Soybean Antigen Protein-Induced Intestinal Barrier Damage by Trigging Endoplasmic Reticulum Stress and Disordering Gut Microbiota in Weaned Piglets
Abstract
1. Introduction
2. Results and Discussion
2.1. 7S/11S Induced Growth Performance Loss and Allergy in Weaned Piglets
2.2. 7S/11S Altered the Cecal Microbiota Diversity and Composition of Weaned Piglets
2.3. 7S/11S Induced Intestinal ER Stress in Piglets
2.4. 7S/11S Impaired Autophagic Flux in Weaned Piglets
2.5. 7S/11S Induced Intestinal Barrier Damage in Piglets
3. Materials and Methods
3.1. Reagents and Antibodies
3.2. Animal Treatment and Sample Collection
3.3. Intestinal Permeability Assay
3.4. Histopathological Assay
3.5. qRT-PCR Assay
3.6. Western Blot Analysis
3.7. Cecal Microbiome Composition Analysis
3.8. Periodic Acid–Schiff (PAS) Staining
3.9. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Coleman, O.I.; Haller, D. ER Stress and the UPR in Shaping Intestinal Tissue Homeostasis and Immunity. Front. Immunol. 2019, 10, 2825. [Google Scholar] [CrossRef] [Scilit]
- Adolph, T.-E.; Niederreiter, L.; Blumberg, R.S.; Kaser, A. Endoplasmic reticulum stress and inflammation. Dig. Dis. 2012, 30, 341–346. [Google Scholar] [CrossRef] [Scilit]
- Kaser, A.; Blumberg, R.J. Endoplasmic reticulum stress and intestinal inflammation. Mucosal Immunol. 2010, 3, 11–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McGuckin, M.A.; Eri, R.D.; Das, I.; Lourie, R.; Florin, T.H. Intestinal secretory cell ER stress and inflammation. Biochem. Soc. Trans. 2011, 39, 1081–1085. [Google Scholar] [CrossRef] [Scilit]
- Vancamelbeke, M.; Vermeire, S. The intestinal barrier: A fundamental role in health and disease. Expert Rev. Gastroenterol. Hepatol. 2017, 11, 821–834. [Google Scholar] [CrossRef] [Scilit]
- Gu, Z.; Wu, Y.; Sun, H.; You, Y.; Piao, C.; Liu, J.; Wang, Y. Lactobacillus rhamnosus Granules Dose-Dependently Balance Intestinal Microbiome Disorders and Ameliorate Chronic Alcohol-Induced Liver Injury. J. Med. Food 2020, 23, 114–124. [Google Scholar] [CrossRef] [Scilit]
- McKenzie, C.; Tan, J.; Macia, L.; Mackay, C.R. The nutrition-gut microbiome-physiology axis and allergic diseases. Immunol. Rev. 2017, 278, 277–295. [Google Scholar] [CrossRef] [Scilit]
- Rook, G.A. Hygiene hypothesis and autoimmune diseases. Clin. Rev. Allergy Immunol. 2012, 42, 5–15. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Zhou, J.; Gober, H.-J.; Leung, W.T.; Huang, Z.; Pan, X.; Li, C.; Zhang, N.; Wang, L. Alterations in the intestinal microbiome associated with PCOS affect the clinical phenotype. Biomed. Pharmacother. 2021, 133, 110958. [Google Scholar] [CrossRef] [Scilit]
- He, L.; Han, M.; Qiao, S.; He, P.; Li, D.; Li, N.; Ma, X. Soybean Antigen Proteins and their Intestinal Sensitization Activities. Curr. Protein Pept. Sci. 2015, 16, 613–621. [Google Scholar] [CrossRef] [Scilit]
- Zheng, S.; Qin, G.; Tian, H.; Sun, Z. Role of soybean β-conglycinin subunits as potential dietary allergens in piglets. Vet. J. 2014, 199, 434–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Geng, F.; Wu, J.; Kou, Y.; Xu, S.; Sun, Z.; Feng, S.; Ma, L.; Luo, Y. Effects of β-conglycinin on growth performance, immunoglobulins and intestinal mucosal morphology in piglets. Arch. Anim. Nutr. 2014, 68, 186–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, C.L.; Ding, X.D.; Zhu, L.; He, M.C.; Shu, Y.S.; Zhang, Y.; Li, Y.; Wang, X.; Feng, S.; Li, J.; et al. β-Conglycinin-Induced Intestinal Porcine Epithelial Cell Damage via the Nuclear Factor κB/Mitogen-Activated Protein Kinase Signaling Pathway. J. Agric. Food Chem. 2019, 67, 9009–9021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, C.L.; Cao, C.M.; He, M.C.; Shu, Y.S.; Tang, X.; Wang, Y.H.; Zhang, Y.; Xia, X.D.; Li, Y.; Wu, J.J. Soybean Glycinin- and β-Conglycinin-Induced Intestinal Damage in Piglets via the p38/JNK/NF-κB Signaling Pathway. J. Agric. Food Chem. 2018, 66, 9534–9541. [Google Scholar] [CrossRef] [Scilit]
- Parrish, A.; Boudaud, M.; Kuehn, A.; Ollert, M.; Desai, M.S. Intestinal mucus barrier: A missing piece of the puzzle in food allergy. Trends Mol. Med. 2022, 28, 36–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiu, C.-Y.; Chang, K.-C.; Chang, L.-C.; Wang, C.-J.; Chung, W.-H.; Hsieh, W.-P.; Su, S.-C. Phenotype-specific signatures of systems-level gut microbiome associated with childhood airway allergies. Pediatr. Allergy Immunol. 2023, 34, e13905. [Google Scholar] [CrossRef] [Scilit]
- Osman, A.O.; Mahgoub, S.A.; Sitohy, M.Z. Preservative action of 11S (glycinin) and 7S (β-conglycinin) soy globulin on bovine raw milk stored either at 4 or 25 °C. J. Dairy Res. 2013, 80, 174–183. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Zhao, F.; Wang, Y.; Chen, J.; Tao, J.; Tian, G. Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome 2017, 5, 14. [Google Scholar] [CrossRef] [Scilit]
- Tang, Z.; Yang, Y.; Wu, Z.; Ji, Y. Heat Stress-Induced Intestinal Barrier Impairment: Current Insights into the Aspects of Oxidative Stress and Endoplasmic Reticulum Stress. J. Agric. Food Chem. 2023, 71, 5438–5449. [Google Scholar] [CrossRef] [Scilit]
- Pathinayake, P.S.; Waters, D.W.; Nichol, K.S.; Brown, A.C.; Reid, A.T.; Hsu, A.Y.; Horvat, J.C.; Wood, L.G.; Baines, K.J.; Simpson, J.L.; et al. Endoplasmic reticulum-unfolded protein response signalling is altered in severe eosinophilic and neutrophilic asthma. Thorax 2022, 77, 443–451. [Google Scholar] [CrossRef] [Scilit]
- Harding, H.P.; Calfon, M.; Urano, F.; Novoa, I.; Ron, D. Transcriptional and translational control in the Mammalian unfolded protein response. Annu. Rev. Cell Dev. Biol. 2002, 18, 575–599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, M.; Wilkinson, S. ER homeostasis and autophagy. Essays Biochem. 2017, 61, 625–635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silveira, J.S.; Antunes, G.L.; Kaiber, D.B.; Costa, M.S.; Ferreira, F.S.; Marques, E.P.; Schmitz, F.; Gassen, R.B.; Breda, R.V.; Wyse, A.S.; et al. Autophagy induces eosinophil extracellular traps formation and allergic airway inflammation in a murine asthma model. J. Cell Physiol. 2020, 235, 267–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pankiv, S.; Clausen, T.H.; Lamark, T.; Brech, A.; Bruun, J.A.; Outzen, H.; Øvervatn, A.; Bjørkøy, G.; Johansen, T. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J. Biol. Chem. 2007, 282, 24131–24145. [Google Scholar] [CrossRef] [Scilit]
- Bjørkøy, G.; Lamark, T.; Pankiv, S.; Øvervatn, A.; Brech, A.; Johansen, T. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 2009, 452, 181–197. [Google Scholar] [CrossRef] [Scilit]
- Shi, L.; Xun, W.; Peng, W.; Hu, H.; Hou, G. Effect of the single and combined use of curcumin and piperine on growth performance, intestinal barrier function, and antioxidant capacity of weaned wuzhishan piglets. Front. Vet. Sci. 2020, 7, 418. [Google Scholar] [CrossRef] [Scilit]
- Henrichs, B.S.; Brost, K.N.; Hayes, C.A.; Campbell, J.M.; Drackley, J.K. Effects of spray-dried bovine plasma protein in milk replacers fed at a high plane of nutrition on performance, intestinal permeability, and morbidity of holstein calves. J. Dairy Sci. 2021, 104, 7856–7870. [Google Scholar] [CrossRef] [Scilit]
- Harding, H.P.; Zhang, Y.; Ron, D. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 1999, 397, 271–274. [Google Scholar] [CrossRef] [Scilit]
- Urano, F.; Wang, X.; Bertolotti, A.; Zhang, Y.; Chung, P.; Harding, H.P. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000, 287, 664–666. [Google Scholar] [CrossRef] [Scilit]
- Rothe, M.; Sarma, V.; Dixit, V.M.; Goeddel, D.V. TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science 1995, 269, 1424–1427. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Chen, Y.P.; Li, Y.; Zhang, T.; Ying, Z.X.; Su, W.P.; Zhang, L.; Wang, T. L-Threonine improves intestinal mucin synthesis and immune function of intrauterine growth-retarded weanling piglets. Nutrition 2019, 59, 182–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]












| Item | Control | 7S | 11S |
|---|---|---|---|
| Initial weight/kg | 7.4 ± 0.86 | 7.15 ± 1.82 | 7.42 ± 1.46 |
| Average daily gain (ADG, kg/d) | 0.279 A | 0.15 B | 0.138 B |
| Feed:Gain (F/G) | 1.907 A | 3.46 B | 3.71 C |
| Items | Shannon Index | Simpson Index | Ace Index | Chao Index | Valid Sequences |
|---|---|---|---|---|---|
| Control | 4.04 ± 0.24 | 0.04 ± 0.08 a | 480.75 ± 104.44 | 484.69 ± 115.85 | 38,019.80 ± 2743.40 |
| 7S | 4.47 ± 0.37 a | 0.03 ± 0.01 a | 582.25 ± 92.97 a | 588.52 ± 87.44 a | 33,729.60 ± 3190.81 |
| 11S | 3.50 ± 0.58 b | 0.08 ± 0.04 b | 433.02 ± 97.24 b | 425.05 ± 114.33 b | 36,424.40 ± 4874.57 |
| Level | Classification | Control | 7S | 11S |
|---|---|---|---|---|
| Phylum | Firmicutes | 56.77 ± 19.11 | 61.71 ± 9.53 | 74.99 ± 12.09 |
| Bacteroidota | 36.99 ± 19.05 A | 26.99 ± 7.36 A | 9.08 ± 5.33 B | |
| Actinobacteriota | 1.87 ± 1.56 a | 2.77 ± 1.92 a | 14.50 ± 14.32 b | |
| Genus | Lactobacillus | 18.58 ± 8.03 a | 8.61 ± 3.94 | 5.95 ± 2.17 b |
| Prevotella | 20.07 ± 12.54 A | 9.95 ± 7.38 | 2.49 ± 1.67 B | |
| Collinsella | 1.56 ± 1.31 a | 2.21 ± 1.84 a | 11.91 ± 11.05 b | |
| Subdoligranulum | 1.82 ± 0.45 A | 2.58 ± 1.34 A | 10.91 ± 5.30 B | |
| Blautia | 5.42 ± 4.27 | 2.93 ± 2.97 | 3.65 ± 2.45 | |
| Faecalibacterium | 5.55 ± 4.95 | 2.29 ± 2.61 | 3.78 ± 2.80 | |
| Alloprevotella | 5.48 ± 6.20 | 3.36 ± 3.01 | 2.51 ± 3.80 |
| Items | Content | |
|---|---|---|
| Suckling (7–21 Day) | Weaned (21–28 Day) | |
| Ingredients, % | ||
| Corn | / | 60.85 |
| Dried whole milk | 46.00 | / |
| Skimmed milk powder | 42.20 | / |
| a Soybean meal(expanded) | / | 25.00 |
| Whey powder | 10.50 | 5.00 |
| Fish meal | / | 5.00 |
| CaHPO4 | / | 2.20 |
| Limestone | / | 0.69 |
| Wheat bran | / | 0.37 |
| Nacl | 0.30 | 0.25 |
| b Premixb | 1.00 | 0.49 |
| Choline chloride | / | 0.15 |
| Total | 100 | 100 |
| Nutrient levels | ||
| CP, % | 27.9 | 20.80 |
| Ca, % | 1.04 | 0.64 |
| TP, % | 0.89 | 0.51 |
| Lys, % | 1.61 | 1.06 |
| DE, MJ/kg | 14.5 | 13.50 |
| Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Product (bp) |
|---|---|---|---|
| GRP78 | GGCTCTACTCGCATCCCAAAG | CCTGAACAGCAGCACCGTAA | 115 |
| CHOP | CTTCACCACTCTTGACCCTG | CACTTTGTTTCCGTTTCCTG | 170 |
| p62 | CCCGCGTTCCCTACAAA | GGCTGAAACAGAAGCTGAAG | 181 |
| GAPDH | TGACCCCTTCATTGACCTCC | CCATTTGATGTTGGCGGGAT | 160 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Liu, Y.; Zhang, D.; Ding, H.; Feng, S.; Zhao, C.; Wu, J.; Wang, X. Soybean Antigen Protein-Induced Intestinal Barrier Damage by Trigging Endoplasmic Reticulum Stress and Disordering Gut Microbiota in Weaned Piglets. Molecules 2023, 28, 6500. https://doi.org/10.3390/molecules28186500
Wang L, Liu Y, Zhang D, Ding H, Feng S, Zhao C, Wu J, Wang X. Soybean Antigen Protein-Induced Intestinal Barrier Damage by Trigging Endoplasmic Reticulum Stress and Disordering Gut Microbiota in Weaned Piglets. Molecules. 2023; 28(18):6500. https://doi.org/10.3390/molecules28186500
Chicago/Turabian StyleWang, Lei, Yujia Liu, Daoliang Zhang, Hongyan Ding, Shibin Feng, Chang Zhao, Jinjie Wu, and Xichun Wang. 2023. "Soybean Antigen Protein-Induced Intestinal Barrier Damage by Trigging Endoplasmic Reticulum Stress and Disordering Gut Microbiota in Weaned Piglets" Molecules 28, no. 18: 6500. https://doi.org/10.3390/molecules28186500
APA StyleWang, L., Liu, Y., Zhang, D., Ding, H., Feng, S., Zhao, C., Wu, J., & Wang, X. (2023). Soybean Antigen Protein-Induced Intestinal Barrier Damage by Trigging Endoplasmic Reticulum Stress and Disordering Gut Microbiota in Weaned Piglets. Molecules, 28(18), 6500. https://doi.org/10.3390/molecules28186500

