Next Article in Journal
A Mononuclear Iron(II) Spin-Crossover Molecule Decorated by Photochromic Azobenzene Group
Next Article in Special Issue
Chemical Composition of Leaves, Stem, and Roots of Peperomia pellucida (L.) Kunth
Previous Article in Journal
The Changes in Bioactive Compounds and Antioxidant Activity of Chia (Salvia hispanica L.) Herb under Storage and Different Drying Conditions: A Comparison with Other Species of Sage
Previous Article in Special Issue
Antiviral Plants from Marajó Island, Brazilian Amazon: A Narrative Review
 
 
Retraction published on 12 September 2025, see Molecules 2025, 30(18), 3707.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect

by
Shaymaa Mahmoud
1,
Sobhy Hassab El-Nabi
1,
Asmaa Hawash
1,2,
Hesham R. El-Seedi
3,4,5,*,
Shaden A. M. Khalifa
6,
Sami Ullah
7,8,
Abdullah G. Al-Sehemi
7,8 and
Islam M. El-Garawani
1,*
1
Department of Zoology, Faculty of Science, Menoufia University, Menoufia 32511, Egypt
2
Department of Bioscience, Faculty of Dentistry, Sinai University, Ismailia 41632, Egypt
3
Department of Chemistry, Faculty of Science, Menoufia University, Menoufia 32511, Egypt
4
International Joint Research Laboratory of Intelligent Agriculture and Agri-Products Processing, Jiangsu University, Zhenjiang 212013, China
5
School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013, China
6
Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm University, S-106 91 Stockholm, Sweden
7
Research Center for Advanced Materials Science (RCAMS), King Khalid University, P.O. Box 9004, Abha 61413, Saudi Arabia
8
Department of Chemistry, College of Science, King Khalid University, P.O. Box 9004, Abha 61413, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Molecules 2022, 27(5), 1570; https://doi.org/10.3390/molecules27051570
Submission received: 23 January 2022 / Revised: 15 February 2022 / Accepted: 25 February 2022 / Published: 27 February 2022 / Retracted: 12 September 2025
(This article belongs to the Special Issue Discovery of Bioactive Ingredients from Natural Products, 2nd Edition)

Abstract

Over recent decades, much attention has been given to imply the natural products in cancer therapy alone or in combination with other established procedures. Insects have a rich history in traditional medicine across the globe, which holds promise for the future of natural product drug discovery. Cecropins, peptides produced by insects, are components of a defense system against infections and are well known to exert antimicrobial and antitumor capabilities. The present study aimed to investigate, for the first time, the role of curcumin in enhancing the anticancer effect of Musca domestica larval hemolymph. Third larval instars of M. domestica were injected with curcumin and the hemolymph was picked at 4, 8, and 24 h post-curcumin injection. M. domestica cecropin A (MdCecA) was evaluated in control and injected larval hemolymphs. The cytotoxicity on breast cancer cell lines (MCF-7) and normal Vero cells was assessed to be comparable to control larval hemolymph. Curcumin-injected larval hemolymphs exhibited significant cytotoxicity with respect to the uninjected ones against MCF-7; however, Vero cells showed no cytotoxicity. The IC50 was 106 ± 2.9 and 388 ± 9.2 μg/mL for the hemolymphs of injected larvae at 4 and 8 h, respectively, while the control larval hemolymph revealed the IC50 of >500 μg/mL. For mechanistic anticancer evaluation, concentrations of 30, 60, and 100 μg/mL of curcumin-injected larval hemolymphs were examined. A significant G2/M cell cycle arrest was observed, confirming the anti-proliferative properties of hemolymphs over the tested concentrations. The MdCecA transcripts were significantly (p < 0.05) upregulated at 4 and 8 h post-injection, while a significant downregulation was observed after 24 h. Cecropin quantification by LC–MS revealed that MdCecA peptides have the highest expression in the hemolymph of the treated larvae at 8 h relative to the control group. The upregulation of cecropin expression at mRNA and protein levels may be attributed to the curcumin stimulation and linked to the increased cytotoxicity toward the cancer cell line. In conclusion, the results suggest that the apoptotic and anti-proliferative effects of M. domestica hemolymph on MCF-7 cells following the curcumin injection can be used as a natural candidate in future pharmaceutical industries.

1. Introduction

Natural products have provided successful alternatives in cancer chemotherapy through regular identification of unique potential targets, with specificity or selectivity for cancer cells [1,2]. Developing natural-based anticancer agents plays an important role in the design of effective and safe strategies to combat cancer [3]. Additionally, it is a reasonable candidate to overcome chemotherapy multidrug resistance, which is the most common conventional approach in cancer treatment [4,5].
The housefly Musca domestica is an important medical insect with highly effective immune defense mechanisms and is rarely infected even when reared under large-scale and high-density conditions [6]. M. domestica larvae are considered an excellent source of protein, fats, minerals, vitamins, and high levels of amino acids and have been used in Chinese and Korean traditional medicine [7,8]. M. domestica has exhibited numerous bioactive properties such as antibacterial [9], anti-atherosclerosis and pro-inflammatory responses [10], and immunomodulatory [11], antiviral [12], antifungal [13], antioxidants, and anticancer activities [14]. The chemical composition of M. domestica larval hemolymph is very complex, mainly formed of antimicrobial peptides (AMPs), lysozyme, and agglutinin [15,16]. One of the predominant AMP families is cecropin, which was first isolated from bacterial-challenged giant silk moth, Hyalophora cecropia, pupae [17]. Numerous cecropins have been identified from different species of insect orders (Hymenoptera, Diptera, Coleoptera, Lepidoptera, and Isoptera) [18,19] and other organisms including mammals [20]. These are α-helix linear peptides of approximately 30–35 amino acid residues without cysteine residues and are divided as cecropins A, B, and D [21,22]. They are relatively small proteins that are active against both Gram-positive and Gram-negative bacteria. Cecropins act as active inhibitors of Trypanosoma [23] and Plasmodium [24], inhibiting the proliferation of tumor cell lines [25]. Cecropins have exerted antitumor capabilities against a variety of cancer cell types, including colon cancer [26], leukemia [27], small cell lung cancer [28], gastric carcinoma [29], bladder cancer [25], and hepatocellular carcinoma [30]. Cecropin A is an AMP with a stabilized α-helical structure [31] and has antifungal activity against Beauveria bassiana in silkworm larvae [32]. Cecropin with anti-inflammatory activity has been identified in butterfly, Papilio xuthus [33], and Black fly, Simulium bannaense, salivary glands [34].
The biological impacts of M. domestica larval hemolymph such as anticancer and antioxidant potentials have been recently reported by LPS stimulation [14]. Thus, it is worth investigating possible natural and safe strategies to activate and stimulate the larval extracts’ biological pathway to maximize their anticancer efficiency. Herein, curcumin was selected based on its pharmacological profile, and because it is superior to the traditional chemotherapeutic drugs, owing to its anti-inflammatory, antioxidant, and antitumor properties [35,36], in addition to the minor toxicity [37,38]. Curcumin was reported as an effective natural bio-stimulator that activated many biochemical processes in Apis mellifera [39].
Taking into consideration the biological activities of curcumin, we hypothesized here that curcumin may increase the anticancer potential of M. domestica larval hemolymph. Thus, the current study aimed to maximize the effects of both curcumin and M. domestica larval hemolymph for the enhancement of the resulting anticancer potential, and hence the link of cecropin upregulation in the hemolymph following the curcumin injection was investigated.

2. Materials and Methods

2.1. Insects

M. domestica larvae were provided by the Institute of Medical Entomology, Dokki, Giza, Egypt. Larvae were maintained in the insectary of the Zoology Department, Faculty of Science, Menoufia University under laboratory conditions of 26 ± 1 °C; photoperiod: 14 L:10 D; and relative humidity: 60 ± 10% until pupation. After eclosion, adult flies were fed and maintained at 25 °C under 12 h light/12 h dark cycles (LD12:12) [40].

2.2. Curcumin Injection and Hemolymph Collection

Newly molted third instar larvae were injected into the hemocoel with 100 ng of curcumin per larva in a saline solution (Sigma-Aldrich, St. Louis, MO, USA) using a sterile, thin-needled micro-syringe. Hemolymph was extracted by cutting the anterior part of larvae with sterile fine scissors in a previously chilled Eppendorf tube. Larval hemolymph was collected at 4, 8, and 24 h post-injection and from normal larvae as controls.

2.3. Cecropin Evaluation

2.3.1. Nano LC–MS Analysis of M. domestica Cecropin Protein

Nano LC–MS analysis was conducted for the quantification of cecropin peptide in control and injected larvae at the Proteomics and Metabolomics Unit, 57,357 Children’s Cancer Hospital, Cairo, Egypt using a TripleTOF 5600 + (AB Sciex, Ontario, Canada) connected at the front end with a Eksigent nanoLC 400 autosampler with an Ekspert nanoLC 425 pump according to [41,42,43]. Hemolymph samples were compared against standard cecropin A peptide (AS-24009, AnaSpec, San Jose, CA, USA).

2.3.2. RNA Extraction, cDNA Synthesis, and Quantitative PCR of M. Domestica Cecropin Gene (MdCecA)

Total RNAs were extracted from hemolymph using Trizol reagent (Thermo Fisher Scientific, Austin, TX, USA) according to the manufacturer’s protocol. Specific primers for cecropin were designed by primer3 software and their sequences are illustrated in Table 1. The β-actin gene was used as an endogenous house-keeping gene [44]. RNA purity was estimated using spectrophotometric measurements (Milton Roy spectrophotometer, Spectronic 1201, Houston, TX, USA) at A260/280 absorbance, and the integrity was checked by agarose gel electrophoresis. The first-strand cDNA synthesis was made using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s instructions.
The qPCR was carried out using the Maxima SYBR Green/ROX qPCR Master Mix (SABiosciences™, Applied Biosystems, Foster City, CA, USA). The incubation of reaction mixtures was performed at 95 °C for 10 min, followed by 40 cycles at 95 °C for 20 s, annealing at 58 °C for one minute, and finally one minute of extension at 72 °C. The relative expression ratios of MdCecA were calibrated against the control samples.

2.4. In Vitro Anticancer Activity

2.4.1. Maintenance of Cell Lines

The Holding Company for Biological Products and Vaccines (VACSERA), Giza, Egypt, provided cell lines of human breast cancer (MCF-7) and normal African green monkey kidney (Vero). A hemocytometer was used to quantify the number of cells per milliliter, which was then computed using the following equation:
Cells/mL = 104 × (Average count per square) × (Dilution factor)
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum, 100 U/mL penicillin, and 100 g/mL streptomycin was used to maintain and culture the cell lines. At 37 °C, cells were incubated in T25 culture flasks at a density of 2 × 104 cells/cm2 in a humidified 5% CO2 environment. Every 48 h, the medium was changed. An inverted microscope was used to verify that the cells were 75 percent confluent. After trypsinization (0.025 percent trypsin and 0.02 percent EDTA), cells were collected and washed twice with phosphate-buffered saline (PBS). All of the tests were carried out in triplicate. All reagents and media were acquired from an Egyptian Lonza distributor.

2.4.2. Cytotoxicity Assay

The cytotoxicity of the hemolymph was assessed on MCF-7 cells, as well as the Vero normal green monkey kidney cells. The extracted hemolymphs at 4 and 8 h post-curcumin injection and the solution of curcumin (100 ng) were tested via serial dilutions (0–500 μg/mL) using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide dye (MTT). Cells were plated at a density of 1 × 104 cells per well in a 96-well plate and incubated at 37 °C for 48 h in a humidified (5% CO2) atmosphere until reaching the confluent (70%) monolayer. Briefly, after 24 h of exposure to hemolymph samples or curcumin, each well received 100 mL of MTT dye, which was then incubated for 4 h. An aliquot of PBS (100 μL) was used to wash each cell, and 100 μL of MTT destaining solution (acidified isopropanol) was added for at least 10 min on a shaker. To assess the number of live cells, the optical density was measured using a microplate reader (RADIM SEAC Sirio S, Pomezia, Italy). The following formula was used to compute the percentage of inhibition:
A percentage OD (absorbance) test/OD Control = (1 − OD test/OD Control) 100
Graphpad Prism software was used to perform the inhibition curve and compute the 50% maximum inhibitory concentration (IC50) (San Diego, CA, USA).

2.4.3. Cell Cycle Analysis

The effect of larval hemolymph injected with curcumin on the proliferation of cells was evaluated by measuring the distribution of the cells in the different phases of the cell cycle using flow cytometry. Cells were treated with 30, 60, and 100 μg/mL of hemolymph from control and injected larvae (4 and 8 h post injection). Cells were harvested and pelleted in 1 mL of cold PBS before being fixed in cold 75 percent ethanol for 24 h at 40 °C. PBS was used to wash the fixed cells. RNase was added, and cells were incubated at 37 °C for 30 min before being resuspended in a propidium iodide (1 mg/mL) staining solution and incubated in the dark at room temperature for 5–10 min. A fluorescence-activated cell sorter flow cytometer was used to examine the cells (Coulter Epics XL, Beckman Coulter, CA, USA).

2.4.4. Apoptosis Detection

MCF-7 cells were inoculated into a 6-well culture plate and incubated at 37 °C. The next day, after the medium was removed, 2.0 mL of RPMI 1640 complete medium with the 30, 60, and 100 μg/mL of tested hemolymph samples were added and incubated. After digestion with trypsin, cells were collected, washed three times in PBS, and suspended in 0.5 mL of binding buffer (10 mM HEPES/NaOH, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). At room temperature, FITC-labeled Annexin V (50 mg/mL, 5 mL) and PI (50 mg/mL, 5 mL) were added and then incubated for 30 min in the dark. Flow cytometry (Coulter Epics XL, Beckman Coulter, CA, USA) and its associated software were used to measure the apoptosis rate immediately.

2.5. Data Analysis

Nano LC–MS data analysis was performed using Analyst TF 1.7.1 and for data acquisition (Sciex software). Raw MS files from the TripleTOFTM 5600+ were analyzed by Protein pilot (version 5.0.1.0, 4895) and the Paragon Algorithm (version 5.0.1.0, 4874). Results were expressed as the mean ± SD of triplicates from three separate experiments. Statistical significance was determined using one-way analysis of variance (ANOVA), using SPSS software version 21.1 (Chicago, IL, USA). The values with p < 0.05 were considered significant.

3. Results

3.1. Insects’ Mortality and Morphology Changes

No morphological alterations were observed among the groups. The mortality was recorded without significant differences between groups (0.1 ± 0.04%).

3.2. MdCecA Altered Expression

3.2.1. Quantification of MdCecA Peptide

Changes in MdCecA peptide levels were detected in hemolymphs of control and curcumin-injected larvae at different intervals using Nano LC/MS (Figure 1A). The results revealed a significant (p < 0.05) increase in the protein levels in the larval hemolymph over all tested time points with respect to the control. The highest level was observed at 8 h (2.56 folds) followed by 4 h (1.86 folds) and 24 h (1.36 folds) post-injection.

3.2.2. Transcriptional Responses of M. Domestica Larvae to Curcumin Injection

The transcriptional level of MdCecA in larval hemolymphs was measured by qRT-PCR. The MdCecA transcripts were increased after 4 and 8 h of injection. However, the upregulation was stopped and reversed after 24 h post-injection (Figure 1B). The upregulation was estimated as 4.45- and 12.61-fold for 4 and 8 h, respectively, relative to the untreated larvae.

3.3. Anticancer Effects of Curcumin-Injected M. Domestica Larval Hemolymph

3.3.1. Cytotoxicity

However, a significant elevation in cecropin A at the levels of protein and transcripts was reported at both 4 and 8 h post-injection intervals. The cytotoxic effect of control and curcumin-injected larval hemolymphs was investigated in vitro against MCF-7 and Vero cells using an MTT assay. Uninjected larval hemolymph exhibited a lower cytotoxicity than the injected ones toward the cancer cells (MCF-7) (Figure 2), accounting for IC50 of 106 ± 2.9 and 388 ± 9.2 μg/mL for the hemolymphs of the injected larvae at 4 and 8 h, respectively. The IC50 of curcumin was about 321 µg/mL; however, the control larval hemolymph revealed IC50 > 500 μg/mL and the viability showed about 80% corresponding to 500 μg/mL. On Vero normal cells, no cytotoxicity was observed up to a concentration of 500 µg/mL in control and curcumin-injected larvae.

3.3.2. DNA Content and Cell Cycle Distribution

Cell cycle analysis of treated (4 h, Figure 3A, and 8 h, Figure 4A, post-curcumin injection) and control MCF-7 cells was performed. Among the 4 h group (Figure 3B,C), the accumulations of cells at the sub-G1 phase revealed significant (p < 0.05) apoptotic populations (~20% and 38 for 60 and 100 μg/mL, respectively). Moreover, G2/M arrest was significantly detected with ~33% and 48 for 60 and 100 μg/mL, respectively, compared to 10.5% in untreated cells. Moreover, among the 8 h group (Figure 4B,C), significant accumulations of the apoptotic phase (~29.45 and 55.23% for 60 and 100 μg/mL, respectively) and G2/M phase (~12.76 and 38.49% for 60 and 100 μg/mL, respectively) were recorded.

3.3.3. Apoptotic Effect on MCF-7

Following annexinV/propidium iodide labeling, flow cytometric analysis was carried out (Figure 5A,B). Among the groups tested at 4 h, apoptotic events were increased by about 21 and 37% at concentrations of 60 and 100 μg/mL, respectively, when compared to 1.8% in untreated cells (Figure 5C). However, necrosis was significantly observed in 100 μg/mL (4.3%) compared with the untreated group (1.3%).
Moreover, a significant increase in the apoptotic MCF-7 events after hemolymph treatment, 8 h post-curcumin injection, was observed with about 1.85 and 2.78 % for 60 and 100 μg/mL, respectively, when compared with 0.92% in untreated cells (Figure 5D). However, a remarkable dose-dependent increase in necrotic cells was counted (5.49, 7.64, and 21.44% at concentrations of 30, 60, and 100 μg/mL, respectively) compared with control cells (1.67%).

4. Discussion

Insects are a large, untapped, and unexplored resource of potentially useful compounds for modern medicine [10]. Several active proteins and peptides with diverse biological activities including antibacterial, antifungal, and antiviral properties were reported in insects [30,45]. Identification, isolation, and application of these agents will eventually benefit public health services and bio-pharmaceutical industries. Previous reports showed that housefly larvae have antitumor activities that have attracted a great deal of interest during recent years. A number of studies have reported that the extract of M. domestica hemolymph can inhibit the growth of tumor cells [46,47], whereas Hou et al. [9] proved that crude extract from M. domestica exhibited antitumor activity. Wang et al. [44] purified a protein fraction from housefly larvae, which had an inhibitory activity against the human lung cancer cell line with no toxicity to chick embryo fibroblast-like cells.
Following curcumin injection, a significant increase in cytotoxicity was observed, indicating its effective role in enhancing the anticancer potential of M. domestica larval hemolymph. Curcumin has been used for hundreds of years as a flavor, dye, and preservative [48] and was reported to possess therapeutic properties, including anti-inflammatory, anticancer, and antioxidant activities [48,49]. A similar observation was reported by Strachecka et al. [39] who examined the influence of curcumin on Apis mellifera workers and found that curcumin-treated workers had a higher protein concentration, elevated antioxidant enzymes, and other biomarkers activities. Curcumin was proven to be an effective natural bio-stimulator, improving apian health due to the activation of many biochemical processes involved in the formation of apian resistance [39]. There is a lack of publications concerning the role of curcumin in insects; however, other reports related to this subject are available in mammals. Curcumin has been reported to play an anticancer role in several tumor models, including glioblastoma, liver, colorectal, lung, ovarian, breast, oral, and gastric cancer [34,50,51,52,53,54,55,56]. The underlying mechanisms have been explained by the inhibition of proliferation, angiogenesis, invasion and metastasis of cancer cells, or apoptosis induction by curcumin [34,57,58].
The enhanced cytotoxicity may be due to the activation of internal mechanisms in insects such as proteolytic cascades and the activation of cellular defense mechanisms that may lead to the increase in secreted cecropin in the hemolymph [59,60]. In this study, following larval injection with curcumin, the higher concentration was found in the larval body at 4 h together with the elevated levels of cecropin inducing the highest cytotoxic effect against MCF-7. The interference of curcumin as an enhancer of cecropin cytotoxicity may be suggested. However, at 8 h, curcumin levels might be less than those at 4 h due to the absorption and metabolism by the insect, suggesting the lower enhancement or additive effect of cecropin cytotoxicity.
Apoptosis is a fundamental cellular event that has been implemented in tumor diagnosis and therapy [61]. It is a form of cell death mediated by the internal cellular machinery and is tightly regulated by intrinsic and extrinsic pathways. It is a controlled cell suicide, making the target cells morphologically and biochemically distinct [62]. In the current study, curcumin-injected larval hemolymph significantly decreased the growth of MCF-7 cells via the induction of apoptotic cascade at a fast rate and the arrested cell cycle of MCF-7 in the G2/M phase [61]. Similar results were obtained by Qian et al. [63] on insect tea against human tongue carcinoma TCA8113 cells. The formation of apoptotic bodies was observed along with the sub-G1 DNA (apoptotic cells) accumulation in cells treated with curcumin-injected larval hemolymph. Several antitumor agents arrested the cell cycle and induced apoptotic cell death.
The expression pattern of cecropin after curcumin injection at both protein and mRNA levels is consistent with the findings of Sackton et al. [64], who proved that cecropin showed duplication rates of the increase in M. domestica in response to the bacterial infection [64]. However, there are no reports concerning cecropin expression especially after curcumin stimulation. The time-dependent expression pattern of cecropin was reported to be induced rapidly after infection with Gram-negative and Gram-positive bacteria, fungi, and even any foreign body entering the insect body [65,66,67]. It can be detected from 2–6 h to 24–36 h after an immune stimulation [68,69]. Cecropin is upregulated over the time course of an infection, and peak activity is reached days after infection; such an interval differs from insect to insect [70]. The expression of the genes encoding cecropins was induced simultaneously shortly after infection by bacteria [71,72] and were expressed at high levels in insect larvae under bacterial infection [73]. The expression pattern of the cecropin genes does not show a constant pattern in all insects. In silkworm, its expression is not identical across different types of microbial infection [74,75], suggesting that different signaling pathways may be involved in the regulation of immune gene expression in a distinct manner. The expression levels of cecropin mRNA peaked at the first days post-oral infection with Gram-negative bacteria, E. coli, and relatively decreased with time in salivary glands of Simulium bannaense [76]. Cecropin expression levels were significantly upregulated after the bacterial injection [77,78]; however, no increase in gene transcription was observed at 24 h after the injection in Anopheles coluzzii [79]. Concurrently, the current data could indicate the capacity of M. domestica hemolymph to express a highly effective production of cecropin at 8 h post-curcumin injection as a stressor where it gradually decreases toward normal levels with time. This decline may be due to the absorption and metabolism of injected curcumin by the insect body. Additionally, protein stability, post-transcriptional alterations, and mRNA degradation may explain the observed differences in peptide expression [14].
Peptides related to the Cecropin family have been proven as effective antitumor agents in numerous studies, although signaling pathways involved in these antitumor activities have not been established yet. Cecropin binding to the cancer cell surfaces leads to pores formation resulting in cell lysis and cellular disruption [80], most likely cecropins possessing a destructive effect on cancer cell membranes. Apoptosis induction by cecropins has been explained by the upregulation of caspase-3 and caspase-9, prior to cell destruction [34]. The latter is a caspase initiator and a direct activator of caspase-3, an effector enzyme responsible for protein hydrolysis of the membrane surrounding the cell nucleus. This can induce the morphological changes, indicating cellular apoptosis, and may be attributed to cecropin concentrations [80]. The increased concentration of reactive oxygen species in cancer cells in the presence of cecropin may also be a causing factor for cell apoptosis [80]. Cecropin A has been reported to have antitumor properties against leukemia cell lines, which was manifested by the proliferation inhibition [81] with no cytotoxic properties against normal cell lines [80]. Cecropin A has been shown to cause the downregulation of the phosphorylation-related signaling pathway in regard to the regulation of cell division, cell cycle, or transcription regulation [81]. Finally, the underlying enhanced anticancer mechanism of M. domestica larval hemolymph after curcumin stimulation on human cancer cell lines may be attributed to the induction of apoptosis by regulating protein and mRNA expressions of cecropin, which may be a target for breast cancer therapy. Moreover, further in vivo studies of stimulated M. domestica larval hemolymph are required to assess the underlying anticancer effects. Furthermore, the improvement of the curcumin entry method to the larvae for easier and applicable pharmaceutical large-scale applications should be considered.

5. Conclusions

To our knowledge, this is the first time we have reported how curcumin can naturally stimulate and enhance the anticancer effects of M. domestica larval hemolymph with evidential in vitro anti-proliferative and apoptotic signs supporting its anticancer potential.

Author Contributions

Conceptualization, S.M. and I.M.E.-G.; methodology, A.H. and S.M.; software, S.M.; validation, I.M.E.-G., S.M. and S.H.E.-N.; formal analysis, A.H.; investigation, S.M.; resources, S.U., A.G.A.-S. and A.H.; data curation, H.R.E.-S.; writing—original draft preparation, S.M.; writing—review and editing, S.A.M.K.; visualization, S.M.; supervision, I.M.E.-G., S.M. and S.H.E.-N.; project administration, I.M.E.-G.; funding acquisition, S.U and A.G.A.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by King Khalid University, Abha, Saudi Arabia and the Research Center for Advanced Materials Science (RCAMS) at King Khalid University, Abha, Saudi Arabia, grant no: RCAMS/KKU//008/21 and “The APC was funded by RCAMS/KKU//008/21”.

Institutional Review Board Statement

All procedures in this study were in accordance with the ethical standards of the Institutional Research Committee, Menoufia University, Egypt (MUFS-F-GE-8-20).

Data Availability Statement

All data generated or analyzed during this study are included in this article.

Acknowledgments

Authors acknowledge the support and funding of King Khalid University through the Research Center for Advanced Materials Science (RCAMS) under grant no: RCAMS/KKU//008/21.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Sample Availability

Not applicable.

References

  1. El-Garawani, I.M.; El-Sabbagh, S.M.; Abbas, N.H.; Ahmed, H.S.; Eissa, O.A.; Abo-Atya, D.M.; Khalifa, S.A.M.; El-Seedi, H.R. A newly isolated strain of Halomonas sp. (HA1) exerts anticancer potential via induction of apoptosis and G2/M arrest in hepatocellular carcinoma (HepG2) cell line. Sci. Rep. 2020, 10, 14076. [Google Scholar] [CrossRef] [PubMed]
  2. Tohamy, A.A.; El-Garawani, I.M.; Ibrahim, S.R.; Abdel Moneim, A.E. The apoptotic properties of Salvia aegyptiaca and Trigonella foenum-graecum extracts on Ehrlich ascites carcinoma cells: The effectiveness of combined treatment. Res. J. Pharm. Biol. Chem. Sci. 2016, 7, 1872–1883. [Google Scholar]
  3. Greenwell, M.; Rahman, P.K.S.M. Medicinal Plants: Their Use in Anticancer Treatment. Int. J. Pharm. Sci. Res. 2015, 6, 4103–4112. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, J.Y.; Tao, L.Y.; Liang, Y.J.; Chen, L.M.; Mi, Y.J.; Zheng, L.S.; Wang, F.; She, Z.G.; Lin, Y.C.; To, K.K.W.; et al. Anthracenedione derivatives as anticancer agents isolated from secondary metabolites of the mangrove endophytic fungi. Mar. Drugs 2010, 8, 1469–1481. [Google Scholar] [CrossRef]
  5. Liu, B.; Ezeogu, L.; Zellmer, L.; Yu, B.; Xu, N.; Joshua Liao, D. Protecting the normal in order to better kill the cancer. Cancer Med. 2015, 4, 1394–1403. [Google Scholar] [CrossRef]
  6. Fu, P.; Wu, J.; Guo, G. Purification and molecular identification of an antifungal peptide from the hemolymph of Musca domestica (housefly). Cell. Mol. Immunol. 2009, 6, 245–251. [Google Scholar] [CrossRef]
  7. Hwangbo, J.; Hong, E.C.; Jang, A.; Kang, H.K.; Oh, J.S.; Kim, B.W.; Park, B.S. Utilization of house fly-maggots, a feed supplement in the production of broiler chickens. J. Environ. Biol. 2009, 30, 609–614. [Google Scholar]
  8. Pemberton, R.W. Insects and other arthropods used as drugs in Korean traditional medicine. J. Ethnopharmacol. 1999, 65, 207–216. [Google Scholar] [CrossRef]
  9. Hou, L.; Shi, Y.; Zhai, P.; Le, G. Antibacterial activity and in vitro anti-tumor activity of the extract of the larvae of the housefly (Musca domestica). J. Ethnopharmacol. 2007, 111, 227–231. [Google Scholar] [CrossRef]
  10. Chu, F.J.; Jin, X.B.; Zhu, J.Y. Housefly maggots (Musca domestica) protein-enriched fraction/extracts (PE) inhibit lipopolysaccharide-induced atherosclerosis pro-inflammatory responses. J. Atheroscler. Thromb. 2011, 18, 282–290. [Google Scholar] [CrossRef]
  11. Cao, X.; Zhou, M.; Wang, C.; Hou, L.; Li, Y.; Chen, L. Musca domestica pupae lectin improves the immunomodulatory activity of macrophages by activating nuclear factor-κB. J. Med. Food 2012, 15, 145–151. [Google Scholar] [CrossRef] [PubMed]
  12. Lu, X.; Jin, X.; Wang, J.; Chu, F.; Zhu, J. Antihepatitis B virus activity of a protein-enriched fraction from housefly (Musca domestica) in a stable HBV-producing cell line. Sci. World J. 2014, 2014, 389560. [Google Scholar] [CrossRef] [PubMed]
  13. Zhou, J.; Kong, L.; Fang, N.; Mao, B.; Ai, H. Synthesis and functional characterization of MAF-1A peptide derived from the larvae of housefly, musca domestica (Diptera: Muscidae). J. Med. Entomol. 2016, 53, 1467–1472. [Google Scholar] [CrossRef] [PubMed]
  14. El-Garawani, I.; El-Seedi, H.; Khalifa, S.; El Azab, I.H.; Abouhendia, M.; Mahmoud, S. Enhanced Antioxidant and Cytotoxic Potentials of Lipopolysaccharides-Injected Musca domestica Larvae. Pharmaceutics 2020, 12, 1111. [Google Scholar] [CrossRef]
  15. Boman, H.G. Peptide Antibiotics and their Role in Innate Immunity. Annu. Rev. Immunol. 1995, 13, 61–92. [Google Scholar] [CrossRef]
  16. Bulet, P.; Hetru, C.; Dimarcq, J.L.; Hoffmann, D. Antimicrobial peptides in insects; structure and function. Dev. Comp. Immunol. 1999, 23, 329–344. [Google Scholar] [CrossRef]
  17. Steiner, H.; Hultmark, D.; Engström, Å.; Bennich, H.; Boman, H.G. Sequence and specificity of two antibacterial proteins involved in insect immunity. Nature 1981, 292, 246–248. [Google Scholar] [CrossRef]
  18. Bulet, P.; Stocklin, R. Insect Antimicrobial Peptides: Structures, Properties and Gene Regulation. Protein Pept. Lett. 2005, 12, 3–11. [Google Scholar] [CrossRef]
  19. Yi, H.Y.; Chowdhury, M.; Huang, Y.D.; Yu, X.Q. Insect antimicrobial peptides and their applications. Appl. Microbiol. Biotechnol. 2014, 98, 5807–5822. [Google Scholar] [CrossRef]
  20. Boman, H.G. Innate immunity and the normal microflora. Immunol. Rev. 2000, 173, 5–16. [Google Scholar] [CrossRef]
  21. van Hofsten, P.; Faye, I.; Kockum, K.; Lee, J.Y.; Xanthopoulos, K.G.; Boman, I.A.; Boman, H.G.; Engström, A.; Andreu, D.; Merrifield, R.B. Molecular cloning, cDNA sequencing, and chemical synthesis of cecropin B from Hyalophora cecropia. Proc. Natl. Acad. Sci. USA 1985, 82, 2240–2243. [Google Scholar] [CrossRef] [PubMed]
  22. Hultmark, D.; Engström, Å.; Bennich, H.; Kapur, R.; Boman, H.G. Insect Immunity: Isolation and Structure of Cecropin D and Four Minor Antibacterial Components from Cecropia Pupae. Eur. J. Biochem. 1982, 127, 207–217. [Google Scholar] [CrossRef] [PubMed]
  23. Barr, S.C.; Rose, D.; Jaynes, J.M. Activity of lytic peptides against intracellular Trypanosoma cruzi amastigotes in vitro and parasitemias in mice. J. Parasitol. 1995, 81, 974–978. [Google Scholar] [CrossRef] [PubMed]
  24. Boisbouvier, J.; Prochnicka-Chalufour, A.; Nieto, A.R.; Torres, J.A.; Nanard, N.; Rodriguez, M.H.; Possani, L.D.; Delepierre, M. Structural information on a cecropin-like synthetic peptide, Shiva-3 toxic to the sporogonic development of Plasmodium berghei. Eur. J. Biochem. 1998, 257, 263–273. [Google Scholar] [CrossRef]
  25. Suttmann, H.; Retz, M.; Paulsen, F.; Harder, J.; Zwergel, U.; Kamradt, J.; Wullich, B.; Unteregger, G.; Stöckle, M.; Lehmann, J. Antimicrobial peptides of the Cecropin-family show potent antitumor activity against bladder cancer cells. BMC Urol. 2008, 8, 5. [Google Scholar] [CrossRef]
  26. Moore, A.J.; Devine, D.A.; Bibby, M.C. Preliminary experimental anticancer activity of cecropins. Pept. Res. 1994, 7, 265–269. [Google Scholar]
  27. Chen, H.M.; Wang, W.; Smith, D.; Chan, S.C. Effects of the anti-bacterial peptide cecropin B and its analogs, cecropins B-1 and B-2, on liposomes, bacteria, and cancer cells. Biochim. Biophys. Acta—Gen. Subj. 1997, 1336, 171–179. [Google Scholar] [CrossRef]
  28. Shin, S.Y.; Lee, M.K.; Kim, K.L.; Hahm, K.S. Structure-antitumor and hemolytic activity relationships of synthetic peptides derived from cecropin A-magainin 2 and cecropin A-melittin hybrid peptides. J. Pept. Res. 1997, 50, 279–285. [Google Scholar] [CrossRef]
  29. Chan, S.C.; Hui, L.; Chen, H.M. Enhancement of the cytolytic effect of anti-bacterial cecropin by the microvilli of cancer cells. Anticancer Res. 1998, 18, 4467–4474. [Google Scholar]
  30. Jin, X.; Mei, H.; Li, X.; Ma, Y.; Zeng, A.H.; Wang, Y.; Lu, X.; Chu, F.; Wu, Q.; Zhu, J. Apoptosis-inducing activity of the antimicrobial peptide cecropin of Musca domestica in human hepatocellular carcinoma cell line BEL-7402 and the possible mechanism. Acta Biochim. Biophys. Sin. 2010, 42, 259–265. [Google Scholar] [CrossRef]
  31. Fu, H.; Björstad, Å.; Dahlgren, C.; Bylund, J. A bactericidal cecropin-A peptide with a stabilized α-helical structure possess an increased killing capacity but no proinflammatory activity. Inflammation 2004, 28, 337–343. [Google Scholar] [CrossRef] [PubMed]
  32. Lu, D.; Geng, T.; Hou, C.; Huang, Y.; Qin, G.; Guo, X. Bombyx mori cecropin A has a high antifungal activity to entomopathogenic fungus Beauveria bassiana. Gene 2016, 583, 29–35. [Google Scholar] [CrossRef] [PubMed]
  33. Kim, J.K.; Lee, E.; Shin, S.; Jeong, K.W.; Lee, J.Y.; Bae, S.Y.; Kim, S.H.; Lee, J.; Kim, S.R.; Lee, D.G.; et al. Structure and function of papiliocin with antimicrobial and anti-inflammatory activities isolated from the swallowtail butterfly, Papilio xuthus. J. Biol. Chem. 2011, 286, 41296–41311. [Google Scholar] [CrossRef]
  34. Wu, J.; Lu, W.Y.; Cui, L.L. Inhibitory effect of curcumin on invasion of skin squamous cell carcinoma A431 cells. Asian Pac. J. Cancer Prev. 2015, 16, 2813–2818. [Google Scholar] [CrossRef] [PubMed]
  35. Tan, R.Z.; Liu, J.; Zhang, Y.Y.; Wang, H.L.; Li, J.C.; Liu, Y.H.; Zhong, X.; Zhang, Y.W.; Yan, Y.; Lan, H.Y.; et al. Curcumin relieved cisplatin-induced kidney inflammation through inhibiting Mincle-maintained M1 macrophage phenotype. Phytomedicine 2019, 52, 284–294. [Google Scholar] [CrossRef]
  36. Mantzorou, M.; Pavlidou, E.; Vasios, G.; Tsagalioti, E.; Giaginis, C. Effects of curcumin consumption on human chronic diseases: A narrative review of the most recent clinical data. Phytother. Res. 2018, 32, 957–975. [Google Scholar] [CrossRef]
  37. Basnet, P.; Skalko-Basnet, N. Curcumin: An anti-inflammatory molecule from a curry spice on the path to cancer treatment. Molecules 2011, 16, 4567–4598. [Google Scholar] [CrossRef]
  38. Creţu, E.; Trifan, A.; Vasincu, A.; Miron, A. Plant-derived anticancer agents-curcumin in cancer prevention and treatment Symphytum View project Special Issue: “Polyphenols in Plants” View project. Rev. Med. Chir. Soc. Med. Nat. Iasi. 2012, 116, 1223–1229. [Google Scholar]
  39. Strachecka, A.J.; Olszewski, K.; Paleolog, J. Curcumin stimulates biochemical mechanisms of Apis mellifera resistance and extends the apian life-span. J. Apic. Sci. 2015, 59, 129–141. [Google Scholar] [CrossRef]
  40. Codd, V.; Dolezel, D.; Stehlik, J.; Piccin, A.; Garner, K.J.; Racey, S.N.; Straatman, K.R.; Louis, E.J.; Costa, R.; Sauman, I.; et al. Circadian rhythm gene regulation in the housefly Musca domestica. Genetics 2007, 177, 1539–1551. [Google Scholar] [CrossRef][Green Version]
  41. Magdeldin, S.; Moresco, J.J.; Yamamoto, T.; Yates, J.R. Off-line multidimensional liquid chromatography and auto sampling result in sample loss in LC/LC-MS/MS. J. Proteome Res. 2014, 13, 3826–3836. [Google Scholar] [CrossRef] [PubMed]
  42. Saadeldin, I.M.; Swelum, A.A.A.; Elsafadi, M.; Mahmood, A.; Osama, A.; Shikshaky, H.; Alfayez, M.; Alowaimer, A.N.; Magdeldin, S. Thermotolerance and plasticity of camel somatic cells exposed to acute and chronic heat stress. J. Adv. Res. 2020, 22, 105–118. [Google Scholar] [CrossRef] [PubMed]
  43. Enany, S.; Zakeer, S.; Sayed, A.A.; Magdeldin, S. Shotgun proteomic analysis of ESBL-producing and non-ESBL-producing Klebsiella Pneumoniae clinical isolates. Microbiol. Res. 2020, 234, 126423. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, Y.; Zhao, Y.; Lei, C.; Zhu, F. Antiviral and antitumor activities of the protein fractions from the larvae of the housefly, Musca domestica. Afr. J. Biotechnol. 2012, 11, 9468–9474. [Google Scholar] [CrossRef]
  45. Hao, Y.J.; Jing, Y.J.; Qu, H.; Li, D.S.; Du, R.Q. Purification and characterization of a thermal stable antimicrobial protein from housefly larvae, Musca domestica, induced by ultrasonic wave. Acta Biol. Hung. 2008, 59, 289–304. [Google Scholar] [CrossRef]
  46. Wen, C.; Qu, C.; Li, D.; Zhang, X. Influence of Immuned Hemolymph of Housefly on Ultrastructures and Cell Cycles of SMMC-7721 Cells. Henan J. Oncol. 2004, 17, 100–102. [Google Scholar]
  47. Zhao, R.J.; Zhang, Q.H.; Li, F.D. The effection of antimicrobial peptides extracted from adult housefly on tumour cell. Chin. J. Vector Biol. Control 2007, 18, 17–19. [Google Scholar]
  48. Wilken, R.; Veena, M.S.; Wang, M.B.; Srivatsan, E.S. Curcumin: A review of anti-cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Mol. Cancer 2011, 10, 12. [Google Scholar] [CrossRef]
  49. Ak, T.; Gülçin, I. Antioxidant and radical scavenging properties of curcumin. Chem.-Biol. Interact. 2008, 174, 27–37. [Google Scholar] [CrossRef]
  50. Coleman, D.T.; Soung, Y.H.; Surh, Y.J.; Cardelli, J.A.; Chung, J. Curcumin prevents palmitoylation of integrin β4 in breast cancer cells. PLoS ONE 2015, 10, e0125399. [Google Scholar] [CrossRef]
  51. Li, W.; Zhou, Y.; Yang, J.; Li, H.; Zhang, H.; Zheng, P. Curcumin induces apoptotic cell death and protective autophagy in human gastric cancer cells. Oncol. Rep. 2017, 37, 3459–3466. [Google Scholar] [CrossRef] [PubMed]
  52. Marquardt, J.U.; Gomez-Quiroz, L.; Arreguin Camacho, L.O.; Pinna, F.; Lee, Y.H.; Kitade, M.; Domínguez, M.P.; Castven, D.; Breuhahn, K.; Conner, E.A.; et al. Curcumin effectively inhibits oncogenic NF-κB signaling and restrains stemness features in liver cancer. J. Hepatol. 2015, 63, 661–669. [Google Scholar] [CrossRef] [PubMed]
  53. Mishra, A.; Kumar, R.; Tyagi, A.; Kohaar, I.; Hedau, S.; Bharti, A.C.; Sarker, S.; Dey, D.; Saluja, D.; Das, B. Curcumin modulates cellular AP-1, NF-kB, and HPV16 E6 proteins in oral cancer. Ecancermedicalscience 2015, 9, 525. [Google Scholar] [CrossRef] [PubMed]
  54. Shakibaei, M.; Kraehe, P.; Popper, B.; Shayan, P.; Goel, A.; Buhrmann, C. Curcumin potentiates antitumor activity of 5-fluorouracil in a 3D alginate tumor microenvironment of colorectal cancer. BMC Cancer 2015, 15, 250. [Google Scholar] [CrossRef] [PubMed]
  55. Terlikowska, K.M.; Witkowska, A.M.; Zujko, M.E.; Dobrzycka, B.; Terlikowski, S.J. Potential application of curcumin and its analogues in the treatment strategy of patients with primary epithelial ovarian cancer. Int. J. Mol. Sci. 2014, 15, 21703–21722. [Google Scholar] [CrossRef] [PubMed]
  56. Zanotto-Filho, A.; Braganhol, E.; Klafke, K.; Figueiró, F.; Terra, S.R.; Paludo, F.J.; Morrone, M.; Bristot, I.J.; Battastini, A.M.; Forcelini, C.M.; et al. Autophagy inhibition improves the efficacy of curcumin/temozolomide combination therapy in glioblastomas. Cancer Lett. 2015, 358, 220–231. [Google Scholar] [CrossRef] [PubMed]
  57. Amin, A.R.M.R.; Haque, A.; Rahman, M.A.; Chen, Z.G.; Khuri, F.R.; Shin, D.M. Curcumin induces apoptosis of upper aerodigestive tract cancer cells by targeting multiple pathways. PLoS ONE 2015, 10, e0124218. [Google Scholar] [CrossRef]
  58. Bimonte, S.; Barbieri, A.; Palma, G.; Rea, D.; Luciano, A.; D’Aiuto, M.; Arra, C.; Izzo, F. Dissecting the role of curcumin in tumour growth and angiogenesis in mouse model of human breast cancer. BioMed Res. Int. 2015, 2015, 878134. [Google Scholar] [CrossRef]
  59. Grizanova, E.; Dubovskiy, I.; Whitten, M.; Glupov, V.V. Contributions of cellular and humoral immunity of Galleria mellonella larvae in defence against oral infection by Bacillus thuringiensis. J. Invertebr. Pathol. 2014, 119, 40–46. [Google Scholar] [CrossRef]
  60. Hoffmann, J.A.; Reichhart, J.M.; Hetru, C. Innate immunity in higher insects. Curr. Opin. Immunol. 1996, 8, 8–13. [Google Scholar] [CrossRef]
  61. Milanezi, F.; Leito, D.; Ricardo, S.; Augusto, I.; Schmitt, F. Evaluation of HER2 in breast cancer: Reality and expectations. Expert Opin. Med. Diagn. 2009, 3, 607–620. [Google Scholar] [CrossRef] [PubMed]
  62. Reed, J.C. Warner-Lambert/Parke Davis award lecture: Mechanisms of apoptosis. Am. J. Pathol. 2000, 157, 1415–1430. [Google Scholar] [CrossRef]
  63. Qian, Y.; Li, G.J.; Wang, R.; Zhou, Y.L.; Sun, P.; Zhao, X. In vitro anticancer effects of insect tea in TCA8113 cells. J. Cancer Res. Ther. 2014, 10, 1045–1051. [Google Scholar] [CrossRef] [PubMed]
  64. Sackton, T.B.; Lazzaro, B.P.; Clark, A.G.; Wittkopp, P. Rapid expansion of immune-related gene families in the house fly, musca domestica. Mol. Biol. Evol. 2017, 34, 857–872. [Google Scholar] [CrossRef]
  65. Kobayashi, A.; Matsui, M.; Kubo, T.; Natori, S. Purification and characterization of a 59-kilodalton protein that specifically binds to NF-kappa B-binding motifs of the defense protein genes of Sarcophaga peregrina (the flesh fly). Mol. Cell Biol. 1993, 13, 4049–4056. [Google Scholar]
  66. Dimarcq, J.L.; Hoffmann, D.; Meister, M.; Bulet, P.; Lanot, R.; Reichhart, J.M.; Hoffmann, J.A. Characterization and transcriptional profiles of a Drosophila gene encoding an insect defensin. A study in insect immunity. Eur. J. Biochem. 1994, 221, 201–209. [Google Scholar] [CrossRef]
  67. Józefiak, A.; Engberg, R.M. Insect proteins as a potential source of antimicrobial peptides in livestock production. A review. J. Anim. Feed Sci. 2017, 26, 87–99. [Google Scholar] [CrossRef]
  68. Meister, S.; Kanzok, S.M.; Zheng, X.-L.; Luna, C.; Li, T.-R.; Hoa, N.T.; Clayton, J.R.; White, K.P.; Kafatos, F.C.; Christophides, G.K.; et al. Immune signaling pathways regulating bacterial and malaria parasite infection of the mosquito Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2005, 102, 11420–11425. [Google Scholar] [CrossRef]
  69. Das De, T.; Sharma, P.; Thomas, T.; Singla, D.; Tevatiya, S.; Kumari, S.; Chauhan, C.; Rani, J.; Srivastava, V.; Kaur, R.; et al. Interorgan Molecular Communication Strategies of “Local” and “Systemic” Innate Immune Responses in Mosquito Anopheles stephensi. Front. Immunol. 2018, 9, 148. [Google Scholar] [CrossRef]
  70. Haine, E.R.; Moret, Y.; Siva-Jothy, M.T.; Rolff, J. Antimicrobial defense and persistent infection in insects. Science 2008, 322, 1257–1259. [Google Scholar] [CrossRef]
  71. Iketani, M.; Morishima, I. Induction of antibacterial protein synthesis by soluble peptidoglycan in isolated fat body from larvae of the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 1993, 23, 913–917. [Google Scholar] [CrossRef]
  72. Morishima, I.; Horiba, T.; Iketani, M.; Nishioka, E.; Yamano, Y. Parallel induction of cecropin and lysozyme in larvae of the silkworm, Bombyx mori. Dev. Comp. Immunol. 1995, 19, 357–363. [Google Scholar] [CrossRef]
  73. Hong, S.-M.; Kusakabe, T.; Lee, J.-M.; Tatsuke, T.; Kawaguchi, Y.; Kang, M.-W.; Kang, S.-W.; Kim, K.-A.; Nho, S.-K. Structure and Expression Analysis of the Cecropin-E Gene from the Silkworm, Bombyx mori. Biosci. Biotechnol. Biochem. 2008, 72, 1992–1998. [Google Scholar] [CrossRef]
  74. Yamano, Y.; Matsumoto, M.; Inoue, K.; Kawabata, T.; Morishima, I. Cloning of cDNAs for Cecropins A and B, and Expression of the Genes in the Silkworm, Bombyx mori. Biosci. Biotechnol. Biochem. 1994, 58, 1476–1478. [Google Scholar] [CrossRef]
  75. Yang, J.; Furukawa, S.; Sagisaka, A.; Ishibashi, J.; Taniai, K.; Shono, T.; Yamakawa, M. cDNA cloning and gene expression of cecropin D, an antibacterial protein in the silkworm, Bombyx mori. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1999, 122, 409–414. [Google Scholar] [CrossRef]
  76. Wu, J.; Mu, L.; Zhuang, L.; Han, Y.; Liu, T.; Li, J.; Yang, Y.; Yang, H.; Wei, L. A cecropin-like antimicrobial peptide with anti-inflammatory activity from the black fly salivary glands. Parasit Vectors 2015, 8, 561. [Google Scholar] [CrossRef] [PubMed]
  77. Vizioli, J.; Bulet, P.; Charlet, M.; Lowenberger, C.; Blass, C.; Müller, H.M.; Dimopoulos, G.; Hoffmann, J.; Kafatos, F.C.; Richman, A. Cloning and analysis of a cecropin gene from the malaria vector mosquito, Anopheles gambiae. Insect Mol. Biol. 2000, 9, 75–84. [Google Scholar] [CrossRef]
  78. Christophides, G.K.; Zdobnov, E.; Barillas-Mury, C.; Birney, E.; Blandin, S.; Blass, C.; Brey, P.T.; Collins, F.H.; Danielli, A.; Dimopoulos, G.; et al. Immunity-related genes and gene families in Anopheles gambiae. Science 2002, 298, 159–165. [Google Scholar] [CrossRef]
  79. Bevivino, G.; Arcà, B.; Lombardo, F. Effects of Local and Systemic Immune Challenges on the Expression of Selected Salivary Genes in the Malaria Mosquito Anopheles coluzzii. Pathogens 2021, 10, 1300. [Google Scholar] [CrossRef]
  80. Cerón, J.M.A.; Contreras-Moreno, J.; Puertollano, E.; De Cienfuegos, G.Á.; Puertollano, M.A.; De Pablo, M.A. The antimicrobial peptide cecropin A induces caspase-independent cell death in human promyelocytic leukemia cells. Peptides 2010, 31, 1494–1503. [Google Scholar] [CrossRef]
  81. Zhai, Z.; Ni, X.; Jin, C.; Ren, W.; Li, J.; Deng, J.; Deng, B.; Yin, Y. Cecropin a modulates tight junction-related protein expression and enhances the barrier function of porcine intestinal epithelial cells by suppressing the MEK/ERK pathway. Int. J. Mol. Sci. 2018, 19, 1941. [Google Scholar] [CrossRef] [PubMed]
Figure 1. MdCec expression of control and curcumin-injected M. domestica larval hemolymphs after 4, 8, and 24 h of injection. (A) Cecropin quantification analyzed by Nano LC–MS/MS. (B) Relative MdCec-mRNA expression analyzed by qRT-PCR. # indicate significant difference (p < 0.05). Data were illustrated as mean ± SD, (n = 3).
Figure 1. MdCec expression of control and curcumin-injected M. domestica larval hemolymphs after 4, 8, and 24 h of injection. (A) Cecropin quantification analyzed by Nano LC–MS/MS. (B) Relative MdCec-mRNA expression analyzed by qRT-PCR. # indicate significant difference (p < 0.05). Data were illustrated as mean ± SD, (n = 3).
Molecules 27 01570 g001
Figure 2. The viability of control and curcumin-injected M. domestica larval hemolymph on MCF-7 cell lines using the MTT assay. The incubation with serial concentrations (3.9–500 µg/mL) of the tested larval hemolymphs was performed in triplicate. Data were illustrated as (mean ± SD) of three separate experiments.
Figure 2. The viability of control and curcumin-injected M. domestica larval hemolymph on MCF-7 cell lines using the MTT assay. The incubation with serial concentrations (3.9–500 µg/mL) of the tested larval hemolymphs was performed in triplicate. Data were illustrated as (mean ± SD) of three separate experiments.
Molecules 27 01570 g002
Figure 3. Effect of different M domestica hemolymph concentrations, 4 h post-curcumin injection (A), on the cell cycle distribution of treated and control MCF-7 cells. The cell cycle phases were analyzed according to DNA contents after propidium iodide (PI) labeling (n = 3), (B). Data were illustrated as mean ± SD, # shows the significant increase with respect to the control (p < 0.05), (C).
Figure 3. Effect of different M domestica hemolymph concentrations, 4 h post-curcumin injection (A), on the cell cycle distribution of treated and control MCF-7 cells. The cell cycle phases were analyzed according to DNA contents after propidium iodide (PI) labeling (n = 3), (B). Data were illustrated as mean ± SD, # shows the significant increase with respect to the control (p < 0.05), (C).
Molecules 27 01570 g003
Figure 4. Effect of different M domestica hemolymph concentrations, 8 h post-curcumin injection (A), on the cell cycle distribution of treated and control MCF-7 cells. The cell cycle phases were analyzed according to DNA contents after propidium iodide (PI) labeling (n = 3) (B). Data were illustrated as mean±SD; # show the significant difference (p < 0.05) (C).
Figure 4. Effect of different M domestica hemolymph concentrations, 8 h post-curcumin injection (A), on the cell cycle distribution of treated and control MCF-7 cells. The cell cycle phases were analyzed according to DNA contents after propidium iodide (PI) labeling (n = 3) (B). Data were illustrated as mean±SD; # show the significant difference (p < 0.05) (C).
Molecules 27 01570 g004
Figure 5. Effect of different M. domestica hemolymph concentrations, 4 h (A) and 8 h (B) post-curcumin injection, on the incidence of apoptosis/necrosis in treated and control MCF-7 cells. The flow cytometric dot-plot was analyzed after annexinV/propidium iodide (PI) labeling, 4 h (C) and 8 h (D). Data were illustrated as mean ± SD (n = 3). # shows the significant increase (p < 0.05).
Figure 5. Effect of different M. domestica hemolymph concentrations, 4 h (A) and 8 h (B) post-curcumin injection, on the incidence of apoptosis/necrosis in treated and control MCF-7 cells. The flow cytometric dot-plot was analyzed after annexinV/propidium iodide (PI) labeling, 4 h (C) and 8 h (D). Data were illustrated as mean ± SD (n = 3). # shows the significant increase (p < 0.05).
Molecules 27 01570 g005
Table 1. Sequences of the primers used in the experiment.
Table 1. Sequences of the primers used in the experiment.
PrimerAccession No.Forward (5′–3′)Reverse (5′–3′)
MdCecAAF416602CGGAGGAAACAATCGCAAAT GTAGCATCGCGGGTATGTTG
β-actinJN9690885ACACACCAAAATGTGCGACG5′CGGTGGTGGTGAACGAGTAA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mahmoud, S.; Hassab El-Nabi, S.; Hawash, A.; El-Seedi, H.R.; Khalifa, S.A.M.; Ullah, S.; Al-Sehemi, A.G.; El-Garawani, I.M. RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect. Molecules 2022, 27, 1570. https://doi.org/10.3390/molecules27051570

AMA Style

Mahmoud S, Hassab El-Nabi S, Hawash A, El-Seedi HR, Khalifa SAM, Ullah S, Al-Sehemi AG, El-Garawani IM. RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect. Molecules. 2022; 27(5):1570. https://doi.org/10.3390/molecules27051570

Chicago/Turabian Style

Mahmoud, Shaymaa, Sobhy Hassab El-Nabi, Asmaa Hawash, Hesham R. El-Seedi, Shaden A. M. Khalifa, Sami Ullah, Abdullah G. Al-Sehemi, and Islam M. El-Garawani. 2022. "RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect" Molecules 27, no. 5: 1570. https://doi.org/10.3390/molecules27051570

APA Style

Mahmoud, S., Hassab El-Nabi, S., Hawash, A., El-Seedi, H. R., Khalifa, S. A. M., Ullah, S., Al-Sehemi, A. G., & El-Garawani, I. M. (2022). RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect. Molecules, 27(5), 1570. https://doi.org/10.3390/molecules27051570

Article Metrics

Back to TopTop