Lactiplantibacillus plantarum NKK20 Alleviates High-Fat-Diet-Induced Nonalcoholic Fatty Liver Disease in Mice through Regulating Bile Acid Anabolism
Abstract
1. Introduction
2. Results
2.1. Influence of NKK20 on Body Weight and Blood Lipids in NAFLD Mice
2.2. Influence of NKK20 on Splenic/Hepatic Inflammatory Factors and Hepatic Cholesterol-Metabolizing Enzymes’ Expression and Intestinal Microbiota in NAFLD Mice
2.3. Influence of NKK20 on Liver Tissue in NAFLD Mice
2.4. Results of 16S rRNA Sequencing of Mouse Colon Contents
2.5. Effect of NKK20 on Metabolomics in Colon Contents
2.6. NKK20 Significantly Affected Bile Acid Metabolism in Mice
3. Discussion
4. Materials and Methods
4.1. NKK20 Preparation
4.2. Animals Diet and Treatment
4.3. Plasma Parameters
4.4. RNA Extraction and qPCR Assay
4.5. Liver Histopathological Observation
4.6. Analysis of Intestinal Flora of Mice
4.7. Untargeted/Targeted Metabolomics Analysis
4.8. Liver Bile Acid of Mice Was Detected by UPLC-MS/MS
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Rao, H.; Liu, F.; Wei, L.; Li, H.; Wu, C. Recent advances in adipose tissue dysfunction and its role in the pathogenesis of non-alcoholic fatty liver disease. Cells 2021, 10, 3300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, R.S.; Bril, F.; Cusi, K.; Newsome, P.N. Modulation of insulin resistance in nonalcoholic fatty liver disease. Hepatology 2019, 70, 711–724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, T.C.; Chiou, W.C.; Lai, W.H.; Huang, H.C.; Huang, Y.L.; Liu, H.K.; Liang, Y.C.; Huang, C. Ugonin J improves metabolic disorder and ameliorates nonalcoholic fatty liver disease by regulating the AMPK/AKT signaling pathway. Pharmacol. Res. 2021, 163, 105298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, S.W.; Chan, W.K. Epidemiology of non-alcoholic fatty liver disease in Asia. Indian. J. Gastroenterol. 2020, 39, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Farzanegi, P.; Dana, A.; Ebrahimpoor, Z.; Asadi, M.; Azarbayjani, M.A. Mechanisms of beneficial effects of exercise training on non-alcoholic fatty liver disease (NAFLD): Roles of oxidative stress and inflammation. Eur. J. Sport. Sci. 2019, 19, 994–1003. [Google Scholar] [CrossRef] [Scilit]
- Kazankov, K.; Jorgensen, S.; Thomsen, K.L.; Moller, H.J.; Vilstrup, H.; George, J.; Schuppan, D.; Grønbæk, H. The role of macrophages in nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 145–159. [Google Scholar] [CrossRef] [Scilit]
- Arroyave-Ospina, J.C.; Wu, Z.; Geng, Y.; Moshage, H. Role of oxidative stress in the pathogenesis of non-alcoholic fatty liver disease: Implications for prevention and therapy. Antioxidants 2021, 10, 174. [Google Scholar] [CrossRef] [Scilit]
- Hwangbo, H.; Kim, M.Y.; Ji, S.Y.; Kim, S.Y.; Lee, H.; Kim, G.Y.; Park, C.; Keum, Y.S.; Hong, S.H.; Cheong, J.; et al. Auranofin attenuates non-alcoholic fatty liver disease by suppressing lipid accumulation and NLRP3 inflammasome-mediated hepatic inflammation in vivo and in vitro. Antioxidants 2020, 9, 1040. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Duan, Q.; Wu, R.; Harris, E.N.; Su, Q. Pathophysiological communication between hepatocytes and non-parenchymal cells in liver injury from NAFLD to liver fibrosis. Adv. Drug. Deliv. Rev. 2021, 176, 113869. [Google Scholar] [CrossRef] [Scilit]
- Wu, T.; Zhang, Y.; Li, W.; Zhao, Y.; Long, H.; Muhindo, E.M.; Liu, R.; Sui, W.; Li, Q.; Zhang, M. Lactobacillus rhamnosus LRa05 ameliorate hyperglycemia through a regulating glucagon-mediated signaling pathway and gut microbiota in type 2 diabetic mice. J. Agric. Food Chem. 2021, 69, 8797–8806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, M.; Wu, T.; Zhang, G.; Liu, R.; Sui, W.; Zhang, M.; Geng, J.; Yin, J.; Zhang, M. Lactobacillus rhamnosus LRa05 improves lipid accumulation in mice fed with a high fat diet via regulating the intestinal microbiota, reducing glucose content and promoting liver carbohydrate metabolism. Food Funct. 2020, 11, 9514–9525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Slattery, C.; Cotter, P.D.; O’Toole, P.W. Analysis of health benefits conferred by Lactobacillus species from Kefir. Nutrients 2019, 11, 1252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva Sabo, S.; Vitolo, M.; Gonzalez, J.; Oliveira, R. Overview of Lactobacillus plantarum as a promising bacteriocin producer among lactic acid bacteria. Food Res. Int. 2014, 64, 527–536. [Google Scholar] [CrossRef] [Scilit]
- Jin, M.; Qian, Z.; Yin, J.; Xu, W.; Zhou, X. The role of intestinal microbiota in cardiovascular disease. J. Cel. Mol. Med. 2019, 23, 2343–2350. [Google Scholar] [CrossRef] [Scilit]
- Tripathi, A.; Debelius, J.; Brenner, D.A.; Karin, M.; Loomba, R.; Schnabl, B.; Knight, R. The gut-liver axis and the intersection with the microbiome. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 397–411. [Google Scholar] [CrossRef] [Scilit]
- Martin-Mateos, R.; Albillos, A. The role of the gut-liver axis in metabolic dysfunction-associated fatty liver disease. Front. Immunol. 2021, 12, 660179. [Google Scholar] [CrossRef] [Scilit]
- Suk, K.T.; Koh, H. New perspective on fecal microbiota transplantation in liver diseases. J. Gastroenterol. Hepatol. 2022, 37, 24–33. [Google Scholar] [CrossRef] [Scilit]
- Madsen, M.; Kimer, N.; Bendtsen, F.; Petersen, A.M. Fecal microbiota transplantation in hepatic encephalopathy: A systematic review. Scand. J. Gastroenterol. 2021, 56, 560–569. [Google Scholar] [CrossRef] [Scilit]
- Shi, Q.; Dai, L.; Zhao, Q.; Zhang, X. A review on the effect of gut microbiota on metabolic diseases. Arch. Microbiol. 2022, 204, 192. [Google Scholar] [CrossRef] [Scilit]
- Hu, Q.; Zhang, W.; Wu, Z.; Tian, X.; Xiang, J.; Li, L.; Li, Z.; Peng, X.; Wei, S.; Ma, X. Baicalin and the liver-gut system: Pharmacological bases explaining its therapeutic effects. Pharmacol. Res. 2021, 165, 105444. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.; Han, M.; Heinrich, B.; Fu, Q.; Zhang, Q.; Sandhu, M.; Agdashian, D.; Terabe, M.; Berzofsky, J.A.; Fako, V.; et al. Gut microbiome-mediated bile acid metabolism regulates liver cancer via NKT cells. Science 2018, 360, n5931. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hylemon, P.B.; Harris, S.C.; Ridlon, J.M. Metabolism of hydrogen gases and bile acids in the gut microbiome. FEBS Lett. 2018, 592, 2070–2082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monteiro-Cardoso, V.F.; Corliano, M.; Singaraja, R.R. Bile acids: A communication channel in the gut-brain axis. Neuromol. Med. 2021, 23, 99–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, Y.; Gui, W.; Koo, I.; Smith, P.B.; Allman, E.L.; Nichols, R.G.; Rimal, B.; Cai, J.; Liu, Q.; Patterson, A.D. The microbiome modulating activity of bile acids. Gut Microbes 2020, 11, 979–996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molinero, N.; Ruiz, L.; Sanchez, B.; Margolles, A.; Delgado, S. Intestinal bacteria interplay with bile and cholesterol metabolism: Implications on host physiology. Front. Physiol. 2019, 10, 185. [Google Scholar] [CrossRef] [Scilit]
- Shao, J.W.; Ge, T.T.; Chen, S.Z.; Wang, G.; Yang, Q.; Huang, C.H.; Xu, L.C.; Chen, Z. Role of bile acids in liver diseases mediated by the gut microbiome. World J. Gastroenterol. 2021, 27, 3010–3021. [Google Scholar] [CrossRef] [Scilit]
- Han, H.; Jiang, Y.; Wang, M.; Melaku, M.; Liu, L.; Zhao, Y.; Everaert, N.; Yi, B.; Zhang, H. Intestinal dysbiosis in nonalcoholic fatty liver disease (NAFLD): Focusing on the gut-liver axis. Crit. Rev. Food Sci. Nutr. 2021, 63, 1689–1706. [Google Scholar] [CrossRef] [Scilit]
- Foley, M.H.; O’Flaherty, S.; Allen, G.; Rivera, A.J.; Stewart, A.K.; Barrangou, R.; Theriot, C.M. Lactobacillus bile salt hydrolase substrate specificity governs bacterial fitness and host colonization. Proc. Natl. Acad. Sci. USA 2021, 118, e2017709118. [Google Scholar] [CrossRef] [Scilit]
- Mullish, B.H.; McDonald, J.; Pechlivanis, A.; Allegretti, J.R.; Kao, D.; Barker, G.F.; Kapila, D.; Petrof, E.O.; Joyce, S.A.; Gahan, C.G.M.; et al. Microbial bile salt hydrolases mediate the efficacy of faecal microbiota transplant in the treatment of recurrent Clostridioides difficile infection. Gut 2019, 68, 1791–1800. [Google Scholar] [CrossRef] [Scilit]
- Mori, H.; Svegliati, B.G.; Marzioni, M.; Di Nicola, F.; Santori, P.; Maroni, L.; Abenavoli, L.; Scarpellini, E. Farnesoid X receptor, bile acid metabolism, and gut microbiota. Metabolites 2022, 12, 647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinha, S.R.; Haileselassie, Y.; Nguyen, L.P.; Tropini, C.; Wang, M.; Becker, L.S.; Sim, D.; Jarr, K.; Spear, E.T.; Singh, G.; et al. Dysbiosis-induced secondary bile acid deficiency promotes intestinal inflammation. Cell Host Microbe 2020, 27, 659–670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fiorucci, S.; Biagioli, M.; Zampella, A.; Distrutti, E. Bile acids activated receptors regulate innate immunity. Front. Immunol. 2018, 9, 1853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, S.; Chen, J.; Zhu, L.; Guo, T.; Qin, D.; Hu, Z.; Han, S.; Wang, J.; Matias, F.B.; Wen, L.; et al. Oryzanol alleviates high fat and cholesterol diet-induced hypercholesterolemia associated with the modulation of the gut microbiota in hamsters. Food Funct. 2022, 13, 4486–4501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Lorenzo, F.; De Castro, C.; Silipo, A.; Molinaro, A. Lipopolysaccharide structures of gram-negative populations in the gut microbiota and effects on host interactions. FEMS Microbiol. Rev. 2019, 43, 257–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fei, N.; Bruneau, A.; Zhang, X.; Wang, R.; Wang, J.; Rabot, S.; Gérard, P.; Zhao, L. Endotoxin producers overgrowing in human gut microbiota as the causative agents for nonalcoholic fatty liver disease. mBio 2020, 11, e03263-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiang, J.; Ferrell, J.M. Bile acids as metabolic regulators and nutrient sensors. Annu. Rev. Nutr. 2019, 39, 175–200. [Google Scholar] [CrossRef] [Scilit]
- Chruszcz, M.; Chew, F.T.; Hoffmann-Sommergruber, K.; Hurlburt, B.K.; Mueller, G.A.; Pomés, A.; Rouvinen, J.; Villalba, M.; Wöhrl, B.M.; Breiteneder, H. Allergens and their associated small molecule ligands-their dual role in sensitization. Allergy 2021, 76, 2367–2382. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Y.; Yu, Z.; Zhang, W.; Sun, T. Lactobacillus rhamnosus Probio-M9 improves the quality of life in stressed adults by gut microbiota. Foods 2021, 10, 2384. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Hiraishi, K.; Kurahara, L.H.; Nakano-Narusawa, Y.; Li, X.; Hu, Y.; Matsuda, Y.; Zhang, H.; Hirano, K. Inhibitory effects of breast milk-derived Lactobacillus rhamnosus Probio-M9 on colitis-associated carcinogenesis by restoration of the gut microbiota in a mouse model. Nutrients 2021, 13, 1143. [Google Scholar] [CrossRef] [Scilit]
- Cao, K.; Zhang, K.; Ma, M.; Ma, J.; Tian, J.; Jin, Y. Lactobacillus mediates the expression of NPC1L1, CYP7A1, and ABCG5 genes to regulate cholesterol. Food Sci. Nutr. 2021, 9, 6882–6891. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, Y.; Wang, Q.; Chang, R.; Zhou, X.; Xu, C. Intestinal barrier function-non-alcoholic fatty liver disease interactions and possible role of gut microbiota. J. Agric. Food Chem. 2019, 67, 2754–2762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ziolkowska, S.; Binienda, A.; Jablkowski, M.; Szemraj, J.; Czarny, P. The interplay between insulin resistance, inflammation, oxidative stress, base excision repair and metabolic syndrome in nonalcoholic fatty liver disease. Int. J. Mol. Sci. 2021, 22, 11128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; van Esch, B.; Wagenaar, G.; Garssen, J.; Folkerts, G.; Henricks, P. Pro- and anti-inflammatory effects of short chain fatty acids on immune and endothelial cells. Eur. J. Pharmacol. 2018, 831, 52–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, B.; Hao, K.; Chen, X.; Wu, E.; Nie, D.; Zhang, G.; Si, H. Broussonetia papyrifera polysaccharide alleviated acetaminophen-induced liver injury by regulating the intestinal flora. Nutrients 2022, 14, 2636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, W.; Ao, H.; Peng, C. Gut Microbiota, short-chain fatty acids, and herbal medicines. Front. Pharmacol. 2018, 9, 1354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Markowiak-Kopec, P.; Slizewska, K. The effect of probiotics on the production of short-chain fatty acids by human intestinal microbiome. Nutrients 2020, 12, 1107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Overby, H.B.; Ferguson, J.F. Gut microbiota-derived short-chain fatty acids facilitate microbiota: Host cross talk and modulate obesity and hypertension. Curr. Hypertens. Rep. 2021, 23, 8. [Google Scholar] [CrossRef] [Scilit]
- Nogal, A.; Valdes, A.M.; Menni, C. The role of short-chain fatty acids in the interplay between gut microbiota and diet in cardio-metabolic health. Gut Microbes 2021, 13, 1897212. [Google Scholar] [CrossRef] [Scilit]
- Kim, C.H. Control of lymphocyte functions by gut microbiota-derived short-chain fatty acids. Cell. Mol. Immunol. 2021, 18, 1161–1171. [Google Scholar] [CrossRef] [Scilit]
- Kriaa, A.; Bourgin, M.; Potiron, A.; Mkaouar, H.; Jablaoui, A.; Gérard, P.; Maguin, E.; Rhimi, M. Microbial impact on cholesterol and bile acid metabolism: Current status and future prospects. J. Lipid Res. 2019, 60, 323–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, C.; Xie, S.; Chi, Z.; Zhang, J.; Liu, Y.; Zhang, L.; Zheng, M.; Zhang, X.; Xia, D.; Ke, Y.; et al. Bile acids control inflammation and metabolic disorder through inhibition of NLRP3 inflammasome. Immunity 2016, 45, 802–816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Chen, K.; Li, F.; Gu, Z.; Liu, Q.; He, L.; Shao, T.; Song, Q.; Zhu, F.; Zhang, L.; et al. Probiotic Lactobacillus rhamnosus GG prevents liver fibrosis through inhibiting hepatic bile acid synthesis and enhancing bile acid excretion in mice. Hepatology 2020, 71, 2050–2066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bi, H.; Xu, Y.; Fan, F.; Sun, X. Effect of drying methods on Lactobacillus rhamnosus GG microcapsules prepared using the complex coacervation method. J. Food Sci. 2022, 87, 1282–1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, X.; Ding, L.; Ma, G.; Zhang, Y.; Sun, Y.; Li, Z.; Tao, X.; Ali, A.; Wang, D.; Wu, L. Lactobacillus rhamnosus TR08 improves dyslipidemia in mice fed with a high fat diet by regulating the intestinal microbiota, reducing systemic inflammatory response, and promoting sphingomholipid metabolism. Molecules 2022, 27, 7357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yue, X.; Wen, S.; Long-Kun, D.; Man, Y.; Chang, S.; Min, Z.; Shuang-Yu, L.; Xin, Q.; Jie, M.; Liang, W. Three important short-chain fatty acids (SCFAs) attenuate the inflammatory response induced by 5-FU and maintain the integrity of intestinal mucosal tight junction. BMC Immunol. 2022, 23, 19. [Google Scholar] [CrossRef] [Scilit]












| Metabolites | Related Metabolic Pathways | m/z | Retention Time (min) | VIP | p Value | Change Trend |
|---|---|---|---|---|---|---|
| Cholic acid glucuronide | Bile acid biosynthesis | 619.2886636 | 4.50925 | 1.48 | 0.010 | ↑ |
| Asparaginyl-Aspartate | Amino acid metabolism | 493.1515701 | 13.59033333 | 1.42 | 0.010 | ↑ |
| Tyrosine | Amino acid metabolism | 180.066612 | 1.814466667 | 1.40 | 0.010 | ↑ |
| 20-trihydroxy-leukotriene-B4 | Steroid metabolism | 365.1966849 | 4.9492 | 1.391 | 0.000 | ↑ |
| Enkephalin L | Steroid metabolism | 554.2620907 | 22.95986667 | 1.37 | 0.000 | ↑ |
| 9′-Carboxy-gamma-chromanol | Bile acid biosynthesis | 397.2362352 | 16.50585 | 1.16 | 0.001 | ↓ |
| Prostaglandin B2 | Arachidonic acid metabolism | 461.1969152 | 4.7223 | 1.15 | 0.001 | ↑ |
| Hyocholic acid | Bile acid biosynthesis | 389.2697488 | 5.430083333 | 1.14 | 0.001 | ↓ |
| 5b-Cholestane-3a,7a,12a,24,25-pentol | Bile acid biosynthesis | 433.3323119 | 8.048866667 | 1.15 | 0.024 | ↓ |
| Bisnorcholic acid | Bile acid biosynthesis | 361.2387639 | 5.869866667 | 1.22 | 0.000 | ↓ |
| 3-Sulfodeoxycholic acid | Bile acid biosynthesis | 439.2160426 | 7.62975 | 1.17 | 0.000 | ↓ |
| Components | Normal Diet (kcal/gm) | High-Fat Diet (kcal/gm) |
|---|---|---|
| Casein | 800/200 | 800/200 |
| L-Cystine | 12/3 | 12/3 |
| Corn Starch | 2024.8/506.2 | 0/0 |
| Maltodextrin | 500/125 | 500/125 |
| Sucrose | 275/68.8 | 275/68.8 |
| Cellulose | 0/50 | 0/50 |
| Soybean Oil | 225/25 | 225/25 |
| Lard | 180/20 | 2205/245 |
| Mineral Mix | 0/10 | 0/10 |
| DiCalcium Phosphate | 0/13 | 0/13 |
| Calcium Carbonate | 0/5.5 | 0/5.5 |
| Potassium Citrate | 0/16.5 | 0/16.5 |
| Vitamin Mix | 40/10 | 40/10 |
| Choline Bitartrate | 0/2 | 0/2 |
| Total kcal/g | 4056.8 kcal/1055 gm = 3.84 | 4057 kcal/773.8 gm = 5.24 |
| Nutrient composition | Energy supply ratio | |
| Protein | 20% | 20% |
| Carbohydrate | 70% | 20% |
| Fat | 10% | 60% |
| Genes | Primers Sequences (5′→3′) |
|---|---|
| β-actin | F: AAGCTGTGCTATGTTGCTCTA |
| R: GTTTCATGGATGCCACAGGA | |
| TNF-α | F: AACTCCAGGCGGTGCCTATG R: TCCAGCTGCTCCTCCACTTG |
| IL-1β | F: CCTGTCCTGCGTGTTGAAAGA R: GGGAACTGGGCAGACTCAAA |
| IL-4 | F: CCATATCCACGGATGCGACA R: AAGCACCTTGGAAGCCCTAC |
| IL-10 | F: GAAGCTCCCTCAGCGAGGACA R: TTGGGCCAGTGAGTGAAAGGG |
| CYP7A1 | F: CCGATGGATGGAAATACCAC R: GGCAGCGGTCTTTGAGTTAG |
| ASBT | F: TACGGTAGCAGGGGTTTACG R: TGCAAAATGGAACAAAACCA |
| LDLR | F: GAATTTGGCCAGACACAGGT R: CACCGTACCCAGCTGATTTT |
| HMGR | F: GTCATTCCAGCCAAGGTTGT R: GGGACCACTTGCTTCCATTA |
| TGF-β1 | F: GTCAGACATTCGGGAAGCAG |
| R: GCGTATCAGTGGGGGTCA | |
| CTGF | F: CAACCGCAAGATTGGAGTGT |
| R: CTCCAGTCTGCAGAAGGTATTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, C.; Qiu, C.; Zhang, Y.; Yan, M.; Tan, J.; He, J.; Yang, D.; Wang, D.; Wu, L. Lactiplantibacillus plantarum NKK20 Alleviates High-Fat-Diet-Induced Nonalcoholic Fatty Liver Disease in Mice through Regulating Bile Acid Anabolism. Molecules 2023, 28, 4042. https://doi.org/10.3390/molecules28104042
Sun C, Qiu C, Zhang Y, Yan M, Tan J, He J, Yang D, Wang D, Wu L. Lactiplantibacillus plantarum NKK20 Alleviates High-Fat-Diet-Induced Nonalcoholic Fatty Liver Disease in Mice through Regulating Bile Acid Anabolism. Molecules. 2023; 28(10):4042. https://doi.org/10.3390/molecules28104042
Chicago/Turabian StyleSun, Chang, Chenguang Qiu, Yanyan Zhang, Man Yan, Jiajun Tan, Jiayuan He, Dakai Yang, Dongxu Wang, and Liang Wu. 2023. "Lactiplantibacillus plantarum NKK20 Alleviates High-Fat-Diet-Induced Nonalcoholic Fatty Liver Disease in Mice through Regulating Bile Acid Anabolism" Molecules 28, no. 10: 4042. https://doi.org/10.3390/molecules28104042
APA StyleSun, C., Qiu, C., Zhang, Y., Yan, M., Tan, J., He, J., Yang, D., Wang, D., & Wu, L. (2023). Lactiplantibacillus plantarum NKK20 Alleviates High-Fat-Diet-Induced Nonalcoholic Fatty Liver Disease in Mice through Regulating Bile Acid Anabolism. Molecules, 28(10), 4042. https://doi.org/10.3390/molecules28104042

