The Antiproliferative Activity of Adiantum pedatum Extract and/or Piceatannol in Phenylhydrazine-Induced Colon Cancer in Male Albino Rats: The miR-145 Expression of the PI-3K/Akt/p53 and Oct4/Sox2/Nanog Pathways

Abstract

Colon cancer is one of the most common types of cancer worldwide, and its incidence is increasing. Despite advances in medical science, the treatment of colon cancer still poses a significant challenge. This study aimed to investigate the potential protective effects of Adiantum pedatum (AP) extract and/or piceatannol on colon cancer induced via phenylhydrazine (PHZ) in terms of the antioxidant and apoptotic pathways and histopathologic changes in the colons of male albino rats. The rats were randomly divided into eight groups: control, AP extract, piceatannol (P), PHZ, PHZ and AP treatments, PHZ and P treatments, PHZ and both AP and P, and PHZ and prophylaxis with both AP and P. The results demonstrated that PHZ induced oxidative damage, apoptosis, and histopathological changes compared to the control group. However, the administration of AP or P or AP + P as therapy or prophylaxis significantly ameliorated these changes and upregulated the colonic mir-145 and mRNA expression of P53 and PDCD-4 while downregulating the colonic mRNA expression of PI3K, AKT, c-Myc, CK-20, SOX-2, OCT-4, and NanoG compared to the PHZ group. These findings suggest that the candidate drugs may exert their anti-cancer effects through multiple mechanisms, including antioxidant and apoptotic activities.

1. Introduction

Cancer, the uncontrolled growth of abnormal cells, can occur in any part of the body and can be classified based on the type of cell that initially undergoes transformation. The pathophysiology of cancer involves the disruption of normal cellular processes, leading to the uncontrolled growth and spread of abnormal cells to nearby tissues and distant organs as their main cause of death [1]. Colorectal cancer is the third most common cancer worldwide and the second leading cause of cancer-related deaths [2,3]. Oxidative stress, which results from an imbalance between reactive oxygen species (ROS) and antioxidant defenses, has been implicated in cancer development and progression [4]. ROS can cause damage to cellular components such as DNA, proteins, and lipids, leading to mutations and alterations that promote cancer development [5]. Additionally, ROS can activate signaling pathways that promote cell proliferation and survival and inhibit apoptosis. These enzymes, such as superoxide dismutase (SOD), catalase, and glutathione peroxidase, help to neutralize ROS and protect cells from damage [6]. However, in cancer, the expression and activities of antioxidant enzymes are often dysregulated, leading to an imbalance between the production of ROS and antioxidant defenses. Oxidative stress is a critical factor that contributes to the initiation and progression of the disease. Cancer cells often produce higher levels of ROS than normal cells, which can cause DNA damage and mutations that promote tumor growth [7].

Apoptosis, or programmed cell death, plays a critical role in maintaining tissue homeostasis and preventing the development of cancer [8]. The initiation of apoptosis involves two fundamental signaling pathways. The first of these is the extrinsic pathway, which is triggered by external stimuli and involves the activation of death receptors on the surfaces of cells when their pro-apoptotic ligands are bound. The extrinsic pathway typically also activates the intrinsic pathway, and both pathways result in the recruitment and activation of cysteine-aspartic acid proteases (caspases) [9]. Cytotoxic substances, DNA damage, a lack of growth factors, and oxidative stress are some of the intracellular stimuli that can activate the intrinsic (or mitochondrial) route [10], which is regulated by the Bcl-2 family of proteins and mitochondria [11] and characterized by the release of mitochondrial cytochrome c (cyt-c) [12]. Cytochrome c then leads to caspase-3 cleavage, endonuclease activation, and ultimately nuclear DNA fragmentation, which is the hallmark of apoptosis [13]. The Bax protein appears to be necessary for the proper induction of apoptosis, whereas the overexpression of the Bcl-2 protein is thought to reduce the likelihood of apoptosis [14]. The dysregulation of apoptosis can contribute to cancer development and progression by allowing the survival and proliferation of abnormal cells. Apoptosis can be triggered by a variety of signals, including oxidative stress, DNA damage, and the activation of death receptors. Therapeutic strategies that target apoptotic pathways are being developed as potential treatments for cancer.

The tumor suppressor gene TP53, a component of the mitochondrial apoptotic pathway, is a key regulator of cell cycle control and apoptosis. P53 mutations in tumor cells impair the ability to trigger apoptosis. Its expression is limited and downregulated [15]. Several molecular pathways are involved in cancer growth and metastasis; PI3K/AKT pathway activation has been recorded to improve tumorigenesis, metastasis, the epithelium–mesenchymal transition, and the drug resistance of cancer cells [16] via upregulating the expression of c-MYC, which increases the growth, differentiation, invasion, and chemotherapy drug resistance of cancer cells [17]. c-MYC is a key regulator of cell growth and differentiation, and in normal cells, its level of expression is very low. On the contrary, in cancer cells, it displays a sharp upregulation in it is expression subsequent to the activation of the PI3K/AKT pathway [17]. On the other hand, the upstream regulation of c-MYC negatively affects the expression of the tumor suppressor gene P53, promoting cancer cell proliferation and invasion [18]. On the same basis, programmed cell death 4 (PDCD-4) is one of the tumor suppressor genes that halts cancer cells’ growth and metastasis and is often reported to be downregulated in many cancer types that lead to tumor progression, promotion, and proliferation [19]. Thereby, the above-mentioned signaling pathways play critical roles in cancer cell progression or apoptosis. Reasonably, the suppression of the PI3K/AKT pathway could potentially inhibit c-MYC activation and upregulate the expression of the tumor suppressor genes (P53 and PDCD-4) [20].

Several microRNA molecules control the expression of the PI3K/AKT/c-MYC/P53-PDCD-4 signaling pathway; these types of regulation include the activation or suppression of the PI3K/AKT pathway [21]. MicroRNAs (miRNAs) are small, non-coding RNA molecules that play important roles in gene regulation. The dysregulation of miRNA expression has been implicated in the development and progression of many diseases, including cancer [22]. In cancer, altered miRNA expression can contribute to oncogenesis by promoting cell proliferation, inhibiting apoptosis, and enhancing angiogenesis and metastasis [23]. However, miRNAs can also act as tumor suppressors by targeting oncogenes or by regulating cell differentiation and senescence [22,23]. The discovery of the role of miRNAs in cancer has led to growing interest in their potential as therapeutic targets. The ability of miRNAs to modulate multiple genes in a coordinated manner makes them attractive targets for cancer therapy [22,23]. miRNA-based therapeutics can be designed to restore the expression of tumor suppressor miRNAs or inhibit the expression of oncogenic miRNAs. In addition, miRNAs can be used as biomarkers for cancer diagnosis, prognosis, and predicting therapeutic response. Among these microRNAs is mir-145, which is considered a tumor suppressor microRNA that acts via the downstream regulation of the PI3K/AKT/c-MYC pathway, hence improving the expression of PDCD-4 and P53, which halt cancer progression and proliferation [24].

Several stemnesses and proliferating markers have recently been implicated in the scoring of cancer cells’ activity and progression, such as Sox2, Nanog, OCT3/4, and ki67, which reflect the proliferating potency and aggressiveness of cancer cells as higher levels of expression of these markers indicate a bad prognosis and higher degrees of cancer invasion and metastasis [25]. Sox2, Nanog, and OCT3/4 are embryonic transcriptional factors [26]. Also, the Ki-67 protein is a popular proliferation marker for human tumor cells [27]. It exists in each of the cell cycle’s active phases (G1, S, G2, and M) but not in the resting phase (G0) [28]. It participates in the progression of the cell cycle in both interphase and mitotic cells [29]. As an indicator of tumor aggressiveness, the expression of the Ki-67 protein (pKi67) is linked to the proliferative activities of intrinsic cell populations in malignant tumors [30]. Carcinogens seem to play a possible role in causing molecular changes in oncogenes or suppressor genes that will cause the cells to proliferate more than their normal borders.

Despite advances in cancer treatments, the side effects and limited efficacy of conventional therapies have led to increased interest in alternative and complementary approaches. Piceatannol (P), a naturally occurring polyphenol found in various plant sources such as grapes, passion fruit, and white tea, has 11 times the scavenging activity against peroxyl radicals than its parent resveratrol and enhanced the protective effect against DNA damage brought on by •OH radicals [31]. It is effective at scavenging lipid peroxyl radicals [32]. It has a proapoptotic impact on cancer cells. It has been shown to inhibit the growth and proliferation of colon cancer cells by inducing apoptosis (programmed cell death) and cell cycle arrest. Piceatannol has also been shown to suppress the activity of various signaling pathways involved in cancer cell survival and growth, such as the PI3K/Akt and Wnt/β-catenin pathways. Its proapoptotic action might be attributed to mitochondrial potential loss, cytochrome C release, and caspase activation [33]. Recently, its anticancer properties were proven, which operate via targeting tumor-associated macrophages and TGF-β/apoptosis-signaling pathways that limit cancer growth and metastasis, especially in colon and colorectal cancers [34,35,36].

One such approach is the use of plant extracts, which have been used for centuries in traditional medicine to treat a variety of ailments [37]. Plant extracts contain a diverse array of bioactive compounds, including polyphenols, flavonoids, alkaloids, and terpenoids, which have been shown to have anticancer properties [31,32,33]. These compounds can target various molecular pathways involved in cancer development and progression, including cell proliferation, apoptosis, angiogenesis, and metastasis [38,39]. Several plant extracts have shown potential as anticancer agents in preclinical studies and clinical trials. For example, extracts from turmeric (Curcuma longa), green tea (Camellia sinensis), and ginseng (Panax ginseng) have been shown to have anticancer effects in vitro and in vivo and have been the subjects of clinical trials in cancer patients [40]. Other plant extracts, such as those from garlic (Allium sativum), ginger (Zingiber officinale), and milk thistle (Silybum marianum), have also been shown to have anticancer properties [41].

The genus Adiantum pedatum L. belongs to the Pteridaceae family and is a delicate and elegant fern species often known as the northern maidenhair fern. Traditional medicine has regularly used Adiantum pedatum for its numerous health advantages. It was previously used to treat several afflictions like sore throat, kidney stones, and hepatic insufficiency and to control wound bleeding [42]. Some pteridophytes have been shown to have anticancer properties, but not against a specific kind of cancer. Asplenium rutamuraria has phenolic compounds as anticancer agents [43]. Meanwhile, Pteridium aquilinum’s extract is a potent source of anticancer compounds, and Equisetum hyemale induced G2/M arrest and cell apoptosis. However, the anticancer effects of this plant and its bioactive compounds still have not been investigated. Moreover, in-depth studies are needed to completely understand the mechanisms underlying the Adiantum pedatum extract’s anti-cancer activities and to evaluate its potential therapeutic uses.

Thus, the present study was designed to investigate the antiproliferative activity of an Adiantum pedatum extract against chemically induced colon cancer in rats and address the implication of the mir-145/PI3K/AKT/c-MYC/PDCD-4—P53 signaling pathway in either the curative or prophylactic effect of the extract in comparison to a recently validated anticancer bioactive compound, piceatannol. This study also investigated the possible therapeutic synergism of combining the AP extract with piceatannol against rat colon cancer.

2. Results

2.1. Phytochemical Screening of AP Extract

The run time of a GC-Mass screening of the AP extract was 45 min. The GC-Mass phytochemical screening of the AP extract was carried out with the use of the National Institute Standard and Technology (NIST)’s mass spectral library (National Institute of Standards and Technology, Gaithersburg, MD, USA) [44,45]. The screened unknown compounds’ spectra were matched to the NIST-recorded known spectra, revealing 20 bioactive chemicals (

Table 1. GC-Mass analysis report for the AP extract.

Bioactive Compounds	RT	Area%	MF	MW	Formula	Activity—Based on the Previous Literature	References
à-D-GLUCOPYRANOSIDE, METHYL	21.36	1.68	739	331	C13H26BNO6Si	Anticancer Antioxidant	[46,47]
5,8,11,14-Eicosatetraynoic acid, TMS derivative	21.36	9.68	707	368	C23H32O2Si	Anticancer	[48]
Dasycarpidan-1-methanol, acetate	21.36	12.68	713	326	C20H26N2O2	Anticancer	[49]
Traumatic acid, (E)-, 2TMS derivative	22.74	0.69	710	372	C18H36O4Si2	Anticancer Antioxidant	[50]
Panaxydol, TMS	22.6	11.25	694	332	C20H32O2Si	Anticancer	[51]
2-Oleoylglycerol, 2TMS derivative	22.88	0.36	731	500	C27H56O4Si2	Antioxidant	[52]
MANNOFURANOSIDE, METHYL 2,3,5,6-TETRAKIS-O-(TRIMETHY LSILYL)-, à-D-	23.31	8.56	772	482	C19H46O6Si4	Anticancer Antimicrobial Antioxidant	[53]
Uridine, 3TMS derivative	23.31	7.56	717	460	C18H36N2O6Si3	Anticancer	[54]
á-D-GALACTOPYRANOSIDE, METHYL	23.07	15.38	734	362	C14H31BO6Si2	Anticancer	[55]
Methyl à-D-glucofuranoside, 4TMS derivative	24.43	2.5	836	482	C19H46O6Si4	Anticancer	[56]
D-(-)-Tagatofuranose,pentakis(trimethylsilyl) ether (isomer1)	24.77	8.77	765	540	C21H52O6Si5	Antioxidant	[57]
D-(-)-Fructofuranose, pentakis(trimethylsilyl) ether (isomer2)	24.82	8.91	782	540	C21H52O6Si5	Antioxidant Anti-inflammatory	[58]
D-Psicofuranose, pentakis(trimethylsilyl) ether (isomer1)	24.82	10.91	777	540	C21H52O6Si5	Antioxidant anticancer	[58]
1,5-Anhydrohexitol, 4TMS derivative	25.44	9.97	797	452	C18H44O5Si4	Antioxidant	[59]
á-DL-ARABINOPYRANOSE, 1,2,3,4-TETRAKIS-O-(TRIMETHY LSILYL)-	25.44	8.97	807	438	C17H42O5Si4	Antioxidant anticancer	[60]
MANNOONIC ACID, 2,3,5,6-TETRAKIS-O-(TRIMETHY LSILYL)-, LACTONE	26.2	6.2	728	466	C18H42O6Si4	Antioxidant anticancer	[61]
Dulcitol, 6TMS derivative	27.72	6.27	759	614	C24H62O6Si6	Anti-inflammatory Anticancer	[62]
D-Sorbitol, 6TMS derivative	27.72	6.27	752	614	C24H62O6Si6	Antioxidant	[63]
BUTANAL, 2,3,4-TRIS[(TRIMETHYLSILYL)O XY]-, (R*,R*)-	27.72	6.27	870	336	C13H32O4Si3	Antioxidant anticancer	[64]
L-Fucitol, 5TMS derivative	27.72	6.27	752	526	C21H54O5Si5	Antioxidant anticancer	[65]

MF; a matching factor or a direct match. It is a comparison of the unknown mass spectrum’s peaks to those of the peaks in the library’s spectra. This number, therefore, is an indication of how similar the unknown spectrum is to the library’s known spectra. The suggested general guidelines of the National Institute of Standards and Technology (NIST) for match factor scores are as follows: >900 is an excellent match, 800–900 is a good match, 700–800 is a fair match, and <600 is a poor match. RT; retention time, MW; molecular weight.

and Figure 1).

2.2. Oxidative Stress Markers

As shown in

Table 2. Effects of different treatments on oxidative stress markers (MDA, PC, and NO) in the colons of male albino rats.

Groups	MDA	PC	NO
Control	12.12 ± 0.351 d	0.837 ± 0.035 cd	0.625 ± 0.027 c
AP	11.38 ± 0.756 d	0.773 ± 0.026 d	0.644 ± 0.626 c
P	12.00 ± 0.425 d	0.787 ± 0.223 d	0.740 ± 0.040 c
PHZ	33.183 ± 1.359 a	3.152 ± 0.078 a	5.183 ± 0.252 a
PHZ + AP	18.88 ± 1.339 bc	1.830 ± 0.044 b	0.756 ± 0.110 c
PHZ + P	21.37 ± 1.644 b	1.732 ± 0.026 b	0.752 ± 0.045 c
PHZ + AP + P	19.45 ± 1.981 b	1.728 ± 0.030 b	1.120 ± 0.102 b
PHZ + AP + P (Prophylaxis)	16.37 ± 1.620 c	1.163 ± 0.032 c	0.820 ± 0.028 c

Data are presented as means ± SEMs. ^a,b,c,d Different superscript letters indicate a significant difference (p < 0.05).

, for malondialdehyde (MDA), protein carbonyl (PC), and nitric oxide (NO) levels, the administration of AP or P did not induce any significant change in colon tissue when compared with the control group. On the other hand, the PHZ group showed a significant increase in MDA, PC, and NO levels when compared with the control group, while the PHZ + AP, PHZ + PIC, PHZ + AP + P, and prophylaxis groups showed significantly reduced levels of oxidative stress markers when compared with the PHZ group.

2.3. Antioxidant Markers

As shown in

Table 3. Effects of different treatments on antioxidant enzymes (SOD, CAT, GST, GSH, GPx, and TAC) in the colons of male albino rats.

Groups	SOD	CAT	GST	GSH	GPx	TAC
Control	459.17 ± 12.21 a	11.80 ± 0.52 a	12.40 ± 0.57 a	11.17 ± 0.32 a	31.50 ± 0.52 a	5.13 ± 0.39 a
AP	456.00 ± 12.37 a	10.28 ± 1.07 a	14.14 ± 0.59 a	10.82 ± 0.58 a	32.36 ± 2.71 a	4.24 ± 0.94 ab
P	468.17 ± 14.71 a	11.42 ± 0.31 a	12.97 ± 0.17 a	10.94 ± 0.19 a	27.67 ± 0.88 b	5.23 ± 0.39 a
PHZ	224.83 ± 9.46 c	3.29 ± 0.77 c	4.88 ± 0.42 c	4.11 ± 0.63 b	3.88 ± 0.56 d	0.52 ± 0.12 c
PHZ + AP	401.00 ± 24.75 ab	6.86 ± 0.71 b	10.00 ± 0.91 ab	8.48 ± 0.59 a	16.34 ± 2.17 c	3.78 ± 0.30 b
PHZ + P	419.83 ± 15.56 ab	9.12 ± 0.52 a	8.66 ± 0.64 b	8.50 ± 0.46 a	27.82 ± 1.65 b	3.58 ± 0.24 b
PHZ + AP + P	386.00 ± 17.89 b	9.90 ± 0.33 a	9.39 ± 0.43 ab	8.28 ± 0.88 a	29.68 ± 1.70 ab	4.83 ± 0.34 a
PHZ + AP + P (Prophylaxis)	429.17 ± 20.27 ab	10.47 ± 0.47 a	11.48 ± 0.41 ab	9.65 ± 0.67 a	32.20 ± 1.72 a	4.30 ± 0.30 ab

Data are presented as means ± SEMs. ^a,b,c,d Different superscript letters indicate a significant difference (p < 0.05).

, the administration of AP and P did not induce any significant change in GSH, SOD, CAT, GPx, and TAC levels when compared with the control group, but AP administration induced a significant increase in the GST level when compared with the control group. The PHZ group showed significant decreases in all antioxidant levels when compared with the control group. The PHZ + AP, PHZ + PIC, PHZ + AP + P, and prophylaxis groups showed significantly increased levels of GSH, GST, SOD, CAT, GPx, and TAC when compared with the PHZ group.

2.4. mir-145 and mRNA Expression of PI3K, AKT, P53, c-Myc, and PDCD-4

PHZ + AP, PHZ + P, PHZ + AP + P, and prophylaxis significantly upregulated the colonic mir-145 and mRNA expression of P53 and PDCD-4 compared to the administration of PHZ to rats (Figure 2A,D,F). The administration of AP or P or AP + P as therapy or prophylaxis in PHZ-induced colorectal cancer significantly downregulated the colonic mRNA expression levels of PI3K, AKT, and c-Myc compared to the PHZ group (Figure 2B,C,E).

2.5. Apoptotic and Antiapoptotic Proteins

The AP and P groups showed significant increases in p53, Bax, and Caspase-3 levels compared to the control group, as shown in Figure 3A–C, Figure 4A–C and Figure 5A–C). The administration of PHZ induced significant decreases in p53, caspase 3, and Bax levels compared to the control group, as shown in Figure 3D, Figure 4D and Figure 5D). The PHZ + AP, PHZ + P, PHZ + AP + P, and prophylaxis groups showed significantly increased p53, caspase 3, and Bax levels compared to the PHZ group, as shown in Figure 3E–H, Figure 4E–H and Figure 5E–H). The AP and P groups showed significant decreases in Bcl-2 compared to the control group, as shown in Figure 6A–C. The administration of PHZ induced a significant increase in Bcl-2 level compared to the control group, as shown in Figure 6D. The PHZ + AP, PHZ + P, PHZ + AP + P, and prophylaxis groups showed significant decreases in Bcl-2 level compared to the PHZ group, as shown in Figure 6E–H.

2.6. Immunohistochemical Analysis of P53

The control, AP, and P groups revealed characteristic low levels of nuclear P53 expression (Figure 7A–C,I). Figure 7D,I depict the robust nuclear expression of P53 in the PHZ-induced colon cancer group compared to the control group. Nevertheless, treatment with AP and P alone or in combination, as well as the prophylactic approach with PHZ, significantly reduced the expression of the P53 protein (Figure 7E–I).

2.7. mRNA Expression of CK-20, SOX-2, OCT-4 and NanoG

The administration of AP or P or AP + P as therapy or prophylaxis in PHZ-induced colorectal cancer significantly downregulated the colonic mRNA expression of CK-20, SOX-2, OCT-4, and NanoG compared to the PHZ group (Figure 8A–D).

2.8. Immunohistochemical Analysis of Ki-67

An immunohistochemical analysis of Ki-67 in the colons of various groups revealed distinct Ki-67 immunostaining patterns. The colon sections of the control, AP, and P groups exhibited moderate Ki-67 expression (Figure 9A–C,I). In contrast, a large number of strongly stained positive nuclei were observed in the colon sections of rats treated with PHZ, indicating a robust expression of the Ki-67 protein (Figure 9D,I). Nevertheless, treatment with AP and P alone or in combination, as well as the prophylactic approach, substantially decreased the expression of the Ki-67 protein compared to the PHZ group (Figure 9E–I).

2.9. Histopathological Results

The colons of the control rats displayed normal mucosae composed of regular arrangements of intestinal glands (Ig) or colonic crypts rich in goblet cells (arrows), secreting mucin and with normal basal nuclei; these highly glycosylated proteins are the major components of the mucous layer that lubricates and protects the gastrointestinal tract. The mucosa is also lined with columnar epithelia and has lamina propria between the intestinal glands. Figure 10A,B demonstrate that the intestinal crypts are followed by muscularis mucosae (mm) and then submucosae (sm). The rats administered the AP extract exhibited normal mucosae with normally arranged intestinal glands, followed by the mm and sm, Figure 10C. The colon of a normal rat treated with P demonstrated a normal mucosa (M) with normally arranged intestinal glands, followed by a thin muscularis mucosa (mm) and submucosa (sm), and as demonstrated, the intestinal glands descended deeply into the submucosa, Figure 10D. A PHZ-treated rat colon displayed the mucosa, submucosa, and muscle layers. The mucosa exhibited marked dysplasia and an abnormal and irregular arrangement of intestinal glands (Ig) with hyperchromatic nuclei, some of which shared cell walls; the architecture was severely disrupted, and necrotic areas were also expanded. Necrosis could be observed in a number of malignant neoplastic glands. The muscularis mucosae was disrupted and disorganized, and intestinal glands diffused into the submucosa, generating tumor cell clusters associated with leucocytic cell infiltration (Figure 10E–G). The colon of a diseased animal revived with AP demonstrated a decrease in dysplastic changes within the intestinal glands, a marked improvement in the histopathological examination via H&E stains, and an improvement in the architecture of the crypts, which were lined with a columnar epithelium with minor size variations. The muscularis mucosae was restored to a thin layer, and there were fewer leucocytic cells in the submucosa, Figure 10H. The colons of diseased animals cured via P demonstrated decreases in intestinal dysplasia alterations (Figure 10I). Figure 10J demonstrates that the architecture of the crypts in the colon of a diseased animal revived with AP and P was significantly improved. The colons of diseased animals revived with AP and P (prophylaxis) demonstrated mitigations of the deleterious effects of PHZ, successfully suppressed tumor progression, and marked improvements in tissue sections, which may be attributed to the synergistic suppression effect of AP when combined with P (Figure 10K).

3. Discussion

Colorectal cancer (CRC) is a major cause of cancer-related deaths worldwide. Moreover, several epidemiological studies have linked the consumption of red meat with an increased risk of CRC [2,66]. For example, a meta-analysis showed that the consumption of red meat was associated with a 12% increase in the risk of CRC per 100 g per day of consumption [66]. Moreover, a study showed that the consumption of red meat was associated with an increased risk of CRC in both men and women [67]. Several potential mechanisms have been proposed to explain the link between red meat consumption and the CRC risk [66]. One such mechanism is the production of carcinogenic compounds during the cooking process. When meat is cooked at high temperatures, such as through grilling or frying, it can produce heterocyclic amines (HCAs) and polycyclic aromatic hydrocarbons (PAHs), which are known carcinogens [68]. These compounds have been shown to induce mutations in key oncogenes and tumor suppressor genes, leading to the development of CRC. Another potential mechanism underlying the link between red meat consumption and CRC risk is meat’s high content of heme iron [69]. It has been suggested that a high intake of heme iron may promote the development and progression of CRC through a variety of mechanisms, including the production of reactive oxygen species and the upregulation of pro-inflammatory cytokines [70]. Further research is needed to better understand the complex molecular mechanisms underlying the development and progression of CRC, as well as the potential link between red meat consumption and the risk of CRC. This knowledge can be used to develop more effective prevention and treatment strategies for CRC. In the meantime, individuals can reduce their risk of developing CRC by adopting a healthy lifestyle, including a balanced diet that is rich in fruits and vegetables and low in red and processed meats, exercising regularly, and avoiding smoking and excessive alcohol consumption.

A variety of plants and their bioactive substances have anti-carcinogenic and anti-proliferative effects on colon cancer cells [71]. Studies have also shown a positive correlation between plants’ antioxidant activities and their anti-proliferative properties, indicating that antioxidants may act to slow the growth of cancer cells. For instance, flavonoids exhibit a variety of biological properties, such as cytoprotective properties, and several of them are known to have anti-cancer properties [72]. The present study evaluates the protective roles of both AP and P on colon cancer induced via PHZ. In this study, using PHZ caused elevations in MDA, NO, and PC levels as oxidative stress markers, while MDA, NO, and PC levels significantly decreased in the AP and P with PHZ groups. Also, PHZ caused a decline in all antioxidant levels (SOD, CAT, GST, GSH, and TAC); on the other hand, groups treated with AP and P and PHZ showed significant increases in all antioxidant levels. PHZ intoxication in rats can lead to DNA fragmentation, oxidative DNA damage, and the development of tumors [73]. PHZ causes oxidative stress, which raises ROS such as MDA, which is a lipid peroxidation metabolite; it also lowers antioxidant status [74]. It increased PC and reduced GSH [75]. Plasma PC levels have been associated with the etiology of colorectal cancer [76]. The administration of PHZ led equally to significant reductions in the activities of the enzymes SOD, CAT, and GPx [77]. In the present study, PHZ caused a significant increase in reactive radical NO levels, and these results are in line with Aloke et al. [78], who showed that PHZ caused significant increases in MDA and NO levels as oxidative markers and significant decreases in SOD, CAT, and GSH as antioxidant markers. The excess production of NO causes DNA damage and inhibits DNA repair proteins [79]. Similarly, the levels of NO have been shown to be higher in CRC patients compared to healthy controls [80]. P is a resveratrol metabolite that is regarded as a powerful antioxidant and cytoprotectant due to its significant ability to suppress ROS [81]. P significantly increased the levels of the antioxidants SOD and CAT, it reduced the amounts of the lipid peroxides LPO and NO, which are indicators of mitochondrial oxidative stress [82], and it caused a significant induction of the total antioxidant capacity TAC [81]. Thus, the anti-oxidative property of P may be involved in its anti-invasive action [83]. P inhibits the production of ROS and reduces oxidative stress, exhibiting anti-oxidant and anti-inflammatory effects [84]. P significantly increased GSH levels and decreased lipid peroxidation, according to Wahdan et al. [85]. Interestingly, the antioxidant and anti-cancer activities of the AP extract could be attributed to the bioactive compounds which were identified via GC-MASS spectra and investigated previously for their antioxidant and anticancer activities, such as Methyl α-D-glucopyranoside [46,47], 5,8,11,14-Eicosatetraynoic acid TMS derivative [48], Dasycarpidan-1-methanol, acetate [49], Traumatic acid, (E)-, 2TMS derivative [50], Panaxydol, TMS [51], 2-Oleoylglycerol, 2TMS derivative [52], alpha-D-Mannopyranoside, methyl 2,3,5,6-tetrakis-O-(trimethylsilyl) [53], Uridine, 3TMS derivative [54], Methyl alpha-D-galactopyranoside [55], Methyl à-D-glucofuranoside, 4TMS derivative [56], D-(-)-Tagatofuranose,pentakis (trimethylsilyl) ether [57], D-(-)-Fructofuranose, pentakis(trimethylsilyl) ether [58], D-Psicofuranose, pentakis(trimethylsilyl) ether [58], 1,5-Anhydrohexitol, 4TMS derivative [59], α- DL- Arabinopyranose, 1,2,3,4- tetrakis-O-(trimethylsilyl) [60], Mannoonic acid, 2,3,5,6-tetrakis-O-(trimethylsilyl)-, lactone [61], Dulcitol, 6TMS derivative [62], D-Sorbitol, 6TMS derivative [63], Butanal, 2,3,4-tris[(trimethylsilyl)oxy]-3-[[(trimethylsilyl)oxy]methyl]-[64], L-Fucitol, and 5TMS derivative [65].

The molecular mechanisms underlying CRC development and progression are numerous and complex [86]. CRC is a complex disease that involves the accumulation of genetic and epigenetic alterations in key oncogenes and tumor suppressor genes [86,87]. These alterations lead to the dysregulation of several signaling pathways, including the Wnt/β-catenin, PI3K/Akt/mTOR, and MAPK/ERK pathways, among others [88]. These pathways regulate a wide range of cellular processes, including cell proliferation, differentiation, and apoptosis. The dysregulation of these pathways can lead to uncontrolled cell growth and the development of CRC. One such mechanism is the Nrf2 antioxidant response, which plays a key role in protecting cells from oxidative stress and other forms of cellular damage [89]. Nrf2 is a transcription factor that plays a key role in protecting cells from oxidative stress and other forms of cellular damage. Under normal conditions, Nrf2 is sequestered in the cytoplasm by the protein Keap1 [90]. However, when cells are exposed to oxidative stress or other forms of cellular damage, Nrf2 is released from Keap1 and translocates to the nucleus, where it activates the expression of antioxidant enzymes and other cytoprotective proteins. The Nrf2 antioxidant response has been shown to play a key role in protecting cells from oxidative damage and promoting cell survival. However, recent studies have suggested that the Nrf2 antioxidant response may also play a role in CRC development and progression [91,92]. Several studies have suggested that the Nrf2 antioxidant response may be involved in CRC development and progression. For example, a study showed that Nrf2 activation promotes the growth and survival of CRC cells [93]. Another study showed that Nrf2 activation may promote CRC metastasis [91]. MicroRNAs (miRNAs) are a large family of short (19–22 nucleotide), endogenous RNAs that adversely affect the expression of target genes by cleaving mRNA or via translation inhibition [94]; depending on the target, they can operate as oncogenes or tumor suppressors. miR-145 is a p53-regulated tumor suppressor that has been discovered to be downregulated in colorectal cancer and other malignancies [95,96]. It modulates cancer stem cell stemness and pluripotency by targeting many embryonic transcriptional factors that enhance the oncogenic activity of metastatic cancers, including OCT4, SOX2, NanoG, and KLF4 [95]. miR-145 is a p53-controlled gene. In response to DNA damage, p53 can stimulate transcription and improve the post-transcriptional maturation of the miR-143/miR-145 cluster [96,97] via interacting with the Drosha processing complex [98]. The Ras-responsive element-binding protein (RREB1), which represses the miR-143/145 promoter, can inhibit miR-143/145 cluster transcription [99]. In our study, PHZ + AP, PHZ + P, PHZ + AP + P, and prophylaxis significantly upregulated the colonic mir-145 and mRNA expression levels of P53 and PDCD-4 compared to what was observed in the PHZ-administered rats. The administration of AP or P or AP + P as therapy or prophylaxis in PHZ-induced colorectal cancer significantly downregulated the colonic mRNA expression of PI3K, AKT, c-Myc, CK-20, SOX-2, OCT-4, and NanoG compared to the PHZ group. Hatley and colleagues found that miR-21 promotes RAS signaling activity and thereby suppresses the miR-143/145 cluster [100]. MiR-145 was found to be significantly downregulated in a variety of tumors, including pancreatic, breast, colon, and prostatic cancers [95,96]. Indeed, miR-145 has been well established as a tumor suppressor gene due to its negative regulation of various oncogenes such as Myc, K-Ras, IRS-1, and ERK5 [96,101]. Furthermore, miR-145 inhibits breast cancer cell motility and invasiveness by negatively regulating the junctional cell adhesion molecule (JAM-A), fascin and MUC1 [102,103]. By targeting the oncogenic FLI1, miR-145 suppresses the growth of colon cancer cells and sensitizes them to 5-fluorouracil [104].

Plants produce polyphenols as secondary metabolites to defend themselves from stressful conditions like excessive ultraviolet (UV) irradiation, heat exposure, insect attacks, and bacterial or fungal infections. AP’s high concentration of polyphenolic compounds like terpenoids, cardiac glycosides, steroids, and phenols may be the cause of its antioxidant activity. These findings show promising potential for the development of antimicrobial and antioxidant drugs from the AP plant and provide scientific evidence to support its traditional uses [105]. Acetone extracts and ethanol extracts have high tannin contents [105]. Tannins are antioxidants often characterized by their reducing power and scavenging activities [106]. In the present study, we investigated the expression levels of of p53, caspase3, Bax, and Bcl-2 using the flow cytometric technique to understand the signaling mechanism related to the apoptotic effects of AP and P against colorectal cancer induced via PHZ. In this study, the use of PHZ caused decreases in p53, caspase3, and Bax, and elevations in Bcl2 levels. On the other hand, using AP and P with PHZ increased the levels of p53, caspase3, and Bax and decreased Bcl2 levels. The induction of apoptosis is a major cytotoxic mechanism of anticancer therapies, including radiation, chemotherapy, and targeted therapies [107]. Cancer cells can develop various mechanisms to evade apoptosis. Deficiency in p53, Bax, or caspase activation can cause resistance to radiation and chemotherapy, while the overexpression of anti-apoptotic proteins such as Bcl-XL, c-FLIP, and IAPs are frequently associated with therapeutic resistance [108]. Bcl-2 is a protein best known for its roles in inhibiting apoptosis and promoting oncogenesis [109], and it is widely believed to be an apoptosis suppressor gene. The overexpression of the protein in cancer cells may block or delay the onset of apoptosis by selecting and maintaining long-living cells and arresting cells in the G0 phase of the cell cycle [110]. According to NaveenKumar et al. [111], the use of PHZ decreased p53, Bax, and Caspase-3 levels and increased Bcl-2 in hyperbilirubinemia rats.

Many anticancer drugs act along the physiological pathways of apoptosis, leading to tumor cell destruction [71]. The pro-apoptotic effects of p are mediated through the induction of apoptosis via increases in p53 levels, the upregulation of Bax, the activation of caspases -3, the downregulation of Bcl-2, the loss of mitochondrial potential, and the release of cytochrome c. P has been shown to induce apoptosis in cancer cells [112]. The regulation of apoptotic responses and decreases in oxidative stress, and inflammation by P were linked to a significant amelioration of mitochondrial function [82]. The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a pro-apoptotic ligand that activates the extrinsic apoptosis pathway of cell death receptors; TRAIL could inhibit metastasis and colon cancer cell invasion by promoting platelet apoptosis [113]. P substantially enhances TRAIL-induced cell death (apoptosis), including DNA fragmentation, in human leukemia [114]. Also, in this study, AP succeeded in increasing the apoptotic proteins and decreasing the Bcl-2 level, so it can be concluded that it can inhibit cell proliferation and cause the induction of apoptosis.

The histopathological features may be observed in the biochemical, immunohistochemical, genetic, and epigenetic elements found in the colonic mucosa [115]. For immunohistochemical studies, in the present study, PHZ showed high positivity for ki67 and p53 in colon cancer tissue. According to Darwish et al. [116]’s results, high immunohistochemical nuclear positivities for ki67 and p53 in a Wilms tumor were shown. According to Nussrat, et al. [117], the high-grade dysplasia of colorectal cancer showed significant positive immunohistochemical markers of Ki-67 and P53. The positively stained P53 in the mucosal cells may have appeared as a result of inactive mutants of P53. This result agrees with Hahn and Weinberg [118], who reported that the P53 gene is mutated and deleted in approximately one-half of colorectal tumors, leading to the inactivation of the P53 protein. On the other hand, using P and the AP extract caused lower levels of expression of the Ki-67 and P53 proteins compared with the PHZ group. According to Lee et al. [119], immunohistochemistry staining showed a reduction in the expression of Ki-67 in human oral cancer cells in a P-treated group, and this effect was due to its growth inhibitory effects and the induction of apoptosis.

4. Materials and Methods

4.1. Chemicals

Piceatannol ((E)-4-[2-(3,5Dihydroxyphenyl)ethenyl]1,2-benzenediol, 3,3′,4,5′-Stilbenetetrol, 3,3′,4,5′-Tetrahydroxy-trans-stilbene, Astringenin, and phenylhydrazine were purchased from Sigma–Aldrich Chemical Co. (St. Louis, MO, USA).

4.2. Preparation, Phytochemical Screening, and Physicochemical Standardization of the Adiantum pedatum (AP) Extract

An Adiantum pedatum plant was collected on 15 June 2021 at the Faculty of Pharmacy of Zagazig University and was authenticated under a voucher number (DBCU06) of the herbarium at the Department of Botany, Cairo University. The plant was cleaned with deionized water, and the plant sample was dried at room temperature for 7 days; then, it was ground into a powder and stored in air-tight containers at 4 °C. For the extraction of the plant material, 1 kg of dried plant powder was taken in a conical flask and subjected to a maceration extraction at room temperature, using absolute ethanol three times (3 L). The extract was collected in a separate conical flask to evaporate the solvent via natural evaporation for 2 days. The remaining extract weighed around 230 g. The plant phytochemical screening was carried out using gas chromatography–mass spectrometry (GC-Mass) [120], using a direct capillary column TG-5MS (30 m × 0.25 mm × 0.25 μm thickness). Approximately 3 L of the AP extract was automatically injected into the equipment using an Auto sampler AS3000 combined with GC in split mode and the report attached in the Supplementary Materials. The instrumental analysis was then performed as previously reported [121]. The components were identified by comparing their retention times and mass spectra to the databases Wiley 09 and NIST 11 [121]. Assays for the AP moisture content%, pH, cold extract%, hot extract%, ash (total, acid insoluble, and water-soluble ash%), and total phenolic compound% and tests for saponins, tannin, flavonoids, and proteins were performed according to the method described in [122], as shown in

Table 4. Physicochemical standardization of the Adiantum pedatum (AP) extract.

Items	Results
Moisture content%	9.57 ± 0.33
Cold extraction
Petroleum ether extracts (Cold)	10.97 ± 0.49
Chloroform extracts (Cold)	14.75 ± 0.54
Methanol extracts (Cold)	8.25 ± 0.19
Aqueous extract (cold)	2.85 ± 0.29
Hot extraction
Chloroform extract (Hot)	0.33 ± 0.02
Alcoholic extract (Hot)	17.66 ± 0.46
Aqueous extract (hot)	12.76 ± 0.82
Total Ash	7.75 ± 0.29
Acid insoluble ash	3.45 ± 0.17
Water soluble ash	8.8 ± 0.316
Test for phenolic compounds
Total Phenolic %	4.6 ± 0.18
pH
5% 10%	5.62 5.48
TEST FOR SAPONINS
Foam Test	+
TEST FOR TANNINS
(a) Ferric chloride reagent (b) Lead acetate test (c) Potassium dichromate test	+ + +
TEST FOR FLAVANOIDS
Shinoda Test	+
TEST FOR PROTEINS
(a) Biuret Test (b) Xanthoproteic test	+ +

+ means positive reaction.

.

4.3. Animals Care

The animal house of the college of Veterinary Medicine at Zagazig University provided 48 healthy adult male albino rats, each weighing between 180 and 200 g. Throughout the experiment, the animals were housed in standard laboratory settings. All animal procedures were carried out in compliance with the accepted standards for handling and using lab animals. All rats received humane care, and the experimental methods were approved by the Institutional Animal Care and Use Committee of Badr University in Cairo (No. BUC-IACUC/VET/131/A/2023).

4.4. Induction of Colon Cancer

The animals were each given a weekly dose of PHZ that was dissolved in 0.9% NaCl and injected intraperitoneally at a dose of (90 mg/kg bw) twice a week for four consecutive weeks to induce colon cancer [123,124], and the PHZ injections continued for the next four weeks.

4.5. Experimental Animals Design

The rats were randomly divided into eight groups (15 in each group), and they were administered their doses as follows: group 1 (control group) contained rats fed on a balanced diet without any treatments; the group 2 (AP) rats were administered a dose of 200 mg/kg b.w of AP orally for each alternate day [125]; the group 3 (P) rats were administered a dose of 40 mg/kg b.w. of p orally for each alternate day [126], the group 4 (PHZ) rats were administered a dose of 90 mg/kg b.w. of a colon cancer drug injected twice a week ip [124]; the group 5 (PHZ + AP) rats were administered PHZ and AP treatments in the same previous doses; the group 6 (PHZ + P) rats were administered PHZ and P treatments with the same previous doses; the group 7 (PHZ + AP + P) rats were injected with PHZ and co-administered with both AP and P in the same previous doses; and the group 8 (prophylaxis) (PHZ + AP + P) rats were injected with PHZ and co-administered with both AP and P at the same previous doses all at once from the initiation of the experiment. All treatments were applied regularly under the same conditions for a period of 8 weeks.

4.6. Preparation of Colon Tissue Homogenate for Biochemistry Analysis

Before autopsy, the tissues were washed with a PBS (phosphate-buffered saline) solution at a pH of 7.4 which contained 0.16 mg/mL heparin. The tissues were then homogenized in 5–10 mL of cold buffer to remove any red blood cells and centrifuged at 4000 rpm for 15 min at 4 °C. The supernatant was removed for an assay and stored on ice, frozen at −80 °C until use.

4.7. Determination of Oxidative Stress and Antioxidant Markers

All markers we measured were assayed using clear supernatants of colon tissue homogenate. These assays included oxidative stress products. Lipid peroxidation (LPO) was measured by assaying the end product of a peroxidation reaction of MDA, and the result was expressed as (nmol/g wet tissue) [127]. The measurement of protein carbonyl (PC) was carried out according to [128] and expressed as (nmol/g). The measurement of nitric oxide (NO) was carried out according to [129] and expressed as (µmol/g wet tissue). Regarding antioxidant enzymes, the total antioxidant capacity (TAC) was determined according to [130] and expressed as mM/g. CAT was expressed as a unit per gram tissue (U/g) [131]. SOD was expressed as (U/g) [132]. GSH was expressed as (mmol/g) [133]. GST was expressed as (U/g tissue) [134]. The GPx level was expressed as (U/gHb) according to Weinhold et al., 1990. All analyses were performed using a semi–Auto Biochemistry Analyzer (Robonik, Maharashtra, India).

4.8. Preparation of Colon Tissue Suspension for Flow Cytometry

Fresh colon tissue specimens were used in isotonic saline 0.9% and prepared using isotone tris EDTA buffer to wash the materials. The prepared materials were dissolved in 250 mL of distilled water, and then 1N HCL was used to adjust the pH to 7.5. The supernatant was separated from the cell suspension after centrifugation at 1800 rpm for 10 min and examined with a microscope for blood contamination. The cells were fixed in ice-cold 96–100% ethanol (BDH) for 1 min. The fixed cells were stored in a refrigerator until use [135].

4.9. Flow Cytometry Determination of Apoptotic Markers

The determinations of B cell lymphoma 2 (Bcl-2), the apoptosis regulator (BCL2-associated X protein) (BAX), Caspase 3, and the tumor protein (P53) in the colon tissues were carried out using a BD Accuri C6 flow cytometer.

4.10. Histopathological Investigation and Immunohistochemical Detection of P53 and Ki67

Histopathology was carried out according to Bancroft, using hematoxylin and eosin staining techniques [136]. Paraffin-embedded blocks of resected specimens were cut into 5 μm sections. The expression levels of P53 and Ki67 were analyzed using a standard avidin–biotin technique. The procedures were performed according to the manufacturer’s instructions [137].

4.11. RT-qPCR

Total RNA was extracted from the colorectal tissue using Qiazol (Qiagen; Hilden, Germany), according to the manufacturer’s guidelines. To estimate the total RNA concentration, we used a NanoDrop^® ND–1000 Spectrophotometer (NanoDrop Technologies; Wilmington, DE, USA). Using the cDNA Reverse Transcription Kit with High-Capacity (Applied Biosystems™, Waltham, MA, USA), the reverse transcription of the total RNA to cDNA was performed. The reverse transcription of the miRNA was carried out using 50 ng of the total extracted RNA, which was reverse-transcribed in a final volume of 20 µL (50 ng dissolved in 5µL of nuclease-free water, 4 µL of 5× miRCURY RT reaction buffer, 2.5 µL of 10× miRCURY RT Enzyme Mix, 1.2 µL of a predesigned stem-loop primer (Table 1) and 10 µL of RNase-free water), with a cycling condition of 42 °C for 60 min for the reverse transcription stage and 95 °C for the inactivation of the enzyme, according to the instructions of the manufacturer (Qiagen, Germany). The cDNA was then aliquoted and stored at −20 °C until use. The amplification of the cDNA was conducted in a real-time thermal cycler Rotor-Gene Q [138,139] with a SYBER Green master mix and a TOPreal™ qPCR 2×PreMIX (Enzynomics, Daejeon, Republic of Korea) with oligo-NTPs primers (Sangon Biotech, Beijing, China), as noted in

Table 5. Primers and stem-loop sequences of targeted genes.

Gene	Forward Primer (5′ to 3′)	Reverse Primer (5′ to 3′)	Product Size	Accession No.
Gapdh	GCATCTTCTTGTGCAGTGCC	GGTAACCAGGCGTCCGATAC	91	NM_017008.4
Myc	CAACAACCGCAAATGCTCCA	AGCTACGCTTCAGCTCGTTT	110	NM_012603.2
P53	CCCCTGAAGACTGGATAACTGT	TCTCCTGACTCAGAGGGAGC	75	NM_030989.3
PDCD4	CGGCCCGAGGGGATTCTAAA	GGGTCAGTGGGGTTCACATT	123	NM_022265.3
CK-20	CGCATCAATACTGTGCGGTG	AGCTCCCCAGAGTGAAAACG	91	NM_173128.2
AKT-1	GAAGGAGAAGGCCACAGGTC	TTCTGCAGGACACGGTTCTC	111	NM_033230.3
PI3K	CCCTGCCCCATTTCATCCTT	TGTTGTTGCCCCAGACATGA	162	NM_053481.2
SOX2	ACAGAGAAAACCTGAGGGCG	CATCGCCCGGAGTCTAGTTC	173	NM_001109181.2
Nanog	TGCATTTGTCTGAGCTGGGT	ATGGAGTAGGGTGGGTGTGT	115	NM_001100781.1
OCT4	AAGTTGGCGTGGAGACTCTG	GGACTCCTCGGGACTAGGTT	143	NM_001009178.2
mir-145-5P	AACCGGGTCCAGTTTTCCC	GTCGTATCCAGTGCAGGGT
U6	GCTCGCTTCGGCAGCACA	GAGGTATTCGCACCAGAGGA
mir-145-5P stem-loop	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAT
U6 stem-loop	AACGCTTCACGAATTTGCGTG

. The relative gene expression over the normalizer gene Gapdh was finally calculated and represented as a percentage from the control, and the fold change was estimated as 2^−ΔΔct [140].

4.12. Statistical Analysis

The results are expressed as means ± standard error means (SEMs). A one-way analysis of variance (ANOVA) was used to analyze the data, followed by a test of the least significant difference (LSD). The analyses were conducted using the SPSS statistical package, version 19.00, software. A p value ≤ 0.05 was considered statistically significant.

5. Conclusions

Based on the available information, it appears that both AP and P demonstrated some potential in terms of antioxidant and apoptotic activities in male rats with PHZ-induced colon cancer. However, intensive studies are required to be able to draw any definitive conclusions about the effectiveness of either drug. It is important to note that animal studies are often used as a preliminary step in evaluating the potential effectiveness and safety of new drugs, but the results of these studies may not always translate directly to humans. Further research, including clinical trials in humans, will be necessary to fully evaluate the safety and efficacy of these candidate drugs.