Cardioprotective Effect of Centaurea castriferrei Borbás & Waisb Extract against Doxorubicin-Induced Cardiotoxicity in H9c2 Cells
Abstract
1. Introduction
2. Results
2.1. Phytochemical Contents of CAS Extracts
2.2. Effects of CAS Extracts on DOX-Induced Toxicity in H9c2 Cells
2.3. Effects of CAS Extracts and DOX on Cell Cycle Progression in H9c2 Cells
2.4. Effects of CAS Extracts on DOX-Induced Apoptosis in H9c2 Cells
2.5. Effects of CAS Extract on DOX-Induced Oxidative Stress in H9c2 Cells
2.5.1. Detection of Oxidative Stress
2.5.2. Determination of DNA Oxidative Damage
2.5.3. Quantitative Real-Time PCR
2.6. Effects of CAS Extracts and DOX on MCF-7 Breast Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Extraction of Plant Material by Ultrasound-Assisted Extraction (UAE)
4.3. Phytochemical Analysis
4.3.1. RP-HPLC/DAD Analysis
4.3.2. LC/ESI–QTOF–MS Analysis
4.4. Cell Culture and Treatment
4.5. Cytotoxicity Analysis
4.6. Cell Cycle Analysis
4.7. Apoptosis Detection
4.8. Detection of Oxidative Stress
4.9. Determination of DNA Oxidative Damage
4.10. Quantitative Real-Time PCR Analysis (qRT-PCR)
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Senkus, E.; Jassem, J. Cardiovascular effects of systemic cancer treatment. Cancer Treat. Rev. 2011, 37, 300–311. [Google Scholar] [CrossRef] [Scilit]
- Khouri, M.G.; Douglas, P.S.; Mackey, J.R.; Martin, M.; Scott, J.M.; Scherrer-Crosbie, M.; Jones, L.W. Cancer Therapy–Induced Cardiac Toxicity in Early Breast Cancer: Addressing the Unresolved Issues. Circulation 2012, 126, 2749–2763. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Wu, L. In Vitro and In Vivo Cardioprotective Effects of Curcumin against Doxorubicin-Induced Cardiotoxicity: A Systematic Review. J. Oncol. 2022, 2022, 7277562. [Google Scholar] [CrossRef] [Scilit]
- Ghignatti, P.V.D.C.; Nogueira, L.J.; Lehnen, A.M.; Leguisamo, N.M. Cardioprotective effects of exercise training on doxorubicin-induced cardiomyopathy: A systematic review with meta-analysis of preclinical studies. Sci. Rep. 2021, 11, 6330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rawat, P.S.; Jaiswal, A.; Khurana, A.; Bhatti, J.S.; Navik, U. Doxorubicin-induced cardiotoxicity: An update on the molecular mechanism and novel therapeutic strategies for effective management. Biomed. Pharmacother. 2021, 139, 111708. [Google Scholar] [CrossRef] [Scilit]
- He, H.; Wang, L.; Qiao, Y.; Zhou, Q.; Li, H.; Chen, S.; Yin, D.; Huang, Q.; He, M. Doxorubicin Induces Endotheliotoxicity and Mitochondrial Dysfunction via ROS/eNOS/NO Pathway. Front. Pharmacol. 2020, 10, 1531. [Google Scholar] [CrossRef] [Scilit]
- Gorini, S.; De Angelis, A.; Berrino, L.; Malara, N.; Rosano, G.; Ferraro, E. Chemotherapeutic Drugs and Mitochondrial Dysfunction: Focus on Doxorubicin, Trastuzumab, and Sunitinib. Oxid. Med. Cell. Longev. 2018, 2018, 7582730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cappetta, D.; Rossi, F.; Piegari, E.; Quaini, F.; Berrino, L.; Urbanek, K.; De Angelis, A. Doxorubicin targets multiple players: A new view of an old problem. Pharmacol. Res. 2018, 127, 4–14. [Google Scholar] [CrossRef] [Scilit]
- Cardinale, D.; Colombo, A.; Bacchiani, G.; Tedeschi, I.; Meroni, C.A.; Veglia, F.; Civelli, M.; Lamantia, G.; Colombo, N.; Curigliano, G.; et al. Early Detection of Anthracycline Cardiotoxicity and Improvement with Heart Failure Therapy. Circulation 2015, 131, 1981–1988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ojha, S.; Al Taee, H.; Goyal, S.; Mahajan, U.B.; Patil, C.R.; Arya, D.S.; Rajesh, M. Cardioprotective Potentials of Plant-Derived Small Molecules against Doxorubicin Associated Cardiotoxicity. Oxid. Med. Cell. Longev. 2016, 2016, 5724973. [Google Scholar] [CrossRef] [Scilit]
- Octavia, Y.; Tocchetti, C.G.; Gabrielson, K.L.; Janssens, S.; Crijns, H.J.; Moens, A.L. Doxorubicin-induced cardiomyopathy: From molecular mechanisms to therapeutic strategies. J. Mol. Cell. Cardiol. 2012, 52, 1213–1225. [Google Scholar] [CrossRef] [Scilit]
- Specenier, P.M.; Vermorken, J.B. Current concepts for the management of head and neck cancer: Chemotherapy. Oral Oncol. 2009, 45, 409–415. [Google Scholar] [CrossRef] [Scilit]
- Hannouf, M.B.; Sehgal, C.; Cao, J.Q.; Mocanu, J.D.; Winquist, E.; Zaric, G.S. Cost-Effectiveness of Adding Cetuximab to Platinum-Based Chemotherapy for First-Line Treatment of Recurrent or Metastatic Head and Neck Cancer. PLoS ONE 2012, 7, e38557. [Google Scholar] [CrossRef] [Scilit]
- Greenwell, M.; Rahman, P.K.S.M. Medicinal Plants: Their Use in Anticancer Treatment. Int. J. Pharm. Sci. Res. 2015, 6, 4103–4112. [Google Scholar] [CrossRef] [PubMed]
- Siddiqui, A.J.; Jahan, S.; Singh, R.; Saxena, J.; Ashraf, S.A.; Khan, A.; Choudhary, R.K.; Balakrishnan, S.; Badraoui, R.; Bardakci, F.; et al. Plants in Anticancer Drug Discovery: From Molecular Mechanism to Chemoprevention. BioMed Res. Int. 2022, 2022, 5425485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubik, J.; Waszak, Ł.; Adamczuk, G.; Humeniuk, E.; Iwan, M.; Adamczuk, K.; Michalczuk, M.; Korga-Plewko, A.; Józefczyk, A. Phytochemical Analysis and Anti-Cancer Properties of Extracts of Centaurea castriferrei Borbás & Waisb Genus of Centaurea L. Molecules 2022, 27, 7537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salachna, P.; Pietrak, A.; Łopusiewicz, Ł. Antioxidant Potential of Flower Extracts from Centaurea spp. Depends on Their Content of Phenolics, Flavonoids and Free Amino Acids. Molecules 2021, 26, 7465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Artun, F.T.; Karagöz, A. Antiproliferative and apoptosis inducing effects of the methanolic extract of Centaurea hermannii in human cervical cancer cell line. Biotech. Histochem. 2021, 96, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Baharfar, R.; Khalilzadeh, M.; Gheibi, S.; Jazayeri, O.; Azimi, R.; Tajbakhsh, M. Antioxidant and antibacterial activities of the methanolic extract of Centaurea zuvandica Sosn. J. Org. Chem. 2009, 3, 172–177. [Google Scholar]
- Radan, M.; Carev, I.; Tešević, V.; Politeo, O.; Čulić, V.Č. Qualitative HPLC-DAD/ESI-TOF-MS Analysis, Cytotoxic, and Apoptotic Effects of Croatian Endemic Centaurea ragusina L. Aqueous Extracts. Chem. Biodivers. 2017, 14, e1700099. [Google Scholar] [CrossRef] [Scilit]
- Bancheva, S.; Kaya, Z.; Binzet, R. Morphological, Cytological And Palynological Features Of Three Closely Related Centaurea Species (Asteraceae) From Turkey. Mod. Phytomorphol. 2014, 5, 79–84. [Google Scholar] [CrossRef]
- Aktumsek, A.; Zengin, G.; Guler, G.O.; Cakmak, Y.S.; Duran, A. Screening for in vitro antioxidant properties and fatty acid profiles of five Centaurea L. species from Turkey flora. Food Chem. Toxicol. 2011, 49, 2914–2920. [Google Scholar] [CrossRef] [Scilit]
- Hadjira, S.; Mansour, A.; Berkel, C.; Seghiri, R.; Menad, A.; Benayache, F.; Benayache, S.; Cacan, E.; Ameddah, S. Antioxidant, Anti-Inflammatory and Cytotoxic Properties of Centaurea africana Lamk var. [Bonnet] M. Anti-Inflamm. Anti-Allergy Agents Med. Chem. 2021, 20, 89–100. [Google Scholar] [CrossRef] [Scilit]
- Tutin, T.G.; Heywood, V.H.; Burges, N.A.; Moore, D.M.; Valentine, D.H.; Walters, S.M.; Webb, D.A. Flora Europaea. Volume 4. Plantaginaceae to Compositae (and Rubiaceae); Cambridge University Press: Cambridge, UK, 1976; ISBN 978-0-521-08717-9. [Google Scholar]
- Doxorubicin Hydrochloride-NCI. Available online: https://www.cancer.gov/about-cancer/treatment/drugs/doxorubicinhydrochloride (accessed on 30 November 2022).
- Minotti, G.; Menna, P.; Salvatorelli, E.; Cairo, G.; Gianni, L. Anthracyclines: Molecular Advances and Pharmacologic Developments in Antitumor Activity and Cardiotoxicity. Pharmacol. Rev. 2004, 56, 185–229. [Google Scholar] [CrossRef] [Scilit]
- Volkova, M.; Russell, R. Anthracycline Cardiotoxicity: Prevalence, Pathogenesis and Treatment. Curr. Cardiol. Rev. 2011, 7, 214–220. [Google Scholar] [CrossRef] [Scilit]
- Zhu, H.; Sarkar, S.; Scott, L.; Danelisen, I.; Trush, M.A.; Jia, Z.; Li, Y.R. Doxorubicin Redox Biology: Redox Cycling, Topoisomerase Inhibition, and Oxidative Stress. React. Oxyg. Species Apex NC 2016, 1, 189–198. [Google Scholar] [CrossRef] [Scilit]
- dos Santos, D.S.; dos Santos Goldenberg, R.C. Doxorubicin-Induced Cardiotoxicity: From Mechanisms to Development of Efficient Therapy. In Cardiotoxicity; Tan, W., Ed.; InTech: London, UK, 2018; ISBN 978-1-78984-237-1. [Google Scholar]
- Bouzghaia, B.; Moussa, M.T.B.; Goudjil, R.; Harkat, H.; Pale, P. Chemical composition, in vitro antioxidant and antibacterial activities of Centaurea resupinata subsp. dufourii (dostál) greuter. Nat. Prod. Res. 2021, 35, 4734–4739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Özcan, K.; Acet, T.; Çorbacı, C. Centaurea hypoleuca DC: Phenolic content, antimicrobial, antioxidant and enzyme inhibitory activities. South Afr. J. Bot. 2019, 127, 313–318. [Google Scholar] [CrossRef] [Scilit]
- Aboul-Soud, M.A.M.; Ennaji, H.; Kumar, A.; Alfhili, M.A.; Bari, A.; Ahamed, M.; Chebaibi, M.; Bourhia, M.; Khallouki, F.; Alghamdi, K.M.; et al. Antioxidant, Anti-Proliferative Activity and Chemical Fingerprinting of Centaurea calcitrapa against Breast Cancer Cells and Molecular Docking of Caspase-3. Antioxidants 2022, 11, 1514. [Google Scholar] [CrossRef] [Scilit]
- Korga, A.; Józefczyk, A.; Zgórka, G.; Homa, M.; Ostrowska, M.; Burdan, F.; Dudka, J. Evaluation of the phytochemical composition and protective activities of methanolic extracts of Centaurea borysthenica and Centaurea daghestanica (Lipsky) Wagenitz on cardiomyocytes treated with doxorubicin. Food Nutr. Res. 2017, 61, 1344077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosseini, A.; Safari, M.-K.; Rajabian, A.; Boroumand-Noughabi, S.; Eid, A.H.; Al Dhaheri, Y.; Gumpricht, E.; Sahebkar, A. Cardioprotective Effect of Rheum turkestanicum Against Doxorubicin-Induced Toxicity in Rats. Front. Pharmacol. 2022, 13, 909079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sreepriya, P.K.; Vijayan, F.P.; Pareeth, C.M.; Padikkala, J.; Babu, T.D. Cardioprotective effect of Justicia gendarussa on doxorubicin induced toxicity in mice. J. Basic Clin. Physiol. Pharmacol. 2022, 6, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Hu, B.; Zhen, D.; Bai, M.; Xuan, T.; Wang, Y.; Liu, M.; Yu, L.; Bai, D.; Fu, D.; Wei, C. Ethanol extracts of Rhaponticum uniflorum (L.) DC flowers attenuate doxorubicin-induced cardiotoxicity via alleviating apoptosis and regulating mitochondrial dynamics in H9c2 cells. J. Ethnopharmacol. 2022, 288, 114936. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaudhary, R.; Singh, R.; Verma, R.; Kumar, P.; Kumar, N.; Singh, L.; Kumar, S. Investigation on protective effect of Terminalia bellirica (Roxb.) against drugs induced cardiotoxicity in wistar albino rats. J. Ethnopharmacol. 2020, 261, 113080. [Google Scholar] [CrossRef] [Scilit]
- Sandamali, J.A.N.; Hewawasam, R.P.; Jayatilaka, K.A.P.W.; Mudduwa, L.K.B. Nauclea orientalis (L.) Bark Extract Protects Rat Cardiomyocytes from Doxorubicin-Induced Oxidative Stress, Inflammation, Apoptosis, and DNA Fragmentation. Oxid. Med. Cell. Longev. 2022, 2022, 1714841. [Google Scholar] [CrossRef] [Scilit]
- Sahu, R.; Dua, T.K.; Das, S.; De Feo, V.; Dewanjee, S. Wheat phenolics suppress doxorubicin-induced cardiotoxicity via inhibition of oxidative stress, MAP kinase activation, NF-κB pathway, PI3K/Akt/mTOR impairment, and cardiac apoptosis. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2019, 125, 503–519. [Google Scholar] [CrossRef] [Scilit]
- Yin, X.; He, X.; Wu, L.; Yan, D.; Yan, S. Chlorogenic Acid, the Main Antioxidant in Coffee, Reduces Radiation-Induced Apoptosis and DNA Damage via NF-E2-Related Factor 2 (Nrf2) Activation in Hepatocellular Carcinoma. Oxid. Med. Cell. Longev. 2022, 2022, 4566949. [Google Scholar] [CrossRef] [Scilit]
- Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-Ghazani, F.; et al. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed. Pharmacother. 2018, 97, 67–74. [Google Scholar] [CrossRef] [Scilit]
- Liang, N.; Kitts, D.D. Role of Chlorogenic Acids in Controlling Oxidative and Inflammatory Stress Conditions. Nutrients 2015, 8, 16. [Google Scholar] [CrossRef] [Scilit]
- Bouayed, J.; Rammal, H.; Dicko, A.; Younos, C.; Soulimani, R. Chlorogenic acid, a polyphenol from Prunus domestica (Mirabelle), with coupled anxiolytic and antioxidant effects. J. Neurol. Sci. 2007, 262, 77–84. [Google Scholar] [CrossRef] [Scilit]
- Yun, N.; Kang, J.-W.; Lee, S.-M. Protective effects of chlorogenic acid against ischemia/reperfusion injury in rat liver: Molecular evidence of its antioxidant and anti-inflammatory properties. J. Nutr. Biochem. 2012, 23, 1249–1255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, L.; Li, J.; Zha, D.; Zhang, L.; Gao, P.; Yao, T.; Wu, X. Chlorogenic acid prevents diabetic nephropathy by inhibiting oxidative stress and inflammation through modulation of the Nrf2/HO-1 and NF-ĸB pathways. Int. Immunopharmacol. 2018, 54, 245–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, N.; Wang, T.; Gan, Q.; Liu, S.; Wang, L.; Jin, B. Plant flavonoids: Classification, distribution, biosynthesis, and antioxidant activity. Food Chem. 2022, 383, 132531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben Toumia, I.; Sobeh, M.; Ponassi, M.; Banelli, B.; Dameriha, A.; Wink, M.; Chekir Ghedira, L.; Rosano, C. A Methanol Extract of Scabiosa atropurpurea Enhances Doxorubicin Cytotoxicity against Resistant Colorectal Cancer Cells In Vitro. Mol. Basel Switz. 2020, 25, 5265. [Google Scholar] [CrossRef] [Scilit]
- Srdic-Rajic, T.; Tisma-Miletic, N.; Cavic, M.; Kanjer, K.; Savikin, K.; Galun, D.; Konic-Ristic, A.; Zoranovic, T. Sensitization of K562 Leukemia Cells to Doxorubicin by the Viscum album Extract. Phytother. Res. PTR 2016, 30, 485–495. [Google Scholar] [CrossRef] [Scilit]
- Huang, T.; Gong, W.H.; Zou, C.P.; Li, X.C.; Jiang, G.J.; Li, X.H.; Qian, H. Marsdenia tenacissima extract sensitizes MG63 cells to doxorubicin-induced apoptosis. Genet. Mol. Res. GMR 2014, 13, 354–362. [Google Scholar] [CrossRef] [Scilit]
- Tayeh, Z.; Ofir, R. Asteriscus graveolens Extract in Combination with Cisplatin/Etoposide/Doxorubicin Suppresses Lymphoma Cell Growth through Induction of Caspase-3 Dependent Apoptosis. Int. J. Mol. Sci. 2018, 19, 2219. [Google Scholar] [CrossRef] [Scilit]
- Jeon, Y.-J.; Shin, J.-I.; Lee, S.; Lee, Y.G.; Kim, J.B.; Kwon, H.C.; Kim, S.H.; Kim, I.; Lee, K.; Han, Y.S. Angelica gigas Nakai Has Synergetic Effects on Doxorubicin-Induced Apoptosis. BioMed Res. Int. 2018, 2018, 6716547. [Google Scholar] [CrossRef] [Scilit]
- Korga, A.; Iwan, M.; Matosiuk, D.; Rzadkowska, M.; Szacon, E.; Humeniuk, E.; Sysa, M.; Ostrowska, M.; Dudka, J. New tirapazamine derivatives protect cardiomyocytes from doxorubicin toxicity. Curr. Issues Pharm. Med. Sci. 2020, 33, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Witek, P.; Korga, A.; Burdan, F.; Ostrowska, M.; Nosowska, B.; Iwan, M.; Dudka, J. The effect of a number of H9C2 rat cardiomyocytes passage on repeatability of cytotoxicity study results. Cytotechnology 2016, 68, 2407–2415. [Google Scholar] [CrossRef] [Scilit]
- Pitucha, M.; Korga-Plewko, A.; Czylkowska, A.; Rogalewicz, B.; Drozd, M.; Iwan, M.; Kubik, J.; Humeniuk, E.; Adamczuk, G.; Karczmarzyk, Z.; et al. Influence of Complexation of Thiosemicarbazone Derivatives with Cu (II) Ions on Their Antitumor Activity against Melanoma Cells. Int. J. Mol. Sci. 2021, 22, 3104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Melo Santana, B.; Pieretti, J.C.; Gomes, R.N.; Cerchiaro, G.; Seabra, A.B. Cytotoxicity towards Breast Cancer Cells of Pluronic F-127/Hyaluronic Acid Hydrogel Containing Nitric Oxide Donor and Silica Nanoparticles Loaded with Cisplatin. Pharmaceutics 2022, 14, 2837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adamczuk, G.; Humeniuk, E.; Adamczuk, K.; Grabarska, A.; Dudka, J. 2,4-Dinitrophenol as an Uncoupler Augments the Anthracyclines Toxicity against Prostate Cancer Cells. Molecules 2022, 27, 7227. [Google Scholar] [CrossRef] [Scilit]
- Takács, A.; Lajkó, E.; Láng, O.; Istenes, I.; Kőhidai, L. Alpha-lipoic acid alters the antitumor effect of bortezomib in melanoma cells in vitro. Sci. Rep. 2020, 10, 14287. [Google Scholar] [CrossRef] [Scilit]
- Kuruburu, M.G.; Bovilla, V.R.; Naaz, R.; Leihang, Z.; Madhunapantula, S.V. Variations in the Anticancer Activity of Free and Bound Phenolics of Finger Millet (Eleusine coracana (L) Gaertn; Variety KMR-301) Seeds. Phytomedicine Plus 2022, 2, 100276. [Google Scholar] [CrossRef] [Scilit]
- Allambergenova, Z.; Kasela, M.; Adamczuk, G.; Humeniuk, E.; Iwan, M.; Świątek, Ł.; Boguszewska, A.; Rajtar, B.; Józefczyk, A.; Baj, T.; et al. Phytochemical Profile and Biological Activity of the Ethanolic Extract from the Aerial Part of Crocus alatavicus Regel & Semen Growing Wildly in Southern Kazakhstan. Molecules 2022, 27, 3468. [Google Scholar] [CrossRef] [Scilit]
- Hsieh, S.-L.; Li, J.-H.; Dong, C.-D.; Chen, C.-W.; Wu, C.-C. Carnosine suppresses human colorectal cancer cell proliferation by inducing necroptosis and autophagy and reducing angiogenesis. Oncol. Lett. 2022, 23, 44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maszczyk, M.; Banach, K.; Karkoszka, M.; Rzepka, Z.; Rok, J.; Beberok, A.; Wrześniok, D. Chemosensitization of U-87 MG Glioblastoma Cells by Neobavaisoflavone towards Doxorubicin and Etoposide. Int. J. Mol. Sci. 2022, 23, 5621. [Google Scholar] [CrossRef] [Scilit]
- Korga, A.; Ostrowska, M.; Jozefczyk, A.; Iwan, M.; Wojcik, R.; Zgorka, G.; Herbet, M.; Vilarrubla, G.G.; Dudka, J. Apigenin and hesperidin augment the toxic effect of doxorubicin against HepG2 cells. BMC Pharmacol. Toxicol. 2019, 20, 22. [Google Scholar] [CrossRef] [Scilit]
- Bonnay, F.; Veloso, A.; Steinmann, V.; Köcher, T.; Abdusselamoglu, M.D.; Bajaj, S.; Rivelles, E.; Landskron, L.; Esterbauer, H.; Zinzen, R.P.; et al. Oxidative Metabolism Drives Immortalization of Neural Stem Cells during Tumorigenesis. Cell 2020, 182, 1490–1507.e19. [Google Scholar] [CrossRef] [Scilit]
- Niture, S.; Gyamfi, M.A.; Lin, M.; Chimeh, U.; Dong, X.; Zheng, W.; Moore, J.; Kumar, D. TNFAIP8 regulates autophagy, cell steatosis, and promotes hepatocellular carcinoma cell proliferation. Cell Death Dis. 2020, 11, 178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adamczuk, G.; Humeniuk, E.; Adamczuk, K.; Madej-Czerwonka, B.; Dudka, J. Disruption of mitochondrial function augments the radiosensitivity of prostate cancer cell lines. Ann. Agric. Environ. Med. 2022, 2, 12–24. [Google Scholar] [CrossRef] [Scilit]
- Fast SG/ROX qPCR Master Mix (2x). Available online: https://eurx.com.pl/product/e0413/ (accessed on 24 December 2022).









| Main Components | CAS MeOH | CAS H2O | ||||
|---|---|---|---|---|---|---|
| Content (mg/g) | Content (mg/g) | |||||
| ±SD | ±RSD | ±SD | ±RSD | |||
| Neochlorogenic acid | 0.90 | 0.01 | 0.6 | 0.51 | 0.00 | 0.2 |
| Chlorogenic acid | 4.14 | 0.03 | 0.7 | 1.30 | 0.01 | 0.5 |
| Cryptochlorogenic acid | 0.11 | 0.00 | 1.7 | 0.04 | 0.00 | 0.0 |
| Caffeic acid | 0.09 | 0.00 | 0.7 | 0.09 | 0.00 | 1.0 |
| Protocatechuic acid | 0.26 | 0.01 | 3.5 | 0.17 | 0.00 | 2.2 |
| Chlorogenic acid glucoside | 1.70 | 0.00 | 0.1 | 0.14 | 0.00 | 0.9 |
| Caffeic acid derivative | 0.16 | 0.00 | 1.4 | 0.08 | 0.00 | 0.4 |
| Apigenin derivative | 0.40 | 0.01 | 1.3 | 0.21 | 0.00 | 0.2 |
| Luteolin 7-O-glucoside | 0.85 | 0.01 | 0.6 | 0.51 | 0.01 | 2.4 |
| Apigenin 7-O-glucoside | 0.17 | 0.00 | 0.4 | None | - | - |
| Apigenin 7-O-glucuronide | 5.26 | 0.02 | 0.3 | 1.76 | 0.01 | 0.3 |
| Dimethylapigenin | 0.56 | 0.00 | 0.3 | 0.11 | 0.00 | 0.6 |
| Dihydrokaempferol | 0.82 | 0.02 | 0.0 | 0.23 | 0.00 | 0.0 |
| Kaempferol dihydroglucoside | 0.09 | 0.00 | 0.0 | None | - | - |
| Kaempferol glucoside | 0.08 | 0.00 | 0.0 | None | - | - |
| Centaurein | 3.97 | 0.02 | 0.4 | 0.16 | 0.00 | 0.6 |
| Jacein | 1.21 | 0.00 | 0.2 | None | 0 | 0 |
| Apigenin | 7.32 | 0.03 | 0.4 | 0.38 | 0.01 | 2.6 |
| Luteolin | 0.13 | 0.00 | 0.0 | None | - | - |
| No. | Name of Compound | TR (min) | Molecular Ion (M − H) (m/z) | MS/MS Fragments (m/z) |
|---|---|---|---|---|
| 1 | Chlorogenic acid | 15.735 | 353.0846 | 191.0542 |
| 2 | Feruloquinic acid | 20.158 | 367.0989 | 191.0531; 134.0258; 93.0413 |
| 3 | Apigenin glucuronide-glucoside | 21.429 | 607.1286 | 431.0946; 269.0409; 175.0196; 113.0224 |
| 4 | Kaempferide glucoside | 23.376 | 463.0861 | 301.0397; 151.0012; 97.3310 |
| 5 | Isorhamnetin glucoside | 24.507 | 477.1000 | 315.0631 |
| 6 | Chlorogenic acid glucoside | 25.911 | 515.1150 | 353.0852; 191.0536 |
| 7 | Isorhamnetin glucuronide | 26.546 | 491.1154 | 315.0631 |
| 8 | Apigenin glucuronide | 27.153 | 445.0736 | 269.0441; 175.0241; 113.0202 |
| 9 | Centaurein | 27.455 | 521.1231 | 506.1033; 343.0375 |
| 10 | Jacein | 27.960 | 521.1240 | 506.1076; 359.0687; 343.0444 |
| 11 | Hispidulin glucuronide | 28.282 | 475.0842 | 299.0494; 284.0258; 255.0054; 227.0327; 85.0249 |
| 12 | Isorhamnetin | 30.863 | 315.0470 | 300.0327; 199.0447; 65.0458 |
| 13 | Luteolin | 31.090 | 285.0475 | 133.0242; 107.0099 |
| 14 | Apigenin | 34.074 | 269.0310 | 117.0348 |
| 15 | Hispidulin | 35.317 | 299.0524 | 283.0272; 255.0443; 227.0484 |
| No. | Name of Compound | TR (min) | Molecular Ion (M − H) (m/z) | MS/MS Fragments (m/z) |
|---|---|---|---|---|
| 1 | Quinic acid | 1.865 | 191.0525 | 111.0543 |
| 2 | Protocatechuic acid glucoside | 7.799 | 153.0165 | 153.0154; 109.0277 |
| 3 | Chlorogenic acid | 10.087 | 353.0863 | 191.0532; 179.0320 |
| 4 | Neochlorogenic acid | 15.646 | 353.4838 | 191.0520; 135.0389; 85.0277 |
| 5 | Feruloylquinic acid | 20.186 | 367.0987 | 191.0571; 134.0351; 93.0317 |
| 6 | Ferulic acid | 25.478 | 193.0472 | 133.0283 |
| 7 | Apigenin glucuronide | 27.153 | 445.0736 | 269.0440; 175.0241; 113.0202 |
| 8 | Apigenin | 34.138 | 269.0439 | 117.0334 |
| Gene Symbol | Gene Name | Forward Sequence (5′→3′) | Reverse Sequence (5′→3′) |
|---|---|---|---|
| CAT | Catalase | GCTCCGCAATCCTACACCAT | GGACATCGGGTTTCTGAGGG |
| GPX1 | Glutathione peroxidase 1 | CAATCAGTTCGGACATCAGGAGA | TAAAGAGCGGGTGAGCCTTC |
| GSR | Glutathione-disulfide reductase | CAAGGAGAAGCGGGATGCTT | ACTTCGATGTGGGACTTGGTT |
| SOD1 | Superoxide dismutase 1 | GGCCGTACTATGGTGGTCC | CCAATCACACCACAAGCCAAG |
| NFE2L2 | NFE2-like bZIP transcription factor 2 | CTACAGTCCCAGCAGGACAT | GCAAGCGACTGAAATGTAGGTG |
| RNA18SN5 | 18S ribosomal N5 | GAAACTGCGAATGGCTCATTAAA | CACAGTTATCCAAGTGGGAGAGG |
| BACT | Beta-actin | AGAGCTACGAGCTGCCTGAC | AGCACTGTGTTGGCGTACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Humeniuk, E.; Adamczuk, G.; Kubik, J.; Adamczuk, K.; Józefczyk, A.; Korga-Plewko, A. Cardioprotective Effect of Centaurea castriferrei Borbás & Waisb Extract against Doxorubicin-Induced Cardiotoxicity in H9c2 Cells. Molecules 2023, 28, 420. https://doi.org/10.3390/molecules28010420
Humeniuk E, Adamczuk G, Kubik J, Adamczuk K, Józefczyk A, Korga-Plewko A. Cardioprotective Effect of Centaurea castriferrei Borbás & Waisb Extract against Doxorubicin-Induced Cardiotoxicity in H9c2 Cells. Molecules. 2023; 28(1):420. https://doi.org/10.3390/molecules28010420
Chicago/Turabian StyleHumeniuk, Ewelina, Grzegorz Adamczuk, Joanna Kubik, Kamila Adamczuk, Aleksandra Józefczyk, and Agnieszka Korga-Plewko. 2023. "Cardioprotective Effect of Centaurea castriferrei Borbás & Waisb Extract against Doxorubicin-Induced Cardiotoxicity in H9c2 Cells" Molecules 28, no. 1: 420. https://doi.org/10.3390/molecules28010420
APA StyleHumeniuk, E., Adamczuk, G., Kubik, J., Adamczuk, K., Józefczyk, A., & Korga-Plewko, A. (2023). Cardioprotective Effect of Centaurea castriferrei Borbás & Waisb Extract against Doxorubicin-Induced Cardiotoxicity in H9c2 Cells. Molecules, 28(1), 420. https://doi.org/10.3390/molecules28010420

