Natural Hemp-Ginger Extract and Its Biological and Therapeutic Efficacy
Abstract
1. Introduction
2. Results
2.1. Extract Characteristics
2.2. Minimum Inhibitory Concentration for Microorganisms
2.3. Metabolic Activity of WM-266-4 Cells and Appoptosis
2.4. Molecular Analysis
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Process and Preparation of Extract
4.3. Liquid Chromatography-Tandem Mass Spectrometry Analyses
4.4. Microdilution Method for Determination of Antimicrobial Activity
4.5. Metabolic Activity of WM-266-4 and Normal Human Epidermal Melanocytes
4.6. Determination of Cell Apoptosis
4.7. Molecular Analysis-Gene Expression
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Parisi, R.; Iskandar, I.Y.K.; Kontopantelis, E.; Augustin, M.; Griffiths, C.E.M.; Ashcroft, D.M. National, regional, and worldwide epidemiology of psoriasis: Systematic analysis and modelling study. BMJ 2020, 369, m1590. [Google Scholar] [CrossRef]
- Cramer, P.; Stockfleth, E. Actinic keratosis: Where do we stand and where is the future going to take us? Expert Opin. Emerg. Drugs 2020, 25, 49–58. [Google Scholar] [CrossRef]
- Van Zuuren, E.J.; Arents, B.W.M.; van der Linden, M.M.D.; Vermeulen, S.; Fedorowicz, Z.; Tan, J. Rosacea: New Concepts in Classification and Treatment. Am. J. Clin. Dermatol. 2021, 22, 457–465. [Google Scholar] [CrossRef]
- Li, A.; Fan, L.; Xie, L.; Ren, Y.; Li, L. Associations between air pollution, climate factors and outpatient visits for eczema in West China Hospital, Chengdu, south-western China: A time series analysis. J. Eur. Acad. Dermatol. Venereol. 2018, 32, 486–494. [Google Scholar] [CrossRef]
- Clarke, C.A.; McKinley, M.; Hurley, S.; Haile, R.W.; Glaser, S.L.; Keegan, T.H.M.; Swetter, S.M. Continued Increase in Melanoma Incidence across all Socioeconomic Status Groups in California, 1998–2012. J. Investig. Dermatol. 2017, 137, 2282–2290. [Google Scholar] [CrossRef]
- Schmitz, L.; Gambichler, T.; Kost, C.; Gupta, G.; Stücker, M.; Stockfleth, E.; Dirschka, T. Cutaneous squamous cell carcinomas are associated with basal proliferating actinic keratoses. Br. J. Dermatol. 2019, 180, 916–921. [Google Scholar] [CrossRef]
- Kricker, A.; Weber, M.; Sitas, F.; Banks, E.; Rahman, B.; Goumas, C.; Kabir, A.; Hodgkinson, V.S.; van Kemenade, C.H.; Waterboer, T.; et al. Early Life UV and Risk of Basal and Squamous Cell Carcinoma in New South Wales, Australia. Photochem. Photobiol. 2017, 93, 1483–1491. [Google Scholar] [CrossRef]
- Marrot, L. Pollution and Sun Exposure: A Deleterious Synergy. Mechanisms and Opportunities for Skin Protection. Curr. Med. Chem. 2018, 25, 5469–5486. [Google Scholar] [CrossRef]
- Glancy, D.L.; Roberts, W.C. The heart in malignant melanoma: A study of 70 autopsy cases. Am. J. Cardiol. 1968, 21, 555–571. [Google Scholar] [CrossRef]
- Aerts, B.R.J.; Kock, M.C.J.M.; Kofflard, M.J.M.; Plaisier, P.W. Cardiac metastasis of malignant melanoma: A case report. Neth. Heart J. 2014, 22, 39–41. [Google Scholar] [CrossRef]
- Mofidi, A.; Tompa, E.; Spencer, J.; Kalcevich, C.; Peters, C.E.; Kim, J.; Song, C.; Mortazavi, S.B.; Demers, P.A. The economic burden of occupational non-melanoma skin cancer due to solar radiation. J. Occup. Environ. Hyg. 2018, 15, 481–491. [Google Scholar] [CrossRef]
- Rademaker, M.; Agnew, K.; Anagnostou, N.; Andrews, M.; Armour, K.; Baker, C.; Foley, P.; Gebauer, K.; Gupta, M.; Marshman, G.; et al. Psoriasis and infection. A clinical practice narrative. Australas. J. Dermatol. 2019, 60, 91–98. [Google Scholar] [CrossRef]
- Pietrzak, A.; Grywalska, E.; Socha, M.; Roliński, J.; Franciszkiewicz-Pietrzak, K.; Rudnicka, L.; Rudzki, M.; Krasowska, D. Prevalence and Possible Role of Candida Species in Patients with Psoriasis: A Systematic Review and Meta-Analysis. Mediat. Inflamm. 2018, 2018, 9602362. [Google Scholar] [CrossRef]
- Thrastardottir, T.; Love, T.J. Infections and the risk of psoriatic arthritis among psoriasis patients: A systematic review. Rheumatol. Int. 2018, 38, 1385–1397. [Google Scholar] [CrossRef]
- Takahashi, T.; Yamasaki, K. Psoriasis and Antimicrobial Peptides. Int. J. Mol. Sci. 2020, 21, 6791. [Google Scholar] [CrossRef]
- Huang, L.; Gao, R.; Yu, N.; Zhu, Y.; Ding, Y.; Qin, H. Dysbiosis of gut microbiota was closely associated with psoriasis. Sci. China Life Sci. 2019, 62, 807–815. [Google Scholar] [CrossRef]
- Ely, P.H. Is psoriasis a bowel disease? Successful treatment with bile acids and bioflavonoids suggests it is. Clin. Dermatol. 2018, 36, 376–389. [Google Scholar] [CrossRef]
- Dhadwal, G.; Kirchhof, M.G. The Risks and Benefits of Cannabis in the Dermatology Clinic. J. Cutan. Med. Surg. 2017, 22, 194–199. [Google Scholar] [CrossRef]
- Ramot, Y.; Sugawara, K.; Zákány, N.; Tóth, B.I.; Bíró, T.; Paus, R. A novel control of human keratin expression: Cannabinoid receptor 1-mediated signaling down-regulates the expression of keratins K6 and K16 in human keratinocytes in vitro and in situ. PeerJ 2013, 1, e40. [Google Scholar] [CrossRef]
- Sheriff, T.; Lin, M.J.; Dubin, D.; Khorasani, H. The potential role of cannabinoids in dermatology. J. Dermatol. Treat. 2020, 31, 839–845. [Google Scholar] [CrossRef]
- Scheau, C.; Badarau, I.A.; Mihai, L.-G.; Scheau, A.-E.; Costache, D.O.; Constantin, C.; Calina, D.; Caruntu, C.; Costache, R.S.; Caruntu, A. Cannabinoids in the Pathophysiology of Skin Inflammation. Molecules 2020, 25, 652. [Google Scholar] [CrossRef]
- Wang, M.; Wang, Y.-H.; Avula, B.; Radwan, M.M.; Wanas, A.S.; van Antwerp, J.; Parcher, J.F.; ElSohly, M.A.; Khan, I.A. Decarboxylation Study of Acidic Cannabinoids: A Novel Approach Using Ultra-High-Performance Supercritical Fluid Chromatography/Photodiode Array-Mass Spectrometry. Cannabis Cannabinoid Res. 2016, 1, 262–271. [Google Scholar] [CrossRef] [PubMed]
- Dussy, F.E.; Hamberg, C.; Luginbühl, M.; Schwerzmann, T.; Briellmann, T.A. Isolation of Δ9-THCA-A from hemp and analytical aspects concerning the determination of Δ9-THC in cannabis products. Forensic Sci. Int. 2005, 149, 3–10. [Google Scholar] [CrossRef]
- Azad, M.O.K.; Ryu, B.R.; Rana, M.S.; Rahman, M.H.; Lim, J.-D.; Lim, Y.-S. Enhancing the Cannabidiol (CBD) Compound in Formulated Hemp (Cannabis sativa L.) Leaves through the Application of Hot-Melt Extrusion. Processes 2021, 9, 837. [Google Scholar] [CrossRef]
- Triantafillidis, J.K.; Triantafyllidi, A.; Vagianos, C.; Papalois, A. Favorable results from the use of herbal and plant products in inflammatory bowel disease: Evidence from experimental animal studies. Ann. Gastroenterol. 2016, 29, 268–281. [Google Scholar] [CrossRef]
- Ko, J.K.; Leung, C.C. Ginger extract and polaprezinc exert gastroprotective actions by anti-oxidant and growth factor modulating effects in rats. J. Gastroenterol. Hepatol. 2010, 25, 1861–1869. [Google Scholar] [CrossRef]
- Amparo, T.R.; Seibert, J.B.; Vieira, P.M.A.; Teixeira, L.F.M.; Santos, O.; de Souza, G.H.B. Herbal medicines to the treatment of skin and soft tissue infections: Advantages of the multi-targets action. Phytother. Res. 2020, 34, 94–103. [Google Scholar] [CrossRef]
- Grzanna, R.; Lindmark, L.; Frondoza, C.G. Ginger—An Herbal Medicinal Product with Broad Anti-Inflammatory Actions. J. Med. Food 2005, 8, 125–132. [Google Scholar] [CrossRef]
- Shukla, Y.; Singh, M. Cancer preventive properties of ginger: A brief review. Food Chem. Toxicol. 2007, 45, 683–690. [Google Scholar] [CrossRef]
- Ryan, J.L.; Heckler, C.E.; Roscoe, J.A.; Dakhil, S.R.; Kirshner, J.; Flynn, P.J.; Hickok, J.T.; Morrow, G.R. Ginger (Zingiber officinale) reduces acute chemotherapy-induced nausea: A URCC CCOP study of 576 patients. Support Care Cancer 2012, 20, 1479–1489. [Google Scholar] [CrossRef]
- Danwilai, K.; Konmun, J.; Sripanidkulchai, B.; Subongkot, S. Antioxidant activity of ginger extract as a daily supplement in cancer patients receiving adjuvant chemotherapy: A pilot study. Cancer Manag. Res. 2017, 9, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Ray, A.; Vasudevan, S.; Sengupta, S. 6-Shogaol Inhibits Breast Cancer Cells and Stem Cell-Like Spheroids by Modulation of Notch Signaling Pathway and Induction of Autophagic Cell Death. PLoS ONE 2015, 10, e0137614. [Google Scholar] [CrossRef]
- Ishiguro, K.; Ando, T.; Maeda, O.; Ohmiya, N.; Niwa, Y.; Kadomatsu, K.; Goto, H. Ginger ingredients reduce viability of gastric cancer cells via distinct mechanisms. Biochem. Biophys. Res. Commun. 2007, 362, 218–223. [Google Scholar] [CrossRef]
- Sreedhar, A.; Li, J.; Zhao, Y. Next-Gen Therapeutics for Skin Cancer: Nutraceuticals. Nutr. Cancer 2018, 70, 697–709. [Google Scholar] [CrossRef] [PubMed]
- Žitek, T.; Leitgeb, M.; Golle, A.; Dariš, B.; Knez, Ž.; Hrnčič, M.K. The Influence of Hemp Extract in Combination with Ginger on the Metabolic Activity of Metastatic Cells and Microorganisms. Molecules 2020, 25, 4992. [Google Scholar] [CrossRef] [PubMed]
- Wilson, B.J.; Saab, K.R.; Ma, J.; Schatton, T.; Pütz, P.; Zhan, Q.; Murphy, G.F.; Gasser, M.; Waaga-Gasser, A.M.; Frank, N.Y.; et al. ABCB5 maintains melanoma-initiating cells through a proinflammatory cytokine signaling circuit. Cancer Res. 2014, 74, 4196–4207. [Google Scholar] [CrossRef]
- Farha, M.A.; El-Halfawy, O.M.; Gale, R.T.; MacNair, C.R.; Carfrae, L.A.; Zhang, X.; Jentsch, N.G.; Magolan, J.; Brown, E.D. Uncovering the Hidden Antibiotic Potential of Cannabis. ACS Infect. Dis. 2020, 6, 338–346. [Google Scholar] [CrossRef]
- Van Klingeren, B.; Ten Ham, M. Antibacterial activity of delta9-tetrahydrocannabinol and cannabidiol. Antonie Van Leeuwenhoek 1976, 42, 9–12. [Google Scholar] [CrossRef]
- Turner, C.E.; Elsohly, M.A. Biological activity of cannabichromene, its homologs and isomers. J. Clin. Pharmacol. 1981, 21, 283s–291s. [Google Scholar] [CrossRef]
- Appendino, G.; Gibbons, S.; Giana, A.; Pagani, A.; Grassi, G.; Stavri, M.; Smith, E.; Rahman, M.M. Antibacterial cannabinoids from Cannabis sativa: A structure-activity study. J. Nat. Prod. 2008, 71, 1427–1430. [Google Scholar] [CrossRef]
- Martinenghi, L.D.; Jønsson, R.; Lund, T.; Jenssen, H. Isolation, Purification, and Antimicrobial Characterization of Cannabidiolic Acid and Cannabidiol from Cannabis sativa L. Biomolecules 2020, 10, 900. [Google Scholar] [CrossRef] [PubMed]
- Alexander, S.P. Therapeutic potential of cannabis-related drugs. Prog. Neuropsychopharmacol. Biol. Psychiatry 2016, 64, 157–166. [Google Scholar] [CrossRef] [PubMed]
- Guggisberg, J.; Schumacher, M.; Gilmore, G.; Zylla, D.M. Cannabis as an Anticancer Agent: A Review of Clinical Data and Assessment of Case Reports. Cannabis Cannabinoid Res. 2022, 7, 24–33. [Google Scholar] [CrossRef] [PubMed]
- Burch, R.; Mortuza, A.; Blumenthal, E.; Mustafa, A. Effects of cannabidiol (CBD) on the inhibition of melanoma cells in vitro. J. Immunoass. Immunochem. 2021, 42, 285–291. [Google Scholar] [CrossRef]
- Naderi, J.; Dana, N.; Javanmard, S.; Amooheidari, A.; Yahay, M.; Vaseghi, G. Effects of standardized Cannabis sativa extract and ionizing radiation in melanoma cells in vitro. J. Cancer Res. Ther. 2020, 16, 1495–1499. [Google Scholar] [CrossRef]
- ChoiPark, W.-H.-D.; Baek, S.-H.; Chu, J.-P.; Kang, M.-H.; Mi, Y.-J. Cannabidiol Induces Cytotoxicity and Cell Death via Apoptotic Pathway in Cancer Cell Lines. Biomol. Ther. 2008, 16, 87–94. [Google Scholar] [CrossRef]
- Rahmani, A.H.; Shabrmi, F.M.A.; Aly, S.M. Active ingredients of ginger as potential candidates in the prevention and treatment of diseases via modulation of biological activities. Int. J. Physiol. Pathophysiol. Pharmacol. 2014, 6, 125–136. [Google Scholar]
- Wang, X.; Shen, Y.; Thakur, K.; Han, J.; Zhang, J.G.; Hu, F.; Wei, Z.J. Antibacterial Activity and Mechanism of Ginger Essential Oil against Escherichia coli and Staphylococcus aureus. Molecules 2020, 25, 3955. [Google Scholar] [CrossRef]
- Broggi, G.; Musumeci, G.; Puzzo, L.; Russo, A.; Reibaldi, M.; Ragusa, M.; Longo, A.; Caltabiano, R. Immunohistochemical Expression of ABCB5 as a Potential Prognostic Factor in Uveal Melanoma. Appl. Sci. 2019, 9, 1316. [Google Scholar] [CrossRef]
- Wang, S.; Tang, L.; Lin, J.; Shen, Z.; Yao, Y.; Wang, W.; Tao, S.; Gu, C.; Ma, J.; Xie, Y.; et al. ABCB5 promotes melanoma metastasis through enhancing NF-κB p65 protein stability. Biochem. Biophys. Res. Commun. 2017, 492, 18–26. [Google Scholar] [CrossRef]
- Chartrain, M.; Riond, J.; Stennevin, A.; Vandenberghe, I.; Gomes, B.; Lamant, L.; Meyer, N.; Gairin, J.E.; Guilbaud, N.; Annereau, J.P. Melanoma Chemotherapy Leads to the Selection of ABCB5-Expressing Cells. PLoS ONE 2012, 7, e36762. [Google Scholar] [CrossRef] [PubMed]
- Bełkot, K.; Bubka, M.; Lityńska, A. Expression of Caveolin-1 in Human Cutaneous and Uveal Melanoma Cells. Folia Biol. 2016, 64, 145–151. [Google Scholar] [CrossRef]
- Senetta, R.; Stella, G.; Pozzi, E.; Sturli, N.; Massi, D.; Cassoni, P. Caveolin-1 as a promoter of tumour spreading: When, how, where and why. J. Cell. Mol. Med. 2013, 17, 325–336. [Google Scholar] [CrossRef] [PubMed]
- Trimmer, C.; Whitaker-Menezes, D.; Bonuccelli, G.; Milliman, J.N.; Daumer, K.M.; Aplin, A.E.; Pestell, R.G.; Sotgia, F.; Lisanti, M.P.; Capozza, F. CAV1 inhibits metastatic potential in melanomas through suppression of the integrin/Src/FAK signaling pathway. Cancer Res. 2010, 70, 7489–7499. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.N.; Queenan, M.; Brody, J.R.; Potoczek, M.; Sotgia, F.; Lisanti, M.P.; Witkiewicz, A.K. Loss of stromal caveolin-1 expression in malignant melanoma metastases predicts poor survival. Cell Cycle 2011, 10, 4250–4255. [Google Scholar] [CrossRef] [PubMed]
- Singh, C.K.; Panackal, J.E.; Siddiqui, S.; Ahmad, N.; Nihal, M. Combined Inhibition of Specific Sirtuins as a Potential Strategy to Inhibit Melanoma Growth. Front. Oncol. 2020, 10, 591972. [Google Scholar] [CrossRef]
- Knight, J.R.P.; Milner, J. SIRT1, metabolism and cancer. Curr. Opin. Oncol. 2012, 24, 68–75. [Google Scholar] [CrossRef]
- Carafa, V.; Nebbioso, A.; Altucci, L. Sirtuins and Disease: The Road Ahead. Front. Pharmacol. 2012, 3, 4. [Google Scholar] [CrossRef]
- Wilking, M.J.; Singh, C.; Nihal, M.; Zhong, W.; Ahmad, N. SIRT1 deacetylase is overexpressed in human melanoma and its small molecule inhibition imparts anti-proliferative response via p53 activation. Arch. Biochem. Biophys. 2014, 563, 94–100. [Google Scholar] [CrossRef]
- Liu, T.; Liu, P.Y.; Marshall, G.M. The Critical Role of the Class III Histone Deacetylase SIRT1 in Cancer. Cancer Res. 2009, 69, 1702. [Google Scholar] [CrossRef]
- Lehmann, F.S.; Burri, E.; Beglinger, C. The role and utility of faecal markers in inflammatory bowel disease. Therap. Adv. Gastroenterol. 2015, 8, 23–36. [Google Scholar] [CrossRef] [PubMed]
- Hibino, T.; Sakaguchi, M.; Miyamoto, S.; Yamamoto, M.; Motoyama, A.; Hosoi, J.; Shimokata, T.; Ito, T.; Tsuboi, R.; Huh, N.H. S100A9 is a novel ligand of EMMPRIN that promotes melanoma metastasis. Cancer Res. 2013, 73, 172–183. [Google Scholar] [CrossRef] [PubMed]
- Nigam, N.; George, J.; Srivastava, S.; Roy, P.; Bhui, K.; Singh, M.; Shukla, Y. Induction of apoptosis by [6]-gingerol associated with the modulation of p53 and involvement of mitochondrial signaling pathway in B[a]P-induced mouse skin tumorigenesis. Cancer Chemother. Pharmacol. 2010, 65, 687–696. [Google Scholar] [CrossRef]
- Qi, L.-W.; Zhang, Z.; Zhang, C.-F.; Anderson, S.; Liu, Q.; Yuan, C.-S.; Wang, C.-Z. Anti-colon cancer effects of 6-shogaol through G2/M cell cycle arrest by p53/p21-cdc2/cdc25A crosstalk. Am. J. Chin. Med. 2015, 43, 743–756. [Google Scholar] [CrossRef] [PubMed]
- Atalay, S.; Gęgotek, A.; Wroński, A.; Domigues, P.; Skrzydlewska, E. Therapeutic application of cannabidiol on UVA and UVB irradiated rat skin. A proteomic study. J. Pharm. Biomed. Anal. 2021, 192, 113656. [Google Scholar] [CrossRef]
- Seltzer, E.S.; Watters, A.K.; MacKenzie, D.; Granat, L.M.; Zhang, D. Cannabidiol (CBD) as a Promising Anti-Cancer Drug. Cancers 2020, 12, 3203. [Google Scholar] [CrossRef]
- Tomko, A.M.; Whynot, E.G.; Ellis, L.D.; Dupré, D.J. Anti-Cancer Potential of Cannabinoids, Terpenes, and Flavonoids Present in Cannabis. Cancers 2020, 12, 1985. [Google Scholar] [CrossRef] [PubMed]
- Emhemmed, F.; Zhao, M.; Yorulmaz, S.; Steyer, D.; Leitao, C.; Alignan, M.; Cerny, M.; Paillard, A.; Delacourt, F.M.; Julien-David, D.; et al. Cannabis sativa Extract Induces Apoptosis in Human Pancreatic 3D Cancer Models: Importance of Major Antioxidant Molecules Present Therein. Molecules 2022, 27, 1214. [Google Scholar] [CrossRef]
- Žitek, T.; Kotnik, P.; Makoter, T.; Postružnik, V.; Knez, Ž.; Marevci, M.K. Optimisation of the Green Process of Industrial Hemp-Preparation and Its Extract Characterisation. Plants 2022, 11, 1749. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- NCBI. Nucleotide. Available online: https://www.ncbi.nlm.nih.gov/nuccore/ (accessed on 24 May 2022).
- Team, R.C. R: A Language and Environment for Statistical Computing. Available online: https://www.R-project.org/ (accessed on 22 November 2021).
Cannabinoid | CBC | CBD | CBDA | CBGA | CBN | THC | THCA |
---|---|---|---|---|---|---|---|
[mg/g] | 9.50 ± 0.42 | 587.17 ± 8.32 | 37.90 ± 0.40 | 11.12 ± 0.03 | 1.54 ± 0.01 | 14.73 ± 0.40 | ND |
Component | 6-Gingerol | 6-Shogaol | 8-Gingerol | 8-Shogaol | 10-Gingerol | 10-Shogaol |
---|---|---|---|---|---|---|
[mg/g] | 60.07 ± 0.40 | 27.88 ± 0.08 | 10.48 ± 0.04 | 2.98 ± 0.01 | 7.66 ± 0.02 | 4.89 ± 0.01 |
c [µg/mL] | 30.00 | 10.00 | 5.00 | 3.00 | 2.00 | 1.00 | 0.70 | 0.30 | 0.01 |
---|---|---|---|---|---|---|---|---|---|
10.00 | 0.463 | ||||||||
5.00 | 0.472 | 0.491 | |||||||
3.00 | 0.289 | 0.258 | 0.266 | ||||||
2.00 | 0.243 | 0.215 | 0.222 | 0.445 | |||||
1.00 | 0.159 | 0.138 | 0.143 | 0.330 | 0.382 | ||||
0.70 | 0.133 | 0.154 | 0.148 | 0.047 | 0.035 | 0.017 | |||
0.30 | 0.063 | 0.075 | 0.072 | 0.018 | 0.013 | 0.006 | 0.338 | ||
0.01 | 0.026 | 0.032 | 0.030 | 0.006 | 0.004 | 0.002 | 0.202 | 0.338 | |
CON | 0.009 | 0.012 | 0.011 | 0.002 | 0.001 | 0.000 | 0.105 | 0.202 | 0.338 |
Gene | Accession Number | Forward (F) and Reverse (R) Primers | Amplicon Length [bp] |
---|---|---|---|
ABCB5 | NM_001163993.3 | F: TTGAAACCTTCGCAATAGCC | 224 |
R: GACCAAGGCGACTGTCTCT | |||
CAV1 | NM_001753.5 | F: GCAACTCGCTTTAGGTCAGC | 201 |
R: TCAGCCCTATTGGTCCACTT | |||
SIRT1 | NM_012238.5 | F: TGGAACAGGTTGCGGGAATC | 106 |
R: CCTCGTACAGCTTCACAGTCA | |||
S100A9 | NM_002965.4 | F: CATGGAGGACCTGGACACAAA | 171 |
R: CCACTGTGGTCTTAGGGGGT | |||
B2M | NM_004048.2 | F: TTCTGGCCTGGAGGCTATC | 86 |
R: TCAGGAAATTTGACTTTCCATTC | |||
GAPDH | NM_002046.7 | F: GAAGGTGAAGGTCGGAGTC | 226 |
R: GAAGATGGTGATGGGATTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Žitek, T.; Bjelić, D.; Kotnik, P.; Golle, A.; Jurgec, S.; Potočnik, U.; Knez, Ž.; Finšgar, M.; Krajnc, I.; Krajnc, I.; et al. Natural Hemp-Ginger Extract and Its Biological and Therapeutic Efficacy. Molecules 2022, 27, 7694. https://doi.org/10.3390/molecules27227694
Žitek T, Bjelić D, Kotnik P, Golle A, Jurgec S, Potočnik U, Knez Ž, Finšgar M, Krajnc I, Krajnc I, et al. Natural Hemp-Ginger Extract and Its Biological and Therapeutic Efficacy. Molecules. 2022; 27(22):7694. https://doi.org/10.3390/molecules27227694
Chicago/Turabian StyleŽitek, Taja, Dragana Bjelić, Petra Kotnik, Andrej Golle, Staša Jurgec, Uroš Potočnik, Željko Knez, Matjaž Finšgar, Ivan Krajnc, Igor Krajnc, and et al. 2022. "Natural Hemp-Ginger Extract and Its Biological and Therapeutic Efficacy" Molecules 27, no. 22: 7694. https://doi.org/10.3390/molecules27227694
APA StyleŽitek, T., Bjelić, D., Kotnik, P., Golle, A., Jurgec, S., Potočnik, U., Knez, Ž., Finšgar, M., Krajnc, I., Krajnc, I., & Marevci, M. K. (2022). Natural Hemp-Ginger Extract and Its Biological and Therapeutic Efficacy. Molecules, 27(22), 7694. https://doi.org/10.3390/molecules27227694