The Influence of Bacteria Causing Subclinical Mastitis on the Structure of the Cow’s Milk Microbiome
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Characterization of the Farms
4.2. Sampling
4.3. Isolation of DNA
4.4. PCR Amplification and NGS Sequencing
4.5. Bioinformatic Analysis
4.6. Determination of Pathogens
4.7. Determination of the Number of Somatic Cells in Milk
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Gomes, F.; Henriques, M. Control of Bovine Mastitis: Old and Recent Therapeutic Approaches. Curr. Microbiol. 2016, 72, 377–382. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruegg, P.L. A 100-Year Review: Mastitis detection, management, and prevention. J. Dairy Sci. 2017, 100, 10381–10397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Izquierdo, A.C.; Guerra Liera, J.E.; Cervantes, R.E.; Inzunza Castro, J.F.; Villa Mancera, E.A.; Huerta Crispin, R.; Juarez Mosqueda, M.d.L.; Vazquez, A.G.; Olivares Perez, J.; Aparicio, P.S.; et al. Production of Milk and Bovine Mastitis. J. Adv. Dairy Res. 2017, 5, 174. [Google Scholar] [CrossRef] [Green Version]
- Jagielski, T.; Krukowski, H.; Bochniarz, M.; Piech, T.; Roeske, K.; Bakuła, Z.; Wlazło, Ł.; Woch, P. Prevalence of Prototheca spp. on dairy farms in Poland—A cross-country study. Microb. Biotechnol. 2019, 12, 556–566. [Google Scholar] [CrossRef] [Green Version]
- Jagielski, T.; Roeske, K.; Bakuła, Z.; Piech, T.; Wlazło, Ł.; Bochniarz, M.; Woch, P.; Krukowski, H. A survey on the incidence of Prototheca mastitis in dairy herds in Lublin province, Poland. J. Dairy Sci. 2019, 102, 619–628. [Google Scholar] [CrossRef] [Green Version]
- Krishnamoo, P.; Satyanaray, M.L.; Shome, B.R. Coagulase Negative Staphylococcal Species Mastitis: An Overview. Res. J. Vet. Sci. 2016, 9, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Petrovski, K.R.; Trajcev, M.; Buneski, G. A review of the factors affecting the costs of bovine mastitis: Review article. J. S. Afr. Vet. Assoc. 2006, 77, 52–60. [Google Scholar] [CrossRef] [Green Version]
- Oliver, S.P.; Murinda, S.E. Antimicrobial resistance of mastitis pathogens. Vet. Clin. N. Am.-Food Anim. Pract. 2012, 28, 165–185. [Google Scholar] [CrossRef]
- Preethirani, P.L.; Isloor, S.; Sundareshan, S.; Nuthanalakshmi, V.; Deepthikiran, K.; Sinha, A.Y.; Rathnamma, D.; Prabhu, K.N.; Sharada, R.; Mukkur, T.K.; et al. Isolation, biochemical and molecular identification, and in-vitro antimicrobial resistance patterns of bacteria isolated from bubaline subclinical mastitis in South India. PLoS ONE 2015, 10, e0142717. [Google Scholar] [CrossRef]
- Ahsani, M.R.; Bafti, M.S.; Esmailizadeh, A.K.; Mohammadabadi, M.R. Genotyping of isolates of Clostridium perfringens from vaccinated and unvaccinated sheep. Small Rumin. Res. 2011, 95, 65–69. [Google Scholar] [CrossRef]
- Ahsani, M.R.; Mohammadabadi, M.R.; Shamsaddini, M.B. Clostridium perfringens isolate typing by multiplex PCR. J. Venom. Anim. Toxins Incl. Trop. Dis. 2010, 16, 573–578. [Google Scholar] [CrossRef] [Green Version]
- Mohammadabadi, M.R.; Soflaei, M.; Mostafavi, H.; Honarmand, M. Using PCR for early diagnosis of bovine leukemia virus infection in some native cattle. Genet. Mol. Res. 2011, 10, 2658–2663. [Google Scholar] [CrossRef] [PubMed]
- Oikonomou, G.; Addis, M.F.; Chassard, C.; Nader-Macias, M.E.F.; Grant, I.; Delbès, C.; Bogni, C.I.; Le Loir, Y.; Even, S. Milk Microbiota: What Are We Exactly Talking About? Front. Microbiol. 2016, 11, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoque, M.N.; Istiaq, A.; Clement, R.A.; Sultana, M.; Crandall, K.A.; Siddiki, A.Z.; Hossain, M.A. Metagenomic deep sequencing reveals association of microbiome signature with functional biases in bovine mastitis. Sci. Rep. 2019, 9, 13536. [Google Scholar] [CrossRef] [Green Version]
- Hornik, B.; Czarny, J.; Staninska-Pięta, J.; Wolko, Ł.; Cyplik, P.; Piotrowska-Cyplik, A. The Raw Milk Microbiota from Semi- Subsistence Farms Characteristics by NGS Analysis Method. Molecules 2021, 26, 5029. [Google Scholar] [CrossRef]
- Oikonomou, G.; Bicalho, M.L.; Meira, E.; Rossi, R.E.; Foditsch, C.; Machado, V.S.; Teixeira, A.G.V.; Santisteban, C.; Schukken, Y.H.; Bicalho, R.C. Microbiota of cow’s milk; distinguishing healthy, sub-clinically and clinically diseased quarters. PLoS ONE 2014, 9, e85904. [Google Scholar] [CrossRef] [Green Version]
- Addis, M.F.; Tanca, A.; Uzzau, S.; Oikonomou, G.; Bicalho, R.C.; Moroni, P. The bovine milk microbiota: Insights and perspectives from-omics studies. Mol. Biosyst. 2016, 12, 2359–2372. [Google Scholar] [CrossRef] [Green Version]
- Derakhshani, H.; Fehr, K.B.; Sepehri, S.; Francoz, D.; De Buck, J.; Barkema, H.W.; Plaizier, J.C.; Khafipour, E. Invited review: Microbiota of the bovine udder: Contributing factors and potential implications for udder health and mastitis susceptibility. J. Dairy Sci. 2018, 101, 10605–10625. [Google Scholar] [CrossRef] [Green Version]
- Angelopoulou, A.; Holohan, R.; Rea, M.C.; Warda, A.K.; Hill, C.; Ross, R.P. Bovine mastitis is a polymicrobial disease requiring a polydiagnostic approach. Int. Dairy J. 2019, 99, 104539. [Google Scholar] [CrossRef]
- Gao, J.; Liu, Y.-C.; Wang, Y.; Li, H.; Wang, X.-M.; Wu, Y.; Zhang, D.-R.; Gao, S.; Qi, Z. Impact of yeast and lactic acid bacteria on mastitis and milk microbiota composition of dairy cows. AMB Expr. 2020, 10, 22. [Google Scholar] [CrossRef]
- Porcellato, D.; Aspholm, M.; Skeie, S.B.; Monshaugen, M.; Brendehaug, J.; Mellegård, H. Microbial diversity of consumption milk during processing and storage. Int. J. Food Microbiol. 2018, 266, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Castro, I.; Alba, C.; Aparicio, M.; Arroyo, R.; Lorena, J.; Fernández, L.; Arias, R.; Rodríguez, J.M. Metataxonomic and immunological analysis of milk from ewes with or without a history of mastitis. J. Dairy Sci. 2019, 102, 9298–9311. [Google Scholar] [CrossRef] [PubMed]
- Doyle, C.J.; Gleeson, D.; O’Toole, P.W.; Cotter, P.D. Impacts of seasonal housing and teat preparation on raw milk microbiota: A highthroughput sequencing study. Appl. Environ. Microbiol. 2017, 83, e02694-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skeie, S.B.; Håland, M.; Thorsen, I.M.; Narvhus, J.; Porcellato, D. Bulk tank raw milk microbiota differs within and between farms: A moving goalpost challenging quality control. J. Dairy Sci. 2019, 102, 1959–1971. [Google Scholar] [CrossRef] [Green Version]
- Tilocca, B.; Costanzo, N.; Morittu, V.M.; Spina, A.A.; Soggiu, A.; Britti, D.; Roncada, P.; Piras, C. Milk microbiota: Characterization methods and role in cheese production. J. Proteom. 2020, 210, 103534. [Google Scholar] [CrossRef]
- Lima, S.F.; Bicalho, M.L.S.; Bicalho, R.C. Evaluation of milk sample fractions for characterization of milk microbiota from healthy and clinical mastitis cows. PLoS ONE 2018, 13, e0193671. [Google Scholar] [CrossRef] [Green Version]
- Rossi, R.S.; Amarante, A.F.; Correia, L.B.N.; Guerra, S.T.; Nobrega, D.B.; Latosinski, G.S.; Rossi, B.F.; Rall, V.L.M.; Pantoja, J.C.F. Diagnostic accuracy of Somaticell, California Mastitis Test, and microbiological examination of composite milk to detect Streptococcus agalactiae intramammary infections. J. Dairy Sci. 2018, 101, 10220–10229. [Google Scholar] [CrossRef] [Green Version]
- Rosini, R.; Margarit, I. Biofilm formation by Streptococcus agalactiae: Influence of environmental conditions and implicated virulence factors. Front. Cell. Infect. Microbiol. 2015, 5, 6. [Google Scholar] [CrossRef] [Green Version]
- Makovec, J.A.; Ruegg, P.L. Results of Milk Samples Submitted for Microbiological Examination in Wisconsin from 1994 to 2001. J. Dairy Sci. 2003, 86, 3466–3472. [Google Scholar] [CrossRef] [Green Version]
- Jørgensen, H.J.; Nordstoga, A.B.; Sviland, S.; Zadoks, R.N.; Sølverød, L.; Kvitle, B.; Mørk, T. Streptococcus agalactiae in the environment of bovine dairy herds—Rewriting the textbooks? Vet. Microbiol. 2016, 184, 64–72. [Google Scholar] [CrossRef]
- Bi, Y.; Wang, Y.J.; Qin, Y.; Guix Vallverdú, R.; Maldonado García, J.; Sun, W.; Li, S.; Cao, Z. Prevalence of Bovine Mastitis Pathogens in Bulk Tank Milk in China. PLoS ONE 2016, 11, e0155621. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, J.B.C.; Zanardo, L.G.; Galvão, N.N.; Carvalho, I.A.; Nero, L.A.; Moreira, M.A.S. Escherichia coli from clinical mastitis. J. Vet. Diagn. Investig. 2011, 23, 1146–1152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bradley, A.J. Bovine Mastitis: An Evolving Disease. Vet. J. 2002, 164, 116–128. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.N.; Han, S.G. Bovine mastitis: Risk factors, therapeutic strategies, and alternative treatments—A review. Asian-Australas J. Anim. Sci. 2020, 33, 1699–1713. [Google Scholar] [CrossRef]
- Schukken, Y.; Chuff, M.; Moroni, P.; Gurjar, A.; Santisteban, C.; Welcome, F.; Zadoks, R. The “Other” Gram-Negative Bacteria in Mastitis. Vet. Clin. N. Am. Food Anim. Pract. 2012, 28, 239–256. [Google Scholar] [CrossRef]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L.T. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef]
- Guo, L.; He, Y.M.; Li, M.; Chen, D.W.; Chen, X.; Huang, Y.J.; Gu, R.X. Inhibitory effects of single and mixed lactic acid bacteria on intestinal pathogens. Food Sci. Technol. 2017, 42, 26–30. [Google Scholar] [CrossRef]
Milk Samples | Identified Bacteria | SSC 1 < 225,000 | 225,000 < SSC < 400,000 |
---|---|---|---|
S. agalactiae subclinical mastitis milk (M) | Streptococcus agalactiae | Negative | Positive (M1–M15) |
E. coli subclinical mastitis milk (E) | Escherichia coli | Negative | Positive (E1–E16) |
Healthy milk (H) | - | H1–H24 | - |
Healthy Milk (p < 0.0001, F = 516.3) | E. coli Subclinical Mastitis Milk (E) (p < 0.0001, F = 314.7) | S. agalactiae Subclinical Mastitis Milk (M) (p < 0.0001, F = 411.5) | |
---|---|---|---|
OUT number | 5319 ± 96 | 4239 ± 102 | 3987 ± 156 |
Chao 1 | 5498 ± 82 | 4519 ± 52 | 4019 ± 69 |
Shannon index | 7.98 ± 0.54 | 6.81 ± 0.19 | 6.51 ± 0.38 |
Phylogenetic diversity | 10.11 ± 0.52 | 8.54 ± 0.39 | 7.85 ± 0.68 |
Microorganism | Gene | Sequences of Primers and Probes | |
---|---|---|---|
E. coli | uidA | Forward primer (5′–3′) Reverse primer (5′–3′) Probe | GTGTGATATCTACCCGCTTCGC AGAACGGTTTGTGGTTAATCAGGA TCGGCATCCGGTCAGTGGCAGT |
Streptococcus agalactiae | cfb | Forward primer (5′–3′) Reverse primer (5′–3′) Probe | AGCTGTATTAGAAGTACATGCT CATTTGCTGGGCTTGATTATT ATCAAGTGACAACTCCACAAGTGGTAA |
Bos taurus (control) | mtDNA | Forward primer (5′–3′) Reverse primer (5′–3′) Probe | CGGAGTAATCCTTCTGCTCACAGT GGATTGCTGATAAGAGGTTGGTG CATGAGGACAAATATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaczorowski, Ł.; Powierska-Czarny, J.; Wolko, Ł.; Piotrowska-Cyplik, A.; Cyplik, P.; Czarny, J. The Influence of Bacteria Causing Subclinical Mastitis on the Structure of the Cow’s Milk Microbiome. Molecules 2022, 27, 1829. https://doi.org/10.3390/molecules27061829
Kaczorowski Ł, Powierska-Czarny J, Wolko Ł, Piotrowska-Cyplik A, Cyplik P, Czarny J. The Influence of Bacteria Causing Subclinical Mastitis on the Structure of the Cow’s Milk Microbiome. Molecules. 2022; 27(6):1829. https://doi.org/10.3390/molecules27061829
Chicago/Turabian StyleKaczorowski, Łukasz, Jolanta Powierska-Czarny, Łukasz Wolko, Agnieszka Piotrowska-Cyplik, Paweł Cyplik, and Jakub Czarny. 2022. "The Influence of Bacteria Causing Subclinical Mastitis on the Structure of the Cow’s Milk Microbiome" Molecules 27, no. 6: 1829. https://doi.org/10.3390/molecules27061829
APA StyleKaczorowski, Ł., Powierska-Czarny, J., Wolko, Ł., Piotrowska-Cyplik, A., Cyplik, P., & Czarny, J. (2022). The Influence of Bacteria Causing Subclinical Mastitis on the Structure of the Cow’s Milk Microbiome. Molecules, 27(6), 1829. https://doi.org/10.3390/molecules27061829