RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Curcumin Injection and Hemolymph Collection
2.3. Cecropin Evaluation
2.3.1. Nano LC–MS Analysis of M. domestica Cecropin Protein
2.3.2. RNA Extraction, cDNA Synthesis, and Quantitative PCR of M. Domestica Cecropin Gene (MdCecA)
2.4. In Vitro Anticancer Activity
2.4.1. Maintenance of Cell Lines
2.4.2. Cytotoxicity Assay
2.4.3. Cell Cycle Analysis
2.4.4. Apoptosis Detection
2.5. Data Analysis
3. Results
3.1. Insects’ Mortality and Morphology Changes
3.2. MdCecA Altered Expression
3.2.1. Quantification of MdCecA Peptide
3.2.2. Transcriptional Responses of M. Domestica Larvae to Curcumin Injection
3.3. Anticancer Effects of Curcumin-Injected M. Domestica Larval Hemolymph
3.3.1. Cytotoxicity
3.3.2. DNA Content and Cell Cycle Distribution
3.3.3. Apoptotic Effect on MCF-7
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- El-Garawani, I.M.; El-Sabbagh, S.M.; Abbas, N.H.; Ahmed, H.S.; Eissa, O.A.; Abo-Atya, D.M.; Khalifa, S.A.M.; El-Seedi, H.R. A newly isolated strain of Halomonas sp. (HA1) exerts anticancer potential via induction of apoptosis and G2/M arrest in hepatocellular carcinoma (HepG2) cell line. Sci. Rep. 2020, 10, 14076. [Google Scholar] [CrossRef] [PubMed]
- Tohamy, A.A.; El-Garawani, I.M.; Ibrahim, S.R.; Abdel Moneim, A.E. The apoptotic properties of Salvia aegyptiaca and Trigonella foenum-graecum extracts on Ehrlich ascites carcinoma cells: The effectiveness of combined treatment. Res. J. Pharm. Biol. Chem. Sci. 2016, 7, 1872–1883. [Google Scholar]
- Greenwell, M.; Rahman, P.K.S.M. Medicinal Plants: Their Use in Anticancer Treatment. Int. J. Pharm. Sci. Res. 2015, 6, 4103–4112. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.Y.; Tao, L.Y.; Liang, Y.J.; Chen, L.M.; Mi, Y.J.; Zheng, L.S.; Wang, F.; She, Z.G.; Lin, Y.C.; To, K.K.W.; et al. Anthracenedione derivatives as anticancer agents isolated from secondary metabolites of the mangrove endophytic fungi. Mar. Drugs 2010, 8, 1469–1481. [Google Scholar] [CrossRef]
- Liu, B.; Ezeogu, L.; Zellmer, L.; Yu, B.; Xu, N.; Joshua Liao, D. Protecting the normal in order to better kill the cancer. Cancer Med. 2015, 4, 1394–1403. [Google Scholar] [CrossRef]
- Fu, P.; Wu, J.; Guo, G. Purification and molecular identification of an antifungal peptide from the hemolymph of Musca domestica (housefly). Cell. Mol. Immunol. 2009, 6, 245–251. [Google Scholar] [CrossRef]
- Hwangbo, J.; Hong, E.C.; Jang, A.; Kang, H.K.; Oh, J.S.; Kim, B.W.; Park, B.S. Utilization of house fly-maggots, a feed supplement in the production of broiler chickens. J. Environ. Biol. 2009, 30, 609–614. [Google Scholar]
- Pemberton, R.W. Insects and other arthropods used as drugs in Korean traditional medicine. J. Ethnopharmacol. 1999, 65, 207–216. [Google Scholar] [CrossRef]
- Hou, L.; Shi, Y.; Zhai, P.; Le, G. Antibacterial activity and in vitro anti-tumor activity of the extract of the larvae of the housefly (Musca domestica). J. Ethnopharmacol. 2007, 111, 227–231. [Google Scholar] [CrossRef]
- Chu, F.J.; Jin, X.B.; Zhu, J.Y. Housefly maggots (Musca domestica) protein-enriched fraction/extracts (PE) inhibit lipopolysaccharide-induced atherosclerosis pro-inflammatory responses. J. Atheroscler. Thromb. 2011, 18, 282–290. [Google Scholar] [CrossRef]
- Cao, X.; Zhou, M.; Wang, C.; Hou, L.; Li, Y.; Chen, L. Musca domestica pupae lectin improves the immunomodulatory activity of macrophages by activating nuclear factor-κB. J. Med. Food 2012, 15, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Jin, X.; Wang, J.; Chu, F.; Zhu, J. Antihepatitis B virus activity of a protein-enriched fraction from housefly (Musca domestica) in a stable HBV-producing cell line. Sci. World J. 2014, 2014, 389560. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Kong, L.; Fang, N.; Mao, B.; Ai, H. Synthesis and functional characterization of MAF-1A peptide derived from the larvae of housefly, musca domestica (Diptera: Muscidae). J. Med. Entomol. 2016, 53, 1467–1472. [Google Scholar] [CrossRef] [PubMed]
- El-Garawani, I.; El-Seedi, H.; Khalifa, S.; El Azab, I.H.; Abouhendia, M.; Mahmoud, S. Enhanced Antioxidant and Cytotoxic Potentials of Lipopolysaccharides-Injected Musca domestica Larvae. Pharmaceutics 2020, 12, 1111. [Google Scholar] [CrossRef]
- Boman, H.G. Peptide Antibiotics and their Role in Innate Immunity. Annu. Rev. Immunol. 1995, 13, 61–92. [Google Scholar] [CrossRef]
- Bulet, P.; Hetru, C.; Dimarcq, J.L.; Hoffmann, D. Antimicrobial peptides in insects; structure and function. Dev. Comp. Immunol. 1999, 23, 329–344. [Google Scholar] [CrossRef]
- Steiner, H.; Hultmark, D.; Engström, Å.; Bennich, H.; Boman, H.G. Sequence and specificity of two antibacterial proteins involved in insect immunity. Nature 1981, 292, 246–248. [Google Scholar] [CrossRef]
- Bulet, P.; Stocklin, R. Insect Antimicrobial Peptides: Structures, Properties and Gene Regulation. Protein Pept. Lett. 2005, 12, 3–11. [Google Scholar] [CrossRef]
- Yi, H.Y.; Chowdhury, M.; Huang, Y.D.; Yu, X.Q. Insect antimicrobial peptides and their applications. Appl. Microbiol. Biotechnol. 2014, 98, 5807–5822. [Google Scholar] [CrossRef]
- Boman, H.G. Innate immunity and the normal microflora. Immunol. Rev. 2000, 173, 5–16. [Google Scholar] [CrossRef]
- van Hofsten, P.; Faye, I.; Kockum, K.; Lee, J.Y.; Xanthopoulos, K.G.; Boman, I.A.; Boman, H.G.; Engström, A.; Andreu, D.; Merrifield, R.B. Molecular cloning, cDNA sequencing, and chemical synthesis of cecropin B from Hyalophora cecropia. Proc. Natl. Acad. Sci. USA 1985, 82, 2240–2243. [Google Scholar] [CrossRef] [PubMed]
- Hultmark, D.; Engström, Å.; Bennich, H.; Kapur, R.; Boman, H.G. Insect Immunity: Isolation and Structure of Cecropin D and Four Minor Antibacterial Components from Cecropia Pupae. Eur. J. Biochem. 1982, 127, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Barr, S.C.; Rose, D.; Jaynes, J.M. Activity of lytic peptides against intracellular Trypanosoma cruzi amastigotes in vitro and parasitemias in mice. J. Parasitol. 1995, 81, 974–978. [Google Scholar] [CrossRef] [PubMed]
- Boisbouvier, J.; Prochnicka-Chalufour, A.; Nieto, A.R.; Torres, J.A.; Nanard, N.; Rodriguez, M.H.; Possani, L.D.; Delepierre, M. Structural information on a cecropin-like synthetic peptide, Shiva-3 toxic to the sporogonic development of Plasmodium berghei. Eur. J. Biochem. 1998, 257, 263–273. [Google Scholar] [CrossRef]
- Suttmann, H.; Retz, M.; Paulsen, F.; Harder, J.; Zwergel, U.; Kamradt, J.; Wullich, B.; Unteregger, G.; Stöckle, M.; Lehmann, J. Antimicrobial peptides of the Cecropin-family show potent antitumor activity against bladder cancer cells. BMC Urol. 2008, 8, 5. [Google Scholar] [CrossRef]
- Moore, A.J.; Devine, D.A.; Bibby, M.C. Preliminary experimental anticancer activity of cecropins. Pept. Res. 1994, 7, 265–269. [Google Scholar]
- Chen, H.M.; Wang, W.; Smith, D.; Chan, S.C. Effects of the anti-bacterial peptide cecropin B and its analogs, cecropins B-1 and B-2, on liposomes, bacteria, and cancer cells. Biochim. Biophys. Acta—Gen. Subj. 1997, 1336, 171–179. [Google Scholar] [CrossRef]
- Shin, S.Y.; Lee, M.K.; Kim, K.L.; Hahm, K.S. Structure-antitumor and hemolytic activity relationships of synthetic peptides derived from cecropin A-magainin 2 and cecropin A-melittin hybrid peptides. J. Pept. Res. 1997, 50, 279–285. [Google Scholar] [CrossRef]
- Chan, S.C.; Hui, L.; Chen, H.M. Enhancement of the cytolytic effect of anti-bacterial cecropin by the microvilli of cancer cells. Anticancer Res. 1998, 18, 4467–4474. [Google Scholar]
- Jin, X.; Mei, H.; Li, X.; Ma, Y.; Zeng, A.H.; Wang, Y.; Lu, X.; Chu, F.; Wu, Q.; Zhu, J. Apoptosis-inducing activity of the antimicrobial peptide cecropin of Musca domestica in human hepatocellular carcinoma cell line BEL-7402 and the possible mechanism. Acta Biochim. Biophys. Sin. 2010, 42, 259–265. [Google Scholar] [CrossRef]
- Fu, H.; Björstad, Å.; Dahlgren, C.; Bylund, J. A bactericidal cecropin-A peptide with a stabilized α-helical structure possess an increased killing capacity but no proinflammatory activity. Inflammation 2004, 28, 337–343. [Google Scholar] [CrossRef] [PubMed]
- Lu, D.; Geng, T.; Hou, C.; Huang, Y.; Qin, G.; Guo, X. Bombyx mori cecropin A has a high antifungal activity to entomopathogenic fungus Beauveria bassiana. Gene 2016, 583, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.K.; Lee, E.; Shin, S.; Jeong, K.W.; Lee, J.Y.; Bae, S.Y.; Kim, S.H.; Lee, J.; Kim, S.R.; Lee, D.G.; et al. Structure and function of papiliocin with antimicrobial and anti-inflammatory activities isolated from the swallowtail butterfly, Papilio xuthus. J. Biol. Chem. 2011, 286, 41296–41311. [Google Scholar] [CrossRef]
- Wu, J.; Lu, W.Y.; Cui, L.L. Inhibitory effect of curcumin on invasion of skin squamous cell carcinoma A431 cells. Asian Pac. J. Cancer Prev. 2015, 16, 2813–2818. [Google Scholar] [CrossRef] [PubMed]
- Tan, R.Z.; Liu, J.; Zhang, Y.Y.; Wang, H.L.; Li, J.C.; Liu, Y.H.; Zhong, X.; Zhang, Y.W.; Yan, Y.; Lan, H.Y.; et al. Curcumin relieved cisplatin-induced kidney inflammation through inhibiting Mincle-maintained M1 macrophage phenotype. Phytomedicine 2019, 52, 284–294. [Google Scholar] [CrossRef]
- Mantzorou, M.; Pavlidou, E.; Vasios, G.; Tsagalioti, E.; Giaginis, C. Effects of curcumin consumption on human chronic diseases: A narrative review of the most recent clinical data. Phytother. Res. 2018, 32, 957–975. [Google Scholar] [CrossRef]
- Basnet, P.; Skalko-Basnet, N. Curcumin: An anti-inflammatory molecule from a curry spice on the path to cancer treatment. Molecules 2011, 16, 4567–4598. [Google Scholar] [CrossRef]
- Creţu, E.; Trifan, A.; Vasincu, A.; Miron, A. Plant-derived anticancer agents-curcumin in cancer prevention and treatment Symphytum View project Special Issue: “Polyphenols in Plants” View project. Rev. Med. Chir. Soc. Med. Nat. Iasi. 2012, 116, 1223–1229. [Google Scholar]
- Strachecka, A.J.; Olszewski, K.; Paleolog, J. Curcumin stimulates biochemical mechanisms of Apis mellifera resistance and extends the apian life-span. J. Apic. Sci. 2015, 59, 129–141. [Google Scholar] [CrossRef]
- Codd, V.; Dolezel, D.; Stehlik, J.; Piccin, A.; Garner, K.J.; Racey, S.N.; Straatman, K.R.; Louis, E.J.; Costa, R.; Sauman, I.; et al. Circadian rhythm gene regulation in the housefly Musca domestica. Genetics 2007, 177, 1539–1551. [Google Scholar] [CrossRef][Green Version]
- Magdeldin, S.; Moresco, J.J.; Yamamoto, T.; Yates, J.R. Off-line multidimensional liquid chromatography and auto sampling result in sample loss in LC/LC-MS/MS. J. Proteome Res. 2014, 13, 3826–3836. [Google Scholar] [CrossRef] [PubMed]
- Saadeldin, I.M.; Swelum, A.A.A.; Elsafadi, M.; Mahmood, A.; Osama, A.; Shikshaky, H.; Alfayez, M.; Alowaimer, A.N.; Magdeldin, S. Thermotolerance and plasticity of camel somatic cells exposed to acute and chronic heat stress. J. Adv. Res. 2020, 22, 105–118. [Google Scholar] [CrossRef] [PubMed]
- Enany, S.; Zakeer, S.; Sayed, A.A.; Magdeldin, S. Shotgun proteomic analysis of ESBL-producing and non-ESBL-producing Klebsiella Pneumoniae clinical isolates. Microbiol. Res. 2020, 234, 126423. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhao, Y.; Lei, C.; Zhu, F. Antiviral and antitumor activities of the protein fractions from the larvae of the housefly, Musca domestica. Afr. J. Biotechnol. 2012, 11, 9468–9474. [Google Scholar] [CrossRef]
- Hao, Y.J.; Jing, Y.J.; Qu, H.; Li, D.S.; Du, R.Q. Purification and characterization of a thermal stable antimicrobial protein from housefly larvae, Musca domestica, induced by ultrasonic wave. Acta Biol. Hung. 2008, 59, 289–304. [Google Scholar] [CrossRef]
- Wen, C.; Qu, C.; Li, D.; Zhang, X. Influence of Immuned Hemolymph of Housefly on Ultrastructures and Cell Cycles of SMMC-7721 Cells. Henan J. Oncol. 2004, 17, 100–102. [Google Scholar]
- Zhao, R.J.; Zhang, Q.H.; Li, F.D. The effection of antimicrobial peptides extracted from adult housefly on tumour cell. Chin. J. Vector Biol. Control 2007, 18, 17–19. [Google Scholar]
- Wilken, R.; Veena, M.S.; Wang, M.B.; Srivatsan, E.S. Curcumin: A review of anti-cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Mol. Cancer 2011, 10, 12. [Google Scholar] [CrossRef]
- Ak, T.; Gülçin, I. Antioxidant and radical scavenging properties of curcumin. Chem.-Biol. Interact. 2008, 174, 27–37. [Google Scholar] [CrossRef]
- Coleman, D.T.; Soung, Y.H.; Surh, Y.J.; Cardelli, J.A.; Chung, J. Curcumin prevents palmitoylation of integrin β4 in breast cancer cells. PLoS ONE 2015, 10, e0125399. [Google Scholar] [CrossRef]
- Li, W.; Zhou, Y.; Yang, J.; Li, H.; Zhang, H.; Zheng, P. Curcumin induces apoptotic cell death and protective autophagy in human gastric cancer cells. Oncol. Rep. 2017, 37, 3459–3466. [Google Scholar] [CrossRef] [PubMed]
- Marquardt, J.U.; Gomez-Quiroz, L.; Arreguin Camacho, L.O.; Pinna, F.; Lee, Y.H.; Kitade, M.; Domínguez, M.P.; Castven, D.; Breuhahn, K.; Conner, E.A.; et al. Curcumin effectively inhibits oncogenic NF-κB signaling and restrains stemness features in liver cancer. J. Hepatol. 2015, 63, 661–669. [Google Scholar] [CrossRef] [PubMed]
- Mishra, A.; Kumar, R.; Tyagi, A.; Kohaar, I.; Hedau, S.; Bharti, A.C.; Sarker, S.; Dey, D.; Saluja, D.; Das, B. Curcumin modulates cellular AP-1, NF-kB, and HPV16 E6 proteins in oral cancer. Ecancermedicalscience 2015, 9, 525. [Google Scholar] [CrossRef] [PubMed]
- Shakibaei, M.; Kraehe, P.; Popper, B.; Shayan, P.; Goel, A.; Buhrmann, C. Curcumin potentiates antitumor activity of 5-fluorouracil in a 3D alginate tumor microenvironment of colorectal cancer. BMC Cancer 2015, 15, 250. [Google Scholar] [CrossRef] [PubMed]
- Terlikowska, K.M.; Witkowska, A.M.; Zujko, M.E.; Dobrzycka, B.; Terlikowski, S.J. Potential application of curcumin and its analogues in the treatment strategy of patients with primary epithelial ovarian cancer. Int. J. Mol. Sci. 2014, 15, 21703–21722. [Google Scholar] [CrossRef] [PubMed]
- Zanotto-Filho, A.; Braganhol, E.; Klafke, K.; Figueiró, F.; Terra, S.R.; Paludo, F.J.; Morrone, M.; Bristot, I.J.; Battastini, A.M.; Forcelini, C.M.; et al. Autophagy inhibition improves the efficacy of curcumin/temozolomide combination therapy in glioblastomas. Cancer Lett. 2015, 358, 220–231. [Google Scholar] [CrossRef] [PubMed]
- Amin, A.R.M.R.; Haque, A.; Rahman, M.A.; Chen, Z.G.; Khuri, F.R.; Shin, D.M. Curcumin induces apoptosis of upper aerodigestive tract cancer cells by targeting multiple pathways. PLoS ONE 2015, 10, e0124218. [Google Scholar] [CrossRef]
- Bimonte, S.; Barbieri, A.; Palma, G.; Rea, D.; Luciano, A.; D’Aiuto, M.; Arra, C.; Izzo, F. Dissecting the role of curcumin in tumour growth and angiogenesis in mouse model of human breast cancer. BioMed Res. Int. 2015, 2015, 878134. [Google Scholar] [CrossRef]
- Grizanova, E.; Dubovskiy, I.; Whitten, M.; Glupov, V.V. Contributions of cellular and humoral immunity of Galleria mellonella larvae in defence against oral infection by Bacillus thuringiensis. J. Invertebr. Pathol. 2014, 119, 40–46. [Google Scholar] [CrossRef]
- Hoffmann, J.A.; Reichhart, J.M.; Hetru, C. Innate immunity in higher insects. Curr. Opin. Immunol. 1996, 8, 8–13. [Google Scholar] [CrossRef]
- Milanezi, F.; Leito, D.; Ricardo, S.; Augusto, I.; Schmitt, F. Evaluation of HER2 in breast cancer: Reality and expectations. Expert Opin. Med. Diagn. 2009, 3, 607–620. [Google Scholar] [CrossRef] [PubMed]
- Reed, J.C. Warner-Lambert/Parke Davis award lecture: Mechanisms of apoptosis. Am. J. Pathol. 2000, 157, 1415–1430. [Google Scholar] [CrossRef]
- Qian, Y.; Li, G.J.; Wang, R.; Zhou, Y.L.; Sun, P.; Zhao, X. In vitro anticancer effects of insect tea in TCA8113 cells. J. Cancer Res. Ther. 2014, 10, 1045–1051. [Google Scholar] [CrossRef] [PubMed]
- Sackton, T.B.; Lazzaro, B.P.; Clark, A.G.; Wittkopp, P. Rapid expansion of immune-related gene families in the house fly, musca domestica. Mol. Biol. Evol. 2017, 34, 857–872. [Google Scholar] [CrossRef]
- Kobayashi, A.; Matsui, M.; Kubo, T.; Natori, S. Purification and characterization of a 59-kilodalton protein that specifically binds to NF-kappa B-binding motifs of the defense protein genes of Sarcophaga peregrina (the flesh fly). Mol. Cell Biol. 1993, 13, 4049–4056. [Google Scholar]
- Dimarcq, J.L.; Hoffmann, D.; Meister, M.; Bulet, P.; Lanot, R.; Reichhart, J.M.; Hoffmann, J.A. Characterization and transcriptional profiles of a Drosophila gene encoding an insect defensin. A study in insect immunity. Eur. J. Biochem. 1994, 221, 201–209. [Google Scholar] [CrossRef]
- Józefiak, A.; Engberg, R.M. Insect proteins as a potential source of antimicrobial peptides in livestock production. A review. J. Anim. Feed Sci. 2017, 26, 87–99. [Google Scholar] [CrossRef]
- Meister, S.; Kanzok, S.M.; Zheng, X.-L.; Luna, C.; Li, T.-R.; Hoa, N.T.; Clayton, J.R.; White, K.P.; Kafatos, F.C.; Christophides, G.K.; et al. Immune signaling pathways regulating bacterial and malaria parasite infection of the mosquito Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2005, 102, 11420–11425. [Google Scholar] [CrossRef]
- Das De, T.; Sharma, P.; Thomas, T.; Singla, D.; Tevatiya, S.; Kumari, S.; Chauhan, C.; Rani, J.; Srivastava, V.; Kaur, R.; et al. Interorgan Molecular Communication Strategies of “Local” and “Systemic” Innate Immune Responses in Mosquito Anopheles stephensi. Front. Immunol. 2018, 9, 148. [Google Scholar] [CrossRef]
- Haine, E.R.; Moret, Y.; Siva-Jothy, M.T.; Rolff, J. Antimicrobial defense and persistent infection in insects. Science 2008, 322, 1257–1259. [Google Scholar] [CrossRef]
- Iketani, M.; Morishima, I. Induction of antibacterial protein synthesis by soluble peptidoglycan in isolated fat body from larvae of the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 1993, 23, 913–917. [Google Scholar] [CrossRef]
- Morishima, I.; Horiba, T.; Iketani, M.; Nishioka, E.; Yamano, Y. Parallel induction of cecropin and lysozyme in larvae of the silkworm, Bombyx mori. Dev. Comp. Immunol. 1995, 19, 357–363. [Google Scholar] [CrossRef]
- Hong, S.-M.; Kusakabe, T.; Lee, J.-M.; Tatsuke, T.; Kawaguchi, Y.; Kang, M.-W.; Kang, S.-W.; Kim, K.-A.; Nho, S.-K. Structure and Expression Analysis of the Cecropin-E Gene from the Silkworm, Bombyx mori. Biosci. Biotechnol. Biochem. 2008, 72, 1992–1998. [Google Scholar] [CrossRef]
- Yamano, Y.; Matsumoto, M.; Inoue, K.; Kawabata, T.; Morishima, I. Cloning of cDNAs for Cecropins A and B, and Expression of the Genes in the Silkworm, Bombyx mori. Biosci. Biotechnol. Biochem. 1994, 58, 1476–1478. [Google Scholar] [CrossRef]
- Yang, J.; Furukawa, S.; Sagisaka, A.; Ishibashi, J.; Taniai, K.; Shono, T.; Yamakawa, M. cDNA cloning and gene expression of cecropin D, an antibacterial protein in the silkworm, Bombyx mori. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1999, 122, 409–414. [Google Scholar] [CrossRef]
- Wu, J.; Mu, L.; Zhuang, L.; Han, Y.; Liu, T.; Li, J.; Yang, Y.; Yang, H.; Wei, L. A cecropin-like antimicrobial peptide with anti-inflammatory activity from the black fly salivary glands. Parasit Vectors 2015, 8, 561. [Google Scholar] [CrossRef] [PubMed]
- Vizioli, J.; Bulet, P.; Charlet, M.; Lowenberger, C.; Blass, C.; Müller, H.M.; Dimopoulos, G.; Hoffmann, J.; Kafatos, F.C.; Richman, A. Cloning and analysis of a cecropin gene from the malaria vector mosquito, Anopheles gambiae. Insect Mol. Biol. 2000, 9, 75–84. [Google Scholar] [CrossRef]
- Christophides, G.K.; Zdobnov, E.; Barillas-Mury, C.; Birney, E.; Blandin, S.; Blass, C.; Brey, P.T.; Collins, F.H.; Danielli, A.; Dimopoulos, G.; et al. Immunity-related genes and gene families in Anopheles gambiae. Science 2002, 298, 159–165. [Google Scholar] [CrossRef]
- Bevivino, G.; Arcà, B.; Lombardo, F. Effects of Local and Systemic Immune Challenges on the Expression of Selected Salivary Genes in the Malaria Mosquito Anopheles coluzzii. Pathogens 2021, 10, 1300. [Google Scholar] [CrossRef]
- Cerón, J.M.A.; Contreras-Moreno, J.; Puertollano, E.; De Cienfuegos, G.Á.; Puertollano, M.A.; De Pablo, M.A. The antimicrobial peptide cecropin A induces caspase-independent cell death in human promyelocytic leukemia cells. Peptides 2010, 31, 1494–1503. [Google Scholar] [CrossRef]
- Zhai, Z.; Ni, X.; Jin, C.; Ren, W.; Li, J.; Deng, J.; Deng, B.; Yin, Y. Cecropin a modulates tight junction-related protein expression and enhances the barrier function of porcine intestinal epithelial cells by suppressing the MEK/ERK pathway. Int. J. Mol. Sci. 2018, 19, 1941. [Google Scholar] [CrossRef] [PubMed]





| Primer | Accession No. | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|---|
| MdCecA | AF416602 | CGGAGGAAACAATCGCAAAT | GTAGCATCGCGGGTATGTTG |
| β-actin | JN969088 | 5ACACACCAAAATGTGCGACG | 5′CGGTGGTGGTGAACGAGTAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahmoud, S.; Hassab El-Nabi, S.; Hawash, A.; El-Seedi, H.R.; Khalifa, S.A.M.; Ullah, S.; Al-Sehemi, A.G.; El-Garawani, I.M. RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect. Molecules 2022, 27, 1570. https://doi.org/10.3390/molecules27051570
Mahmoud S, Hassab El-Nabi S, Hawash A, El-Seedi HR, Khalifa SAM, Ullah S, Al-Sehemi AG, El-Garawani IM. RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect. Molecules. 2022; 27(5):1570. https://doi.org/10.3390/molecules27051570
Chicago/Turabian StyleMahmoud, Shaymaa, Sobhy Hassab El-Nabi, Asmaa Hawash, Hesham R. El-Seedi, Shaden A. M. Khalifa, Sami Ullah, Abdullah G. Al-Sehemi, and Islam M. El-Garawani. 2022. "RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect" Molecules 27, no. 5: 1570. https://doi.org/10.3390/molecules27051570
APA StyleMahmoud, S., Hassab El-Nabi, S., Hawash, A., El-Seedi, H. R., Khalifa, S. A. M., Ullah, S., Al-Sehemi, A. G., & El-Garawani, I. M. (2022). RETRACTED: Curcumin-Injected Musca domestica Larval Hemolymph: Cecropin Upregulation and Potential Anticancer Effect. Molecules, 27(5), 1570. https://doi.org/10.3390/molecules27051570

