Beta-Caryophyllene Enhances the Anti-Tumor Activity of Cisplatin in Lung Cancer Cell Lines through Regulating Cell Cycle and Apoptosis Signaling Molecules
Abstract
1. Introduction
2. Results
2.1. Cytotoxicity of Beta-Caryophyllene and Cisplatin and Their Synergistic Effect
2.2. Effect of Beta-Caryophyllene and Cisplatin on Migration and Invasion Activities of Lung Cancer Cell Lines
2.3. Effect of Combination Treatment on Mitochondrial Membrane Potential of A549 Cell Lines
2.4. Beta-Caryophyllene Interacts with the Inhibitor of Cyclin Dependent Kinase-1A, CDKN6
2.5. Beta Caryophyllene Enhances Cisplatin Effect on Cell Cycle, Apoptosis and EMT Signaling Molecules
3. Materials and Methods
3.1. Cell Lines Culture, Cell Proliferation and MTT Assay
3.2. Cell Migration Assay (Wound Healing Assay)
3.3. Cell Invasion Assay (Transwell Assay)
3.4. In Silico Analysis
3.5. RNA Isolation and Quantitative Real-Time PCR
3.6. Western Blot Analysis
3.7. Statistical Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dahham, S.S.; Tabana, Y.; Asif, M.; Ahmed, M.; Babu, D.; Hassan, L.E.; Ahamed, M.B.K.; Sandai, D.; Barakat, K.; Siraki, A.; et al. β-Caryophyllene Induces Apoptosis and Inhibits Angiogenesis in Colorectal Cancer Models. Int. J. Mol. Sci. 2021, 22, 10550. [Google Scholar] [CrossRef]
- Arul, S.; Rajagopalan, H.; Ravi, J.; Dayalan, H. Beta-Caryophyllene Suppresses Ovarian Cancer Proliferation by Inducing Cell Cycle Arrest and Apoptosis. Anti-Cancer Agents Med. Chem. 2020, 20, 1530–1537. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Liao, B.; Zhu, P.; Cheng, S.; Du, Z.; Jiang, G. β-Caryophyllene induces apoptosis and inhibits cell proliferation by deregulation of STAT-3/mTOR/AKT signaling in human bladder cancer cells: An in vitro study. J. Biochem. Mol. Toxicol. 2021, 35, e22863. [Google Scholar] [CrossRef] [PubMed]
- Lei, J.; Wang, Q.; Li, G.; Li, Y.; Zhang, P.; Xu, G. β-Caryophyllene from Chilli Pepper Inhibits the Proliferation of Non-Small Cell Lung Cancer Cells by Affecting miR-659-3p-Targeted Sphingosine Kinase 1 (SphK1). Int. J. Gen. Med. 2021, 14, 9599–9613. [Google Scholar] [CrossRef]
- Chung, K.-S.; Hong, J.Y.; Lee, J.-H.; Lee, H.-J.; Park, J.Y.; Choi, J.-H.; Park, H.-J.; Hong, J.; Lee, K.-T. β-Caryophyllene in the Essential Oil from Chrysanthemum Boreale Induces G1 Phase Cell Cycle Arrest in Human Lung Cancer Cells. Molecules 2019, 24, 3754. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.-L.; Chang, J.-C.; Fang, L.-W.; Hsu, H.-F.; Lee, L.-C.; Yang, J.-F.; Liang, M.-T.; Hsiao, P.-C.; Wang, C.-P.; Wang, S.-W.; et al. Bulnesia sarmientoi Supercritical Fluid Extract Exhibits Necroptotic Effects and Anti-Metastatic Activity on Lung Cancer Cells. Molecules 2018, 23, 3304. [Google Scholar] [CrossRef] [PubMed]
- Dilruba, S.; Kalayda, G.V. Platinum-based drugs: Past, present and future. Cancer Chemother. Pharmacol. 2016, 77, 1103–1124. [Google Scholar] [CrossRef]
- Kryczka, J.; Kryczka, J.; Czarnecka-Chrebelska, K.H.; Brzeziańska-Lasota, E. Molecular Mechanisms of Chemoresistance Induced by Cisplatin in NSCLC Cancer Therapy. Int. J. Mol. Sci. 2021, 22, 8885. [Google Scholar] [CrossRef]
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef]
- Zhu, X.; Zhu, H.; Luo, H.; Zhang, W.; Shen, Z.; Hu, X. Molecular mechanisms of cisplatin resistance in cervical cancer. Drug Des. Dev. Ther. 2016, 10, 1885–1895. [Google Scholar] [CrossRef]
- Makovec, T. Cisplatin and beyond: Molecular mechanisms of action and drug resistance development in cancer chemotherapy. Radiol. Oncol. 2019, 53, 148–158. [Google Scholar] [CrossRef] [PubMed]
- Kelland, L. The resurgence of platinum-based cancer chemotherapy. Nat. Rev. 2007, 7, 573–584. [Google Scholar] [CrossRef] [PubMed]
- Tao, K.; Yin, Y.; Shen, Q.; Chen, Y.; Li, R.; Chang, W.; Bai, J.; Liu, W.; Shi, L.; Zhang, P. Akt inhibitor MK-2206 enhances the effect of cisplatin in gastric cancer cells. Biomed. Rep. 2016, 4, 365–368. [Google Scholar] [CrossRef] [PubMed]
- Arita, M.; Watanabe, S.; Aoki, N.; Kuwahara, S.; Suzuki, R.; Goto, S.; Abe, Y.; Takahashi, M.; Sato, M.; Hokari, S.; et al. Combination therapy of cisplatin with cilastatin enables an increased dose of cisplatin, enhancing its antitumor effect by suppression of nephrotoxicity. Sci. Rep. 2021, 11, 750. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, E.A.; Alkuwayti, M.A.; Ibrahim, H.-I.M. Atropine Is a Suppressor of Epithelial–Mesenchymal Transition (EMT) That Reduces Stemness in Drug-Resistant Breast Cancer Cells. Int. J. Mol. Sci. 2022, 23, 9849. [Google Scholar] [CrossRef]
- Dong, J.; Su, S.-Y.; Wang, M.-Y.; Zhan, Z. Shenqi fuzheng, an injection concocted from chinese medicinal herbs, combined with platinum-based chemotherapy for advanced non-small cell lung cancer: A systematic review. J. Exp. Clin. Cancer Res. 2010, 29, 137. [Google Scholar] [CrossRef]
- Kim, J.-H.; Jeong, S.-J.; Kim, B.; Yun, S.-M.; Choi, D.Y.; Kim, S.-H. Melatonin synergistically enhances cisplatin-induced apoptosis via the dephosphorylation of ERK/p90 ribosomal S6 kinase/heat shock protein 27 in SK-OV-3 cells. J. Pineal Res. 2012, 52, 244–252. [Google Scholar] [CrossRef]
- Tseng, C.-Y.; Lin, C.-H.; Wu, L.-Y.; Wang, J.-S.; Chung, M.-C.; Chang, J.-F.; Chao, M.-W. Potential Combinational Anti-Cancer Therapy in Non-Small Cell Lung Cancer with Traditional Chinese Medicine Sun-Bai-Pi Extract and Cisplatin. PLoS ONE 2016, 11, e0155469. [Google Scholar] [CrossRef]
- Zhang, P.; Gao, W.Y.; Turner, S.; Ducatman, B.S. Gleevec (STI-571) inhibits lung cancer cell growth (A549) and potentiates the cisplatin effect in vitro. Mol. Cancer 2003, 2, 1. [Google Scholar] [CrossRef] [PubMed]
- Baharuddin, P.; Satar, N.; Fakiruddin, K.S.; Zakaria, N.; Lim, M.N.; Yusoff, N.M.; Zakaria, Z.; Yahaya, B.H. Curcumin improves the efficacy of cisplatin by targeting cancer stem-like cells through p21 and cyclin D1-mediated tumour cell inhibition in non-small cell lung cancer cell lines. Oncol. Rep. 2016, 35, 13–25. [Google Scholar] [CrossRef]
- Plaimee, P.; Weerapreeyakul, N.; Barusrux, S.; Johns, N.P. Melatonin potentiates cisplatin-induced apoptosis and cell cycle arrest in human lung adenocarcinoma cells. Cell Prolif. 2015, 48, 67–77. [Google Scholar] [CrossRef]
- Abbas, T.; Dutta, A. p21 in cancer: Intricate networks and multiple activities. Nat. Rev. Cancer 2009, 9, 400–414. [Google Scholar] [CrossRef] [PubMed]
- Zamagni, A.; Pasini, A.; Pirini, F.; Ravaioli, S.; Tesei, A.; Calistri, D.; Ulivi, P.; Foca, F.; Delmonte, A.; Molinari, C. CDKN1A upregulation and cisplatin-pemetrexed resistance in non-small cell lung cancer cells. Int. J. Oncol. 2020, 56, 1574–1584. [Google Scholar] [CrossRef] [PubMed]





| Protein Receptor | Ligand | Grid Box | Binding Affinity | Interaction Residues | Bond Distance | Interaction Category | Pi Sigma | Alkyl |
|---|---|---|---|---|---|---|---|---|
| CDK6 (4EZ5) | Beta-Caryophyllene (CID-No- 5281515) | 52.517 | −7.8 | VAL 27 PHE 98 ILE 19 LEU152 ALA162 | 4.94 3.88 5.45 5.13 4.09 | Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic | PHE 98 | VAL 27 ILE 19 LEU 152 ALA 162 |
| Primer Name | Forward Primer | Reverse Primer | PCR Product Size |
|---|---|---|---|
| CDKN1A | AGGTGGACCTGGAGACTCTCAG | AGGTGGACCTGGAGACTCTCAG | 188 |
| E-Cad | GCCTCCTGAAAAGAGAGTGGAAG | TGGCAGTGTCTCTCCAAATCCG | 189 |
| ZEB2 | AATGCACAGAGTGTGGCAAGGC | CTGCTGATGTGCGAACTGTAGG | 231 |
| BCL-2 | GATTGTGGCCTTCTTTGAG | CAAACTGAGCAGAGTCTTC | 212 |
| BCL-xl | CAGAGCTTTGAACAGGTAG | GCTCTCGGGTGCTGTATTG | 167 |
| GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | 195 |
| Protein Target | Primary Antibody Dilution | Secondary Antibody Dilution | Company |
|---|---|---|---|
| CDKN1A | Rabbit polyclonal antibody (1:500) | HRP conjugated rabbit IgG antibodies | Biorbyt, Cambridge, UK |
| ECAD | Mouse polyclonal antibody (1:1000) | HRP conjugated Mouse IgG antibodies | Biorbyt, Cambridge, UK |
| ZEB-2 | Mouse monoclonal antibody (1:750) | HRP conjugated mouse IgG antibodies | Biorbyt, Cambridge, UK |
| BCL2 | Rabbit polyclonal (1:1200) | HRP conjugated Rabbit IgG antibodies | Invitrogen, Waltham, MA, USA |
| BCLxl | Rabbit polyclonal (1:1500) | HRP conjugated rabbit IgG antibodies | Invitrogen, Waltham, MA, USA |
| Actin | Rabbit polyclonal antibody (1:1000) | HRP conjugated rabbit IgG antibodies |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmed, E.A.; Abu Zahra, H.; Ammar, R.B.; Mohamed, M.E.; Ibrahim, H.-I.M. Beta-Caryophyllene Enhances the Anti-Tumor Activity of Cisplatin in Lung Cancer Cell Lines through Regulating Cell Cycle and Apoptosis Signaling Molecules. Molecules 2022, 27, 8354. https://doi.org/10.3390/molecules27238354
Ahmed EA, Abu Zahra H, Ammar RB, Mohamed ME, Ibrahim H-IM. Beta-Caryophyllene Enhances the Anti-Tumor Activity of Cisplatin in Lung Cancer Cell Lines through Regulating Cell Cycle and Apoptosis Signaling Molecules. Molecules. 2022; 27(23):8354. https://doi.org/10.3390/molecules27238354
Chicago/Turabian StyleAhmed, Emad A., Hamad Abu Zahra, Rebai Ben Ammar, Maged Elsayed Mohamed, and Hairul-Islam M. Ibrahim. 2022. "Beta-Caryophyllene Enhances the Anti-Tumor Activity of Cisplatin in Lung Cancer Cell Lines through Regulating Cell Cycle and Apoptosis Signaling Molecules" Molecules 27, no. 23: 8354. https://doi.org/10.3390/molecules27238354
APA StyleAhmed, E. A., Abu Zahra, H., Ammar, R. B., Mohamed, M. E., & Ibrahim, H.-I. M. (2022). Beta-Caryophyllene Enhances the Anti-Tumor Activity of Cisplatin in Lung Cancer Cell Lines through Regulating Cell Cycle and Apoptosis Signaling Molecules. Molecules, 27(23), 8354. https://doi.org/10.3390/molecules27238354

