Pogostone Enhances the Antibacterial Activity of Colistin against MCR-1-Positive Bacteria by Inhibiting the Biological Function of MCR-1
Abstract
:1. Introduction
2. Results
2.1. Pogostone Restored the Antimicrobial Activity of Colistin without Influencing the Growth of the Tested Bacteria
2.2. Identification of the Binding Mode of Pogostone with MCR-1/MCR-3
2.3. Pogostone, Combined with Colistin, Had a Synergistic Effect Compared with Monotherapy In Vivo
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Chemicals
4.2. Animals and Cell Lines
4.3. Plasmid Construction
4.4. MIC Assays, Checkerboard MIC Assay, and FIC Index Determination
4.5. Time Killing Assays
4.6. Growth Curve
4.7. Combined Disk Tests (CDT)
4.8. Bacterial Live/Dead Assays
4.9. Scanning Electron Microscope (SEM) Analysis
4.10. Western Blot Analysis
4.11. Molecular Modelling
4.12. Cytotoxicity Analysis
4.13. Animal Studies
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- van Duin, D.; Kaye, K.S.; Neuner, E.A. Carbapenem-resistant Enterobacteriaceae: A review of treatment and outcomes. Diagn. Microbiol. Infect. Dis. 2013, 75, 115–120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karaiskos, I.; Giamarellou, H. Multidrug-resistant and extensively drug-resistant Gram-negative pathogens: Current and emerging therapeutic approaches. Expert Opin. Pharmacother. 2014, 15, 1351–1370. [Google Scholar] [CrossRef] [PubMed]
- Qu, X.; Bian, X.; Chen, Y. Polymyxin B Combined with Minocycline: A Potentially Effective Combination against blaOXA-23-harboring CRAB in In Vitro PK/PD Model. Molecules 2022, 27, 1085. [Google Scholar] [CrossRef] [PubMed]
- Watkins, R.R.; Smith, T.C.; Bonomo, R.A. On the path to untreatable infections: Colistin use in agriculture and the end of “last resort” antibiotics. Expert Rev. Anti-Infect. Ther. 2016, 14, 785–788. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.Y.; Wang, Y.; Walsh, T.R. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Falgenhauer, L.; Waezsada, S.E.; Yao, Y. Colistin resistance gene mcr-1 in extended-spectrum β-lactamase-producing and carbapenemase-producing Gram-negative bacteria in Germany. Lancet Infect Dis. 2016, 16, 282–283. [Google Scholar] [CrossRef] [Green Version]
- Santos, A.; Silva, M.; Araújo-Júnior, J.X. Revealing Insights into Natural Products Against mcr-1-Producing Bacteria. Curr. Drug Targets. 2021, 22, 1964–1985. [Google Scholar] [CrossRef]
- Annunziato, G.; Spadini, C.; Franko, N. Investigational Studies on a Hit Compound Cyclopropane–Carboxylic Acid Derivative Targeting O-Acetylserine Sulfhydrylase as a Colistin Adjuvant. ACS Infect. Dis. 2021, 7, 281–292. [Google Scholar] [CrossRef]
- Zhou, Y.; Liu, S.; Wang, T. Pterostilbene, a Potential MCR-1 Inhibitor That Enhances the Efficacy of Polymyxin, B. Antimicrob. Agents Chemother. 2018, 62, e02146-17. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Wang, J.; Guo, Y. Discovery of a potential MCR-1 inhibitor that reverses polymyxin activity against clinical mcr-1-positive Enterobacteriaceae. J. Infect. 2019, 78, 364–372. [Google Scholar] [CrossRef]
- Wang, X.F.; Huang, Y.F.; Wang, L. Photo-protective activity of pogostone against UV-induced skin premature aging in mice. Exp. Gerontol. 2016, 77, 76–86. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.-M.; Liao, H.; Liu, Y.; Zheng, Y.; Wu, X.; Su, Z.; Zhang, X.; Lai, Z.; Lai, X.; Lin, Z.-X.; et al. Protective effects of pogostone from Pogostemonis Herba against ethanol-induced gastric ulcer in rats. Fitoterapia 2015, 100, 110–117. [Google Scholar] [CrossRef] [PubMed]
- Peng, F.; Wan, F.; Xiong, L.; Peng, C.; Dai, M.; Chen, J. In vitro and in vivo antibacterial activity of Pogostone. Chin. Med. J. 2014, 127, 4001–4005. [Google Scholar] [PubMed]
- Li, Q.Q.; Huo, Y.Y.; Chen, C.J.; Zeng, Z.Y.; Xu, F.R.; Cheng, Y.X.; Dong, X. Biological Activities of Two Essential Oils from Pogostemon cablin and Eupatorium fortunei and Their Major Components against Fungi Isolated from Panax notoginseng. Chem. Biodivers. 2020, 17, e2000520. [Google Scholar] [CrossRef] [PubMed]
- Breijyeh, Z.; Jubeh, B.; Karaman, R. Resistance of Gram-Negative Bacteria to Current Antibacterial Agents and Approaches to Resolve It. Molecules 2020, 25, 1340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rezai, K.; Weinstein, R.A. Reducing Antimicrobial-Resistant Infections in Health Care Settings: What Works? Antimicrob. Resist. Beyond Break. 2010, 6, 89–101. [Google Scholar]
- Junren, C.; Xiaofang, X.; Mengting, L.; Qiuyun, X.; Gangmin, L.; Huiqiong, Z.; Guanru, C.; Xin, X.; Yanpeng, Y.; Fu, P.; et al. Pharmacological activities and mechanisms of action of Pogostemon cablin Benth: A review. Chin Med. 2021, 16, 5. [Google Scholar] [CrossRef]
- Osawa, K.; Matsumoto, T.; Maruyama, T.; Takiguchi, T.; Okuda, K.; Takazoe, I. Studies of the antibacterial activity of plant extracts and their constituents against periodontopathic bacteria. Bull. Tokyo Dent. Coll. 1990, 31, 17–21. [Google Scholar]
- Wang, X.Y.; Chen, Y.Y.; Bao, J.K. Study on the molecular mechanism of pogotone against Staphylococcus aureus. Chin. J. Antibiot. 2018, 43, 759–764. [Google Scholar]
- Sabnis, S.; Fakhra, S. Synthesis of Silver Nanoparticles using Costusspeciosus and study of its anti-microbial properties against urinary tract pathogens. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 248–252. [Google Scholar]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; sixteenth informational supplement. CLSI document M100-S16CLSI; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2006. [Google Scholar]
- Trott, O.; Arthur, J.O. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2009, 31, 455–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanner, M.F. Python: A programming language for software integration and development. J. Mol. Graph. Model. 1999, 17, 57–61. [Google Scholar] [PubMed]
- Pierce, L.C.; Salomon-Ferrer, R.; De Oliveira, C.A.F.; McCammon, J.A.; Walker, R.C. Routine Access to Millisecond Time Scale Events with Accelerated Molecular Dynamics. J. Chem. Theory Comput. 2012, 8, 2997–3002. [Google Scholar] [CrossRef] [PubMed]
- Salomon-Ferrer, R.; Götz, A.W.; Poole, D.; Le Grand, S.; Walker, R.C. Routine Microsecond Molecular Dynamics Simulations with AMBER on GPUs. 2. Explicit Solvent Particle Mesh Ewald. J. Chem. Theory Comput. 2013, 9, 3878–3888. [Google Scholar] [CrossRef] [PubMed]
- da Silva, S.; Alan, W.; Wim, F.V. ACPYPE-Antechamber python parser interface. BMC Res. Notes 2012, 5, 367. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Wang, W.; Kollman, P.A.; Case, D.A. Automatic atom type and bond type perception in molecular mechanical calculations. J. Mol. Graph. Model. 2006, 25, 247–260. [Google Scholar] [CrossRef]






| Species | Source | mcr-1/3/5/8 Confirmation | Antibiotics | MIC (μg/mL) | FIC Index | |
|---|---|---|---|---|---|---|
| Alone | Combination | |||||
| E. coli ZJ487 | Human intra-abdominal fluid (blaNDM-1-carrying) | + | Colistin | 24.00 ± 8.00 | 2.00 ± 0.00 | 0.22 ± 0.03 |
| K. pneumoniae ZJ02 | Remote tertiary care hospital | + | Colistin | 48.00 ± 16.00 | 4.00 ± 0.00 | 0.22 ± 0.03 |
| E. coli BL21(DE3) (pET28a-mcr-1) | Laboratory strain (carried a mcr-1 gene that originated from K. pneumoniae ZJ05) | + | Colistin | 12.00 ± 4.00 | 3.00 ± 1.00 | 0.31 ± 0.00 |
| S. typhimurium HYM2 | Animal farm | + | Colistin | 48.00 ± 16.00 | 4.00 ± 0.00 | 0.22 ± 0.03 |
| E. coli DZ2-12R | Chicken cloacae | + | Colistin | 16.00 ± 0.00 | 3.50 ± 0.87 | 0.34 ± 0.05 |
| Salmonella 15E464 | I4,5,12:i:- (carried a mcr-3 gene) | + | Colistin | 56.00 ± 13.86 | 5.00 ± 1.73 | 0.22 ± 0.03 |
| E. coli MG1655 (pBAD24-mcr-5) | Laboratory strain (carried a mcr-5 gene) | + | Colistin | 28.00 ± 6.93 | 1.50 ± 0.50 | 0.19 ± 0.04 |
| Salmonella ZZW20 | Animal farm (carried a mcr-8 gene) | + | Colistin | 160.0 ± 55.43 | 7.00 ± 1.73 | 0.17 ± 0.02 |
| K. pneumoniae 16ZJJ9-19BC | Chicken cloacae (Polymyxin-resistant mcr-negative) | - | Colistin | 80.00 ± 27.71 | 10.00 ± 3.46 | 0.19 ± 0.00 |
| E. coli HLJ 109-11(PmrB mutation) | pmr B mutation (Polymyxin-resistant mcr-negative) | - | Colistin | 448.00 ± 110.85 | 64.00 ± 39.19 | 0.27 ± 0.07 |
| E. coli ATCC 25922 | Laboratory strain | - | Colistin | 1.50 ± 0.50 | 1.25 ± 0.43 | 1.00 ± 0.22 |
| K. pneumoniae ATCC 700603 | Laboratory strain | - | Colistin | 1.25 ± 0.43 | 1.00 ± 0.00 | 0.94 ± 0.22 |
| E. coli W3110 (pUC19-mcr-3) | Laboratory strain | + | Colistin | 7.00 ± 1.73 | 1.50 ± 0.50 | 0.34 ± 0.05 |
| Primers Name | Oligonucleotide (5′-3′) |
|---|---|
| MCR-1-D327A | F:GCGTAAGTATCTTGTGGCGTGCGAATAATTCGGACTCAAAAGGC R:GCCTTTTGAGTCCGAATTATTCGCACGCCACAAGATACTTACGC |
| MCR-1-D331A | F:GCGTGATAATAATTCGGCGTCAAAAGGCGTGATGG R:CCATCACGCCTTTTGACGCCGAATTATTATCACGC |
| MCR-1-S332A | F:CGTGATAATAATTCGGACGCGAAAGGCGTGATGGATAAG R:CTTATCCATCACGCCTTTCGCGTCCGAATTATTATCACG |
| MCR-1-M336A | F:GGACTCAAAAGGCGTGGCGGATAAGCTGCCAAAAG R:CTTTTGGCAGCTTATCCGCCACGCCTTTTGAGTCC |
| MCR-1-Q343A | F:GATAAGCTGCCAAAAGCGGCGTTTGCCGATTATAAATCC R:GGATTTATAATCGGCAAACGCCGCTTTTGGCAGCTTATC |
| MCR-1-D346A | F:CAAAAGCGCAATTTGCCGCGTATAAATCCGCGACCAAC R:GTTGGTCGCGGATTTATACGCGGCAAATTGCGCTTTTG |
| MCR-1-WT | F:CGCGGATCCATGATGCAGCATACTTCT R:CCGCTCGAGTCAGCGGATGAATGCGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, S.; Li, L.; Zhan, B.; Shen, X.; Deng, X.; Tan, W.; Fang, T. Pogostone Enhances the Antibacterial Activity of Colistin against MCR-1-Positive Bacteria by Inhibiting the Biological Function of MCR-1. Molecules 2022, 27, 2819. https://doi.org/10.3390/molecules27092819
Xie S, Li L, Zhan B, Shen X, Deng X, Tan W, Fang T. Pogostone Enhances the Antibacterial Activity of Colistin against MCR-1-Positive Bacteria by Inhibiting the Biological Function of MCR-1. Molecules. 2022; 27(9):2819. https://doi.org/10.3390/molecules27092819
Chicago/Turabian StyleXie, Shengnan, Li Li, Baihe Zhan, Xue Shen, Xuming Deng, Wenxi Tan, and Tianqi Fang. 2022. "Pogostone Enhances the Antibacterial Activity of Colistin against MCR-1-Positive Bacteria by Inhibiting the Biological Function of MCR-1" Molecules 27, no. 9: 2819. https://doi.org/10.3390/molecules27092819
APA StyleXie, S., Li, L., Zhan, B., Shen, X., Deng, X., Tan, W., & Fang, T. (2022). Pogostone Enhances the Antibacterial Activity of Colistin against MCR-1-Positive Bacteria by Inhibiting the Biological Function of MCR-1. Molecules, 27(9), 2819. https://doi.org/10.3390/molecules27092819

