine (10 mg, 0.14 mmol) were added, and the solution was stirred at room temperature for 2–4 h. The crude solution was added dropwise to a mixture of water and saturated sodium bicarbonate (1:1, 30 mL), stirred for 1 h and then extracted into ethyl acetate (30 mL), washed with water (2 × 30 mL) and brine (20 mL), dried over magnesium sulphate, filtered and concentrated in vacuo to produce 21 with sufficient purity as a dark oil (15 mg, 74%).
1H NMR (400 MHz, CDCl3) δ 8.45 (dd, J = 7.0, 0.8 Hz, 1H, H7), 7.98 (s, 1H, H2), 7.41 (dd, J = 7.3, 0.8 Hz, 1H, H5), 6.71 (t, J = 7.2 Hz, 1H, H6), 3.63 (dd, J = 15.1, 8.6 Hz, 2H, H1’), 3.28 (dd, J = 14.0, 6.9 Hz, 2H, H1’’), 1.30 (t, J = 7.0 Hz, 3H, H2’), 1.08 (t, J = 7.0 Hz, 3H, H2’’). 13C NMR (100 MHz, CDCl3) δ 164.5 (C), 155.1 (C), 140.4 (CH), 128.2 (CH), 128.1 (CH), 112.5 (CH), 111.1 (C), 104.4 (C), 43.8 (CH2), 39.6 (CH2), 14.2 (CH3), 12.5 (CH3). LCMS (m/z) 296.9 [M+H]+, tR = 3.22 min. HPLC tR = 4.83 min, >90% purity (254 nm).

5.21. 4-Bromo-N-(4-hydroxyphenethyl)pyrazolo[1,5-a]pyridine-3-carboxamide (22)

4-Bromopyrazolo[1,5-a]pyridine-3-carboxylic acid (17 mg, 0.07 mmol) was dissolved in DMF (1 mL). HBTU (2 eq.), DIPEA (4 eq.), and 4-(2-aminoethyl)phenol (19 mg, 0.14 mmol) were added, and the solution was stirred at room temperature for 2–4 h. The crude solution was added dropwise to a mixture of water and saturated sodium bicarbonate (1:1, 30 mL), stirred for 1 h and then extracted into ethyl acetate (30 mL), washed with water (2 × 30 mL) and brine (20 mL), dried over magnesium sulphate, filtered and concentrated in vacuo to produce 22 with sufficient purity as a pale oil (16 mg, 63%).
1H NMR (400 MHz, (CD3)2SO) δ 9.23 (bs, 1H, OH), 8.79 (dd, J = 6.9, 0.8 Hz, 1H, H7), 8.34 (t, J = 5.6 Hz, 1H, H6), 8.15 (s, 1H, H2), 7.65 (dd, J = 7.4, 0.8 Hz, 1H, H5), 7.05 (d, J = 8.5 Hz, 2H, H3’), 6.91 (t, J = 7.2 Hz, 1H, H6), 6.71–6.66 (m, 2H, H4’), 3.40 (dd, J = 14.7, 6.0 Hz, 2H, H1’), 2.73 (t, J = 7.5 Hz, 2H, H2’). 13C NMR (100 MHz, (CD3)2SO) δ 162.2 (C), 155.9 (C), 142.1 (CH), 135.8 (C), 129.5 (CH × 2), 129.4 (CH), 129.3 (C), 128.8 (CH), 115.2 (CH × 2), 113.1 (CH), 111.2 (C), 110.4 (C), 41.2 (CH2), 34.2 (CH2). HPLC tR = 4.410 min, >95% purity (254 nm). HR-ESMS calcd. for C16H14O2N3Br [M+H]+: 360.0342; found 360.0328.

5.22. General Procedure C: Sonogashira Reaction for the Formation of Ethyl 4-Substituted Pyrazolo[1,5-a]pyridine-3-carboxylates

Tetrakis(triphenylphosphine)palladium(0) (0.1 eq.), copper iodide (0.1 eq.) and ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (1 eq.) were combined, sealed and degassed. Diisopropylamine (~2 mL) and substituted alkyne (1.5–2 eq.) were added to the reaction mix, degassed and then stirred under nitrogen for 20 h at 80 °C. Crude material was taken up into ethyl acetate (20 mL), filtered through Celite™ and washed with water, and the aqueous layer was washed with ethyl acetate. The combined organic layers were washed with water (3 × 30 mL) and brine (20 mL), dried over magnesium sulphate, filtered and concentrated in vacuo to give crude product. This was purified using silica gel chromatography (hexanes:ethyl acetate, 9:1) to give the desired product.

5.23. Ethyl 4-((Trimethylsilyl)ethynyl)pyrazolo[1,5-a]pyridine-3-carboxylate (23)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (36 mg, 0.13 mmol) and trimethylsilylacetylene (26 mg, 0.27 mmol) were reacted using general procedure C to produce 23 as a yellow oil (30 mg, 80%).
1H NMR δ 8.48 (dd, J = 6.9, 0.8 Hz, 1H), 8.38 (s, 1H), 7.56 (dd, J = 7.2, 0.9 Hz, 1H), 6.86 (t, J = 7.1 Hz, 1H), 4.36 (q, J = 7.1 Hz, 2H), 1.38 (t, J = 7.1 Hz, 3H), 0.29 (s, 9H). 13C NMR δ 162.1 (C), 145.9 (CH), 139.2 (C), 133.9 (CH), 129.8 (CH), 115.1 (C), 113.0 (CH), 106.3 (C), 102.8 (C), 100.4 (C), 60.0 (CH2), 14.7 (CH3), 0.0 (3 × CH3). HPLC tR = 7.27 min, >98% purity (254 nm). HR-ESMS calcd. for C15H18O2N2Si [M+H]+: 287.1210; found 287.1219.

5.24. Ethyl 4-(3-(Dimethylamino)prop-1-yn-1-yl)pyrazolo[1,5-a]pyridine-3-carboxylate (24)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (50 mg, 0.19 mmol) and N,N-dimethylprop-2-yn-1-amine (46 mg, 0.56 mmol) were reacted using general procedure C to produce 24 as a brown oil (34 mg, 67%).
1H NMR δ 8.46 (dd, J = 6.9, 0.8 Hz, 1H), 8.38 (s, 1H), 7.52 (dd, J = 7.2, 0.7 Hz, 1H), 6.86 (t, J = 7.1 Hz, 1H), 4.33 (q, J = 7.1 Hz, 2H), 3.59 (s, 2H), 2.40 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.4 (C), 146.2 (CH), 139.5 (C), 133.5 (CH), 129.6 (CH), 115.3 (C), 113.2 (CH), 106.0 (C), 92.7 (C), 81.7 (C), 60.3 (CH2), 49.1 (CH2), 44.6 (2 × CH3), 14.7 (CH3). HPLC tR = 4.21 min, >98% purity (254 nm). HR-ESMS calcd. for C15H17O2N3 [M+H]+: 272.1394; found 272.1398.

5.25. Ethyl 4-(4-Hydroxybut-1-yn-1-yl)pyrazolo[1,5-a]pyridine-3-carboxylate (25)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (50 mg, 0.19 mmol) and but-3-yn-1-ol (39 mg, 0.56 mmol) were reacted using general procedure C to produce 25 as a brown powder (38 mg, 80%).
1H NMR δ 8.47 (d, J = 6.8 Hz, 1H), 8.39 (s, 1H), 7.50 (d, J = 7.2 Hz, 1H), 6.88 (t, J = 7.1 Hz, 1H), 4.33 (q, J = 7.1 Hz, 2H), 3.84 (t, J = 5.3 Hz, 2H), 2.73 (t, J = 5.3 Hz, 2H), 1.37 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.9 (C), 146.2 (CH), 140.0 (C), 133.1 (CH), 129.3 (CH), 115.6 (C), 113.5 (CH), 105.2 (C), 95.8 (C), 78.7 (C), 60.8 (CH2), 60.7 (CH2), 25.0 (CH2), 14.5 (CH3). HPLC tR = 4.88 min, >99% purity (254 nm). HR-ESMS calcd. for C14H14O3N2 [M+H]+: 259.1077; found 259.1082.

5.26. Ethyl 4-(7-Hydroxyhept-1-yn-1-yl)pyrazolo[1,5-a]pyridine-3-carboxylate (26)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (50 mg, 0.19 mmol) and hept-6-yn-1-ol (31 mg, 0.28 mmol) were reacted using general procedure C to produce 26 as a dark oil (39 mg, 70%).
1H NMR δ 8.43 (d, J = 6.9, 1H), 8.37 (s, 1H), 7.45 (d, J = 7.1 Hz, 1H), 6.84 (t, J = 7.1 Hz, 1H), 4.33 (q, J = 7.1 Hz, 2H), 3.65 (t, J = 6.1 Hz, 2H), 2.53 (t, J = 6.9 Hz, 2H), 1.99 (s, 1H), 1.70–1.51 (m, 6H), 1.37 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.5 (C), 146.0 (CH), 139.6 (C), 132.9 (CH), 128.8 (CH), 116.0 (C), 113.2 (CH), 105.7 (C), 98.2 (C), 77.1 (C), 62.7 (CH2), 60.2 (CH2), 32.3 (CH2), 28.1 (CH2), 25.2 (CH2), 20.0 (CH2), 14.6 (CH3). HPLC tR = 5.61 min, >98% purity (254 nm). HR-ESMS calcd. for C17H20O3N2 [M+H]+: 301.1547; found 301.155.

5.27. Ethyl 4-(Cyclopropylethynyl)pyrazolo[1,5-a]pyridine-3-carboxylate (27)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (50 mg, 0.19 mmol) and ethynylcyclopropane (18 mg, 0.28 mmol) were reacted using general procedure C to produce 27 as a dark green oil (31 mg, 66%).
1H NMR δ 8.42 (dd, J = 6.9, 0.9 Hz, 1H), 8.37 (s, 1H), 7.42 (dd, J = 7.2, 1.0 Hz, 1H), 6.82 (t, J = 7.1 Hz, 1H), 4.35 (q, J = 7.1 Hz, 2H), 1.53 (m, 1H), 1.39 (t, J = 7.1 Hz, 3H), 1.01–0.85 (m, 4H). 13C NMR δ 162.4 (C), 146.0 (CH), 139.6 (C), 132.5 (CH), 128.8 (CH), 116.0 (C), 113.2 (CH), 105.8 (C), 101.6 (C), 72.2 (CH), 60.2 (CH2), 14.6 (CH3), 8.9 (2 × CH2), 0.8 (CH). HPLC tR = 6.25 min, >97% purity (254 nm). HR-ESMS calcd. for C15H14O2N2 [M+H]+: 255.1128; found 255.1135.

5.28. Ethyl 4-(pent-1-yn-1-yl)pyrazolo[1,5-a]pyridine-3-carboxylate (28)

Ethyl 4-bromopyrazolo[1,5-a]pyridine-3-carboxylate (50 mg, 0.19 mmol) and pent-1-yne (19 mg, 0.28 mmol) were reacted using general procedure C to produce 28 as a yellow oil (22 mg, 46%).
1H NMR δ 8.45 (dd, J = 6.9, 0.8 Hz, 1H), 8.39 (s, 1H), 7.47 (d, J = 6.8 Hz, 1H), 6.85 (t, J = 7.1 Hz, 1H), 4.35 (q, J = 7.1 Hz, 2H), 2.50 (t, J = 7.1 Hz, 2H), 1.70 (sex, J = 7.3 Hz, 2H), 1.39 (t, J = 7.1 Hz, 3H), 1.06 (t, J = 7.4 Hz, 3H). 13C NMR δ 162.5 (C), 146.1 (CH), 140.6 (C), 132.8 (CH), 129.0 (CH), 116.1 (C), 113.2 (CH), 98.4 (C), 78.7 (C), 77.1 (CH2), 60.7 (C), 60.2 (CH2), 22.1 (CH2), 14.6 (CH3), 13.8 (CH3). HPLC tR = 6.58 min, >98% purity (254 nm). HR-ESMS calcd. for C15H16O2N2 [M+H]+: 257.1285; found 257.1284.

5.29. Ethyl 4-ethynylpyrazolo[1,5-a]pyridine-3-carboxylate (29)

Ethyl 4-((trimethylsilyl)ethynyl)pyrazolo[1,5-a]pyridine-3-carboxylate (30 mg, 0.10 mmol) in methanol (2 mL) was cooled to 0 °C; potassium carbonate (29 mg, 0.21 mmol) was added; then, the solution was stirred at room temperature for 5 h. Reaction mix was diluted with water (20 mL), extracted with ethyl acetate (25 mL), washed with brine (20 mL), dried over magnesium sulphate, filtered and concentrated in vacuo to produce 29 with sufficient purity as a brown oil (19 mg, 85%).
1H NMR δ 8.53 (d, J = 6.9 Hz, 1H), 8.44 (s, 1H), 7.62 (d, J = 7.2 Hz), 6.89 (t, J = 7.1 Hz, 1H), 4.37 (q, J = 7.1 Hz, 2H), 3.53 (s, 1H), 1.39 (t, J = 7.1 Hz, 3H). 13C NMR δ 162.5 (C), 146.4 (CH), 139.2 (C), 134.8 (CH), 130.4 (CH), 114.2 (C), 113.0 (CH), 106.0 (C), 84.5 (C), 60.3 (CH2), 51.2 (CH), 14.9 (CH3). HPLC tR = 5.08 min, >95% purity (254 nm). HR-ESMS calcd. for C12H10O2N2 [M+H]+: 215.0815; found 215.0814.

5.30. Surface Plasmon Resonance

SPR assays were performed on a Biacore S200 (GE Healthcare). His-tagged RT (WT, K103N, Y181C or K103N/Y181C) was immobilized on the surface of a Biacore compatible NIHC 1500M (Xantec) chip according to manufacturer’s instructions. Following 3 injections 300 s each of 0.5 M EDTA, the chip surface was activated with a 120 s injection of 5 mM NiCl2 followed by a 2100 s injection of 130 nM RT. The final immobilization level of RT was typically 14,000–27,000 RU. SPR experiments were carried out at 25 °C using a flow rate of 50 µL/min in running buffer. The running buffer was 1.053 × (HBS pH 7.4 + 50 µM EDTA + 0.005% Tween-20). Compounds were provided as 200 mM stocks and diluted in running buffer to obtain the concentrations required for dose-response studies (0, 6.25, 12.5, 25, 50, 100 and 200 µM). Raw sensorgram data were analyzed using Biacore S200 Evaluation Software. Dose-response determinations were evaluated using a 1:1 binding model. KD values were determined by Biacore S200 Evaluation Software Version 1.0. assuming 1:1 binding. For compounds approaching saturation, Rmax was floated. For compounds with insufficient curvature, Rmax was fixed based on a control. Errors were determined as the standard error in the dose-response fit, as calculated by Biacore S200 Evaluation Software.

5.31. DNA Dependant DNA Polymerase (DDDP) Activity Assays

NNRTIs: Nevirapine was obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, NIH. Doravirine was purchased from MedChemExpress (Cat no HY-16767).
Recombinant HIV-1 RT: The p66/p51 HIV-1 RT heterodimer engineered with a N-terminal histidine tag was expressed from the pRT6H-PR vector (provided by Nicolas Sluis-Cremer) which is based on pRT6H-PROT [37], except that the RT coding region is derived from the infectious molecular clone xxLAI [38]. This xxLAI clone contains the HIV-1LAI backbone [39,40] and is engineered with silent mutations introducing Xma I and Xba I sites in the RT coding region at nucleotide positions 40–45 and 1470 to 1475, respectively. pRT6H-PR expressing the NNRTI drug-resistant mutations K103N, Y181C and K103N/Y181C were generated by subcloning Xma I/Xba I fragments in xxLAI harboring the desired NNRTI mutations (Giacobbi NS and Sluis-Cremer 2017 AAC) into the corresponding restriction sites in the RT coding region of p6HRT-PR. RT was expressed in Escherichia coli strain M15 and purified using Ni-NTA chromatography as previously described [41,42]. RT concentrations were determined spectrophotometrically at 280 nm using an extinction coefficient (e280) of 260, 450 M−1 cm−1. To determine DDDP assay incubation times, RT stocks were subjected to a DDDP time course assay to determine the initial linear rate period, which was typically up to 10 min [14].
33P-radiolabeled DDDP assay: Compounds were initially screened for their ability to inhibit WT HIV-1 RT DDDP activity at 1000 µM, 333 µM and 111 µM. If at least 50% inhibitory activity was observed at any of the tested concentrations compared to the untreated control, the compounds were subsequently re-tested to determine their IC50 values against WT RT, with potent inhibitors tested against NNRTI drug-resistant mutants. Nevirapine was included in assays as a positive control for inhibiting RT polymerase activity. The DDDP assay was performed by first adding 25 ng of HIV-1 RT to test compound in 96-well plates followed by initiating RT polymerase activity by adding 200 ng of activated calf thymus (ACT) DNA (Sigma Aldrich), 0.2 µCi 33P-α-dTTP (Perkin Elmer), 50 mM Tris-HCl pH 7.8 50 mM KCl, 10 MgCl2, 50 µM dNTP mix (Bioline), 0.1 mg/mL bovine serum albumin (New England Biolabs), 0.01% IGEPAL (Sigma) and 1 mM dithiothreitol. Reactions contained 2.5% dimethyl sulfoxide (DMSO). Following incubation at 37 °C for 10 min, samples from duplicate wells were applied to Whatman DE81 ion-exchange paper (GE Healthcare); dried membranes were washed in 2X saline-sodium citrate (SSC) buffer; and incorporated counts were quantified using an FLP-2000 phosphorimager (Fujifilm) or Typhoon Trio Phosphorimager (GE Healthcare) as published [14]. Dose–response curves were generated using PRISM GraphPad version 8 by plotting the log transformed drug concentrations against percentage inhibition of DDDP activity compared to the no drug control using non-linear regression analysis [43].
Non-radioactive DDDP Assay: DDDP assays were also performed using a PicoGreen based spectrophotometric assay to detect double-stranded DNA synthesized by recombinant HIV-1 RT [15]. Assays were performed as described for the 32P-radiolabeled DDDP assay except that instead of ACT, the reaction contained 40 nM of a template/primer comprising a 200 nt DNA template (5′-TCTCTCTGGTTAGACCA GATCTGAGCCTGGGAGCTCTCTGGCTGACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTAAAGTAGATGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAATATCTCATAGCTTGGTGCTCGAACAGTGAC-3′) annealed to a 18 nucleotide DNA primer (5′-GTCACTGTTCGAGCACCA-3′), 50 mM Tris-HCl pH 7.8, 50 mM KCl, 10 mM MgCl2 and 50 µM dNTP mix. Reactions were stopped by adding the detection reagent containing 1 × Quant-IT PicoGreen Reagent (Invitrogen) and 12.5 mM ethylenediaminetetraacetic acid (EDTA); samples were transferred to a 96-well black plate, and fluorescence was measured at excitation/emission (480/520 nm) using the CLARIOstar multifunction microplate reader (BMG Labtech).
Combination Assays: To determine if compounds mediated synergistic, antagonistic or additive inhibition of recombinant HIV-1 RT, the non-radioactive DDDP assay was used as described above except that the template/primer comprised an 18 nt primer annealed to a 100 nt template (5′-ATGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAAC TAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAATATCTCATAGCTTGGTGCTCGAACAGTGAC-3′) [15], and the Quantifluor dsDNA system (Promega) was used, according to the manufacturer’s protocol, instead of the Quant-IT PicoGreen Reagent. The combination analysis performed was based on the median effect principle (Chou and Talalay 1983). Data were analyzed using the CalcuSyn Version 2 software (Biosoft, Cambridge, UK) according to CalcuSyn user manual instructions for fixed-ratio combinations [44]. Nevirapine (NVP) was tested in combination with doravirine (DOR), compound B-1 and 27 at fixed ratios of 18:1, 1:200 and 1:19, respectively. Combination index (CI) values at effective doses of 50% (ED50), 75% (ED75) and 90% (ED90) were calculated from three independent assays demonstrating a median-effect plot linear correlation coefficient (r) of r > 0.96. Average CI and the SEM was calculated for 3 independent assays. CI 0.90–1.10 is nearly additive; CI 1.10–1.20 is slight antagonism; CI 1.20–1.45 is moderate antagonism.

5.32. HIV-1 RT Crystallization and Structure Determination

RT52A, a crystallization-optimized form of RT, was expressed and purified as previously described [45]. Hanging-drop crystallization trays were set up following incubation of RT52A (20 mg/mL) for 1 h with either 1:12 27 or 1:12 27 plus 1:1.5 rilpivirine (RPV) molar ratio at room temperature (~23 °C). Crystals were grown at 4 °C in either 1:2, 1:1 or 2:1 ratios of protein and well solution containing 11% PEG 8000, 4% PEG 400, 100 mM imidazole pH 6.6, 10 mM spermine, 15 mM MgSO4, 100 mM ammonium sulfate and 5 mM tris(2-carboxyethyl)phosphine (TCEP) and a previously optimized concentration of microseeds from RT52A/RPV crystals.
Cryoprotectant solutions were prepared using crystallization well solution with the addition of 5% (v/v) ethylene glycol, and 20% (v/v) DMSO (containing 2 mM final concentration of 27 or 0.256 mM rilpivirine plus 2 mM 27). Crystals were harvested ~3 weeks after appearance. Crystals were placed in cryoprotectant for 5 min before flash-cooling in liquid nitrogen. Data were collected at NSLS-II AMX and APS 23ID-D beamlines. Diffraction data were indexed, processed, scaled and merged using the fastDP (XDS) pipeline [46]. Merged datasets were passed through CCP4 DIMPLE to assess ligand binding [47]. Unmerged datasets were assessed for isomorphism using CCP4 BLEND [48], in analysis mode. Three datasets—whose Linear Cell Variation (LCV) values were <1.5%—were merged using CCP4 BLEND Synthesis and AIMLESS [49]. Ligand coordinates and restraints were generated with the Grade Web Server [50]. Molecular replacement, model building and refinement were performed using Phaser (with PDB ID 4G1Q as template) [51], Coot [52] and phenix.refine [53], respectively. The diffraction data and refinement statistics are summarized in Table S1. Figures were prepared with PyMOL (The PyMOL Molecular Graphics System, Version 2.5 Schrödinger, LLC, New York, NY, USA) and BioRender (created with BioRender.com, Toronto, ON, Canada).
Statistical Analysis: The statistical significance between IC50 values obtained from recombinant RT assays were determined using Mann–Whitney test or Kruskal–Wallis test for multiple comparisons using Prism 9 (GraphPad Software Version 9.4.0, Boston, MA, USA).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules28073103/s1, Table S1: Binding site, chemical structure, and potency of HIV-1 RT fragments hits discovered by Bauman et al.; Table S2: HIV-1 RT inhibition, dissociation constants and ligand efficiencies of Series 2 compounds; Figure S1: SPR curves for compounds 2, 6 and 27; Figure S2: Dose response curves for compounds B-1 and 27 determined using the Picogreen RT DDDP assay; Table S3: X-ray data and refinement statistics for PDB 8FFX; Figure S3: Interactions of compound 27 with neighboring waters in the NNIBP; Figure S4: SWISSADME analysis summary of compound 27; Figure S5: Chemical structures of NNRTIs and compound 27 described in this study.

Author Contributions

Conceptualization, E.A., D.K.C., S.J.H. and G.T.; performed experiments, M.M., S.R., S.J.H., S.D., A.J., J.-A.P., M.J.G., C.F.L., G.W.M., D.T., J.D.B. and F.X.R.; analyzed data, M.M., S.R., S.D., S.J.H., A.J., J.-A.P., M.J.G., C.F.L., N.B., G.W.M., P.E., D.T., J.D.B., F.X.R., E.A., D.K.C. and G.T.; writing—original draft preparation, M.M., and S.R.; writing—review and editing, M.M., S.R., S.D., J.-A.P., N.S.-C., F.X.R., E.A., D.K.C. and G.T.; supervision C.F.L., J.-A.P., N.B., F.X.R., E.A., D.K.C. and G.T. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Project Grants GNT1064900 and GNT1119940 awarded to G.T., C.F.L., D.C., N.S.-C. and E.A. from the National Medical Research Council (NHMRC) of Australia, and also to E.A. by grant R01 AI027690 from National Institutes of Health (NIH). S.R. was supported by the National Institute of General Medical Sciences of the National Institutes of Health Training Grant under award numbers T32 GM008339 and T32 GM135141. GT was supported by NHMRC Senior Research Fellowship GNT1117748.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data and protocols associated with this publication not included in the manuscript and supplementary can be made available upon request. The RT/compound 27 structure has been deposited in the Protein Data Bank (PDB ID 8FFX). Atomic coordinates and experimental data will be released upon article publication.

Acknowledgments

We thank the NIH AIDS Research Program, Division of AIDS, NIAID, NIH for providing nevirapine. The authors gratefully acknowledge the contribution to this work of the Victorian Operational Infrastructure Support Program received by the Burnet Institute.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Singh, A.K.; Das, K. Insights into HIV-1 Reverse Transcriptase (RT) Inhibition and Drug Resistance from Thirty Years of Structural Studies. Viruses 2022, 14, 1027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Spivack, S.; Pagkalinawan, S.; Samuel, R.; Koren, D.E. HIV: How to manage heavily treatment-experienced patients. Drugs Context. 2022, 11, 2021-9-1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Cilento, M.E.; Kirby, K.A.; Sarafianos, S.G. Avoiding Drug Resistance in HIV Reverse Transcriptase. Chem. Rev. 2021, 121, 3271–3296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Waheed, A.A.; Tachedjian, G. Why Do We Need New Drug Classes for HIV Treatment and Prevention? Curr. Top. Med. Chem. 2016, 16, 1343–1349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Baker, L.M.; Aimon, A.; Murray, J.B.; Surgenor, A.E.; Matassova, N.; Roughley, S.D.; Collins, P.M.; Krojer, T.; von Delft, F.; Hubbard, R.E. Rapid optimisation of fragments and hits to lead compounds from screening of crude reaction mixtures. Commun. Chem. 2020, 3, 122. [Google Scholar] [CrossRef] [Scilit]
  6. Latham, C.F.; La, J.; Tinetti, R.N.; Chalmers, D.K.; Tachedjian, G. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors. Curr. Top. Med. Chem. 2016, 16, 1135–1153. [Google Scholar] [CrossRef] [Scilit]
  7. Bauman, J.D.; Patel, D.; Dharia, C.; Fromer, M.W.; Ahmed, S.; Frenkel, Y.; Vijayan, R.S.K.; Eck, J.T.; Ho, W.C.; Das, K.; et al. Detecting Allosteric Sites of HIV-1 Reverse Transcriptase by X-ray Crystallographic Fragment Screening. J. Med. Chem. 2013, 56, 2738–2746. [Google Scholar] [CrossRef] [Scilit]
  8. Lai, M.-T.; Feng, M.; Falgueyret, J.-P.; Tawa, P.; Witmer, M.; DiStefano, D.; Li, Y.; Burch, J.; Sachs, N.; Lu, M.; et al. In Vitro Characterization of MK-1439, a Novel HIV-1 Nonnucleoside Reverse Transcriptase Inhibitor. Antimicrob. Agents Chemother. 2014, 58, 1652–1663. [Google Scholar] [CrossRef] [Scilit]
  9. Kendall, J. Synthesis and Reactions of Pyrazolo[1,5-a]pyridines and Related Heterocycles. Curr. Org. Chem. 2011, 15, 2481–2518. [Google Scholar] [CrossRef] [Scilit]
  10. Kendall, J.; O’Connor, P.; Marshall, A.; Frederick, R.; Marshall, E.; Lill, C.; Lee, W.-J.; Kolekar, S.; Chao, M.; Malik, A.; et al. Discovery of Pyrazolo[1,5-a]pyridines as p110I+/--Selective PI3 Kinase Inhibitors. Bioorg. Med. Chem. 2012, 20, 69–85. [Google Scholar] [CrossRef] [Scilit]
  11. Legault, C.; Charette, A.B. Highly Efficient Synthesis of O-(2,4-Dinitrohenyl)hydroxylamine. Application to the Synthesis of Substituted N-Benzoyliminopyridinium Ylides. J. Org. Chem. 2003, 68, 7119–7122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Yamamoto, F.; Oae, S. Nucleophilic Substitution on Trivalent Nitrogen Atom. Menschutkin Type Reaction of O-2,4-Dinitrophenylhydroxylamine with Uncharged Nucleophiles. Bull. Chem. Soc. Jpn. 1975, 48, 77–79. [Google Scholar] [CrossRef] [Scilit]
  13. Schilz, M.; Plenio, H. A Guide to Sonogashira Cross-Coupling Reactions: The Influence of Substituents in Aryl Bromides, Acetylenes, and Phosphines. J. Org. Chem. 2012, 77, 2798–2807. [Google Scholar] [CrossRef] [Scilit]
  14. La, J.; Latham, C.F.; Tinetti, R.N.; Johnson, A.; Tyssen, D.; Huber, K.D.; Sluis-Cremer, N.; Simpson, J.S.; Headey, S.J.; Chalmers, D.K.; et al. Identification of mechanistically distinct inhibitors of HIV-1 reverse transcriptase through fragment screening. Proc. Natl. Acad. Sci. USA 2015, 112, 6979–6984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Singh, K.; Marchand, B.; Rai, D.K.; Sharma, B.; Michailidis, E.; Ryan, E.M.; Matzek, K.B.; Leslie, M.D.; Hagedorn, A.N.; Li, Z.; et al. Biochemical mechanism of HIV-1 resistance to rilpivirine. J. Biol. Chem. 2012, 287, 38110–38123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Cooper, M.A. Optical Biosensors in Drug Discovery. Nat. Rev. Drug. Discov. 2002, 1, 515–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Shepherd, C.A.; Hopkins, A.L.; Navratilova, I. Fragment Screening by SPR and Advanced Application to GPCRs. Prog. Biophys. Mol. Biol. 2014, 116, 113–123. [Google Scholar] [CrossRef] [Scilit]
  18. Patching, S.G. Surface Plasmon Resonance Spectroscopy for Characterisation of Membrane Protein–ligand Interactions and its Potential for Drug Discovery. BBA Biomembr. 2014, 1838, 43–55. [Google Scholar] [CrossRef] [Scilit]
  19. Schuck, P. Use of Surface Plasmon Resonance to Probe the Equilibrium and Dynamic Aspects of Interactions Between Biological Macromolecules. Annu. Rev. Biophys. Biomol. Struct. 1997, 26, 541–566. [Google Scholar] [CrossRef] [Scilit]
  20. Wilson, W.D. Analyzing Biomolecular Interactions. Science 2002, 295, 2103–2105. [Google Scholar] [CrossRef] [Scilit]
  21. Murray, C.W.; Rees, D.C. The Rise of Fragment-Based Drug Discovery. Nat. Chem. 2009, 1, 187–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Hopkins, A.L.; Groom, C.R.; Alex, A. Ligand Efficiency: A Useful Metric for Lead Selection. Drug. Discov. Today 2004, 9, 430–431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Congreve, M.; Chessari, G.; Tisi, D.; Woodhead, A.J. Recent Developments in Fragment-Based Drug Discovery. J. Med. Chem. 2008, 51, 3661–3680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Keserű, G.M.; Erlanson, D.A.; Ferenczy, G.G.; Hann, M.M.; Murray, C.W.; Pickett, S.D. Design Principles for Fragment Libraries: Maximizing the Value of Learnings from Pharma Fragment-Based Drug Discovery (FBDD) Programs for Use in Academia. J. Med. Chem. 2016, 59, 8189–8206. [Google Scholar] [CrossRef] [Scilit]
  25. Erlanson, D.A.; Fesik, S.W.; Hubbard, R.E.; Jahnke, W.; Jhoti, H. Twenty Years on: The Impact of Fragments on Drug Discovery. Nat. Rev. Drug Discov. 2016, 15, 605–619. [Google Scholar] [CrossRef] [Scilit]
  26. Kuroda, D.G.; Bauman, J.D.; Challa, J.R.; Patel, D.; Troxler, T.; Das, K.; Arnold, E.; Hochstrasser, R.M. Snapshot of the equilibrium dynamics of a drug bound to HIV-1 reverse transcriptase. Nat. Chem. 2013, 5, 174–181. [Google Scholar] [CrossRef] [Scilit]
  27. Moss, D.M.; Liptrott, N.J.; Curley, P.; Siccardi, M.; Back, D.J.; Owen, A. Rilpivirine inhibits drug transporters ABCB1, SLC22A1, and SLC22A2 in vitro. Antimicrob. Agents Chemother. 2013, 57, 5612–5618. [Google Scholar] [CrossRef] [Scilit]
  28. Kang, D.; Ruiz, F.X.; Sun, Y.; Feng, D.; Jing, L.; Wang, Z.; Zhang, T.; Gao, S.; Sun, L.; De Clercq, E.; et al. 2,4,5-Trisubstituted Pyrimidines as Potent HIV-1 NNRTIs: Rational Design, Synthesis, Activity Evaluation, and Crystallographic Studies. J. Med. Chem. 2021, 64, 4239–4256. [Google Scholar] [CrossRef] [Scilit]
  29. Geitmann, M.; Elinder, M.; Seeger, C.; Brandt, P.; de Esch, I.J.; Danielson, U.H. Identification of a novel scaffold for allosteric inhibition of wild type and drug resistant HIV-1 reverse transcriptase by fragment library screening. J. Med. Chem. 2011, 54, 699–708. [Google Scholar] [CrossRef] [Scilit]
  30. Smith, R.H.B.; Dar, A.C.; Schlessinger, A. PyVOL: A PyMOL plugin for visualization, comparison, and volume calculation of drug-binding sites. bioRxiv 2019. [Google Scholar] [CrossRef] [Scilit]
  31. Thammaporn, R.; Yagi-Utsumi, M.; Yamaguchi, T.; Boonsri, P.; Saparpakorn, P.; Choowongkomon, K.; Techasakul, S.; Kato, K.; Hannongbua, S. NMR characterization of HIV-1 reverse transcriptase binding to various non-nucleoside reverse transcriptase inhibitors with different activities. Sci. Rep. 2015, 5, 15806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Huo, Z.; Zhang, H.; Kang, D.; Zhou, Z.; Wu, G.; Desta, S.; Zuo, X.; Wang, Z.; Jing, L.; Ding, X.; et al. Discovery of Novel Diarylpyrimidine Derivatives as Potent HIV-1 NNRTIs Targeting the “NNRTI Adjacent” Binding Site. ACS Med. Chem. Lett. 2018, 9, 334–338. [Google Scholar] [CrossRef] [Scilit]
  33. Feng, D.; Zuo, X.; Jing, L.; Chen, C.H.; Olotu, F.A.; Lin, H.; Soliman, M.; De Clercq, E.; Pannecouque, C.; Lee, K.H.; et al. Design, synthesis, and evaluation of “dual-site”-binding diarylpyrimidines targeting both NNIBP and the NNRTI adjacent site of the HIV-1 reverse transcriptase. Eur. J. Med. Chem. 2021, 211, 113063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. National Center for Biotechnology Information. PubChem Compound Summary for CID 145979991. 2023. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/145979991 (accessed on 23 March 2023).
  35. Daina, A.; Michielin, O.; Zoete, V. SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules. Sci. Rep. 2017, 7, 42717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Chopra, A.; Bauman, J.D.; Ruiz, F.X.; Arnold, E. The Halo Library, a Tool for Rapid Identification of Ligand Binding Sites on Proteins Using Crystallographic Fragment Screening. bioRxiv 2022. [Google Scholar] [CrossRef] [Scilit]
  37. Le Grice, S.F.J.; GrÜNinger-Leitch, F. Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur. J. Biochem. 1990, 187, 307–314. [Google Scholar] [CrossRef] [Scilit]
  38. Shi, C.; Mellors, J.W. A recombinant retroviral system for rapid in vivo analysis of human immunodeficiency virus type 1 susceptibility to reverse transcriptase inhibitors. Antimicrob. Agents Chemother. 1997, 41, 2781–2785. [Google Scholar] [CrossRef] [Scilit]
  39. Mellors, J.W.; Bazmi, H.Z.; Schinazi, R.F.; Roy, B.M.; Hsiou, Y.; Arnold, E.; Weir, J.; Mayers, D.L. Novel mutations in reverse transcriptase of human immunodeficiency virus type 1 reduce susceptibility to foscarnet in laboratory and clinical isolates. Antimicrob. Agents Chemother. 1995, 39, 1087–1092. [Google Scholar] [CrossRef] [Scilit]
  40. Peden, K.; Emerman, M.; Montagnier, L. Changes in growth properties on passage in tissue culture of viruses derived from infectious molecular clones of HIV-1LAI, HIV-1MAL, and HIV-1ELI. Virology 1991, 185, 661–672. [Google Scholar] [CrossRef] [Scilit]
  41. Yap, S.-H.; Sheen, C.-W.; Fahey, J.; Zanin, M.; Tyssen, D.; Lima, V.D.; Wynhoven, B.; Kuiper, M.; Sluis-Cremer, N.; Harrigan, P.R.; et al. N348I in the Connection Domain of HIV-1 Reverse Transcriptase Confers Zidovudine and Nevirapine Resistance. PLoS Med. 2007, 4, e335. [Google Scholar] [CrossRef] [Scilit]
  42. Le Grice, S.F.J.; Cameron, C.E.; Benkovic, S.J. Purification and characterization of human immunodeficiency virus type 1 reverse transcriptase. Methods Enzymol. 1995, 262, 130–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Tyssen, D.; Henderson, S.A.; Johnson, A.; Sterjovski, J.; Moore, K.; La, J.; Zanin, M.; Sonza, S.; Karellas, P.; Giannis, M.P.; et al. Structure Activity Relationship of Dendrimer Microbicides with Dual Action Antiviral Activity. PLoS ONE 2010, 5, e12309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Yap, S.H.; Herman, B.D.; Radzio, J.; Sluis-Cremer, N.; Tachedjian, G. N348I in HIV-1 Reverse Transcriptase Counteracts the Synergy Between Zidovudine and Nevirapine. JAIDS J. Acquir. Immune Defic. Syndr. 2012, 61, 153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Bauman, J.D.; Das, K.; Ho, W.C.; Baweja, M.; Himmel, D.M.; Clark, A.D., Jr.; Oren, D.A.; Boyer, P.L.; Hughes, S.H.; Shatkin, A.J.; et al. Crystal engineering of HIV-1 reverse transcriptase for structure-based drug design. Nucleic Acids Res. 2008, 36, 5083–5092. [Google Scholar] [CrossRef] [Scilit]
  46. Winter, G.; McAuley, K.E. Automated data collection for macromolecular crystallography. Methods 2011, 55, 81–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Wojdyr, M.; Keegan, R.; Winter, G.; Ashton, A. DIMPLE—A pipeline for the rapid generation of difference maps from protein crystals with putatively bound ligands. Acta Crystallogr. Sect. A 2013, 69, s299. [Google Scholar] [CrossRef] [Scilit]
  48. Foadi, J.; Aller, P.; Alguel, Y.; Cameron, A.; Axford, D.; Owen, R.L.; Armour, W.; Waterman, D.G.; Iwata, S.; Evans, G. Clustering procedures for the optimal selection of data sets from multiple crystals in macromolecular crystallography. Acta Crystallogr. D Biol. Crystallogr. 2013, 69, 1617–1632. [Google Scholar] [CrossRef] [Scilit]
  49. Evans, P.R.; Murshudov, G.N. How good are my data and what is the resolution? Acta Crystallogr. D Biol. Crystallogr. 2013, 69, 1204–1214. [Google Scholar] [CrossRef] [Scilit]
  50. Smart, O.S.; Sharff, A.; Holstein, J.; Womack, T.O.; Flensburg, C.; Keller, P.; Paciorek, W.; Vonrhein, C.; Bricogne, G. Grade2 Version 1.3.0; Global Phasing Ltd.: Cambridge, UK, 2021. [Google Scholar]
  51. McCoy, A.J.; Grosse-Kunstleve, R.W.; Adams, P.D.; Winn, M.D.; Storoni, L.C.; Read, R.J. Phaser crystallographic software. J. Appl. Crystallogr. 2007, 40, 658–674. [Google Scholar] [CrossRef] [Scilit]
  52. Emsley, P.; Cowtan, K. Coot: Model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 2004, 60, 2126–2132. [Google Scholar] [CrossRef] [Scilit]
  53. Afonine, P.V.; Grosse-Kunstleve, R.W.; Echols, N.; Headd, J.J.; Moriarty, N.W.; Mustyakimov, M.; Terwilliger, T.C.; Urzhumtsev, A.; Zwart, P.H.; Adams, P.D. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr. D Biol. Crystallogr. 2012, 68, 352–367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.