Next Article in Journal
Recent Updates on the Functional Impact of Kahweol and Cafestol on Cancer
Next Article in Special Issue
In Vitro and In Silico Pharmacological and Cosmeceutical Potential of Ten Essential Oils from Aromatic Medicinal Plants from the Mascarene Islands
Previous Article in Journal
Homology Modeling and Molecular Dynamics-Driven Search for Natural Inhibitors That Universally Target Receptor-Binding Domain of Spike Glycoprotein in SARS-CoV-2 Variants
Previous Article in Special Issue
Variations in the Chemical Composition of Essential Oils in Native Populations of Korean Thyme, Thymus quinquecostatus Celak.
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Essential Oil Chemotypes and Genetic Variability of Cinnamomum verum Leaf Samples Commercialized and Cultivated in the Amazon

by
Júlia Karla A. M. Xavier
1,
Talissa Gabriele C. Baia
2,
Oscar Victor C. Alegria
3,
Pablo Luis B. Figueiredo
4,
Adriana R. Carneiro
3,
Edith Cibelle de O. Moreira
5,
José Guilherme S. Maia
1,6,
William N. Setzer
7 and
Joyce Kelly R. da Silva
1,7,*
1
Programa de Pós-Graduação em Química, Universidade Federal do Pará, Belém 66075-900, Brazil
2
Programa Institucional de Bolsas de Iniciação Científica, Universidade Federal do Pará, Belém 66075-900, Brazil
3
Centro de Genômica e Biologia de Sistemas, Universidade Federal do Pará, Belém 66075-900, Brazil
4
Departamento de Ciências Naturais, Centro de Ciências Sociais e Educação, Universidade do Estado do Pará, Belém 66050-540, Brazil
5
Instituto de Estudos em Saúde e Biológicas, Universidade Federal do Sul e Sudeste do Pará, Marabá 68501-970, Brazil
6
Programa de Pós-Graduação em Química, Universidade Federal do Maranhão, São Luís 65080-805, Brazil
7
Aromatic Plant Research Center, 230 N 1200 E, Suite 100, Lehi, UT 84043, USA
*
Author to whom correspondence should be addressed.
Molecules 2022, 27(21), 7337; https://doi.org/10.3390/molecules27217337
Submission received: 31 July 2022 / Revised: 13 September 2022 / Accepted: 14 September 2022 / Published: 28 October 2022
(This article belongs to the Special Issue Chemical Composition and Bioactivities of Essential Oils)

Abstract

Cinnamomum verum (Lauraceae), also known as “true cinnamon” or “Ceylon cinnamon” has been widely used in traditional folk medicine and cuisine for a long time. The systematics of C. verum presents some difficulties due to genetic variation and morphological similarity between other Cinnamomum species. The present work aimed to find chemical and molecular markers of C. verum samples from the Amazon region of Brazil. The leaf EOs and the genetic material (DNA) were extracted from samples cultivated and commercial samples. The chemical composition of the essential oils from samples of C. verum cultivated (Cve1-Cve5) and commercial (Cve6-c-Cv9-c) was grouped by multivariate statistical analysis of Principal Component Analysis (PCA). The major compounds were rich in benzenoids and phenylpropanoids, such as eugenol (0.7–91.0%), benzyl benzoate (0.28–76.51%), (E)-cinnamyl acetate (0.36–32.1%), and (E)-cinnamaldehyde (1.0–19.73%). DNA barcodes were developed for phylogenetic analysis using the chloroplastic regions of the matK and rbcL genes, and psbA-trnH intergenic spacer. The psbA-trnH sequences provided greater diversity of nucleotides, and matK confirmed the identity of C. verum. The combination of DNA barcode and volatile profile was found to be an important tool for the discrimination of C. verum varieties and to examine the authenticity of industrial sources.

Graphical Abstract

1. Introduction

The Cinnamomum Schaeff genus belongs to the Lauraceae family and comprises 336 evergreen aromatic trees and shrubs distributed in Asia, Australia, and the Pacific Islands [1,2,3]. Many of these species have high economic importance and are used as an ingredient in several food products to provide flavor and aroma [4,5].
Cinnamomum verum J. Presl. (syn: C. zeylanicum Blume), also known as “true cinnamon” or “Ceylon cinnamon”, is native to Sri Lanka and southern India but also distributed in Southeast Asia, China, Burma, Indonesia, Madagascar, the Caribbean, Australia, and Africa [6]. Sri Lanka stands out for the most significant production of C. verum globally, corresponding to approximately 70% of the global production [7].
For a long time, C. verum had been widely used as a spice in traditional folk medicine and culinary practices [8]. This species has received more attention in the last decades due to increasing scientific evidence on its potential medicinal and therapeutic value [9]. Among the most relevant biological activities are anticancer [9], antidiabetic [10,11], antioxidant, anticholinergic [12], anti-inflammatory [13], anti-human immunodeficiency virus (HIV) [14], antimicrobial [15], and cytotoxic activities [16].
Such properties are attributed to unique secondary metabolic profiles of C. verum, including cinnamaldehyde, eugenol, cinnamyl acetate, methyl cinnamate, (E)-caryophyllene, and linalool [8,17,18]. Coumarin, a hepatotoxic and carcinogenic compound, is present in low concentrations in C. verum, and is precisely what chemically distinguishes it from other Cinnamomum species, such as C. burmannii, C. loureiroi, and C. cassia (syn. C. aromaticum) [13,19]. These species, known as “false cinnamon” or “cassia cinnamon” can be considered “inferior” to C. verum in several aspects, including their biochemical composition [5].
Systematics of Cinnamomum species primarily depend on morphological character analysis, which is often difficult due to its vast diversity, genetic variation, morphological similarity between species, and strict seasonality in flowering and fruiting [20]. In addition to morphology, chemotaxonomy is a supportive tool for systematics, and the volatile chemical profile, in particular, has been utilized in complex plant groups, such as Lauraceae [21,22,23].
Most medicinal plants used in the raw herbal trade are often marketed as dry twigs, powder, or billets and thus are usually difficult to identify morphologically [24]. Therefore, more scientific and accurate identification methods are required. Chromatographic fingerprinting provides an entire profile of the global components of herbal medicines and is considered to be an important method for evaluating the quality of herbal medicines [25].
There has been tremendous progress with molecular markers known as DNA barcodes in the last ten years. Currently, DNA barcodes can be combined with other technologies, such as molecular, chromatographic, and spectrum technologies, to obtain more satisfactory identification results [26]. Barcode sequences have been used to detect adulteration of cinnamon and identify high-quality species for potential cultivation purposes [27]. This study reports the integrated use of gas chromatography-mass spectrometry (GC-MS) chemotaxonomy and universal barcoding regions (rbcL, matK, and psbA-trnH) to assess their combined and separate identification capabilities.

2. Results and Discussion

2.1. Chemical Composition and Multivariate Analysis

The yields and volatile compositions of the C. verum oils of cultivated and commercial samples are displayed in Table 1.
In general, phenylpropanoids (9.25–96.14%) and benzenoid compounds (0.53–78.71%) predominated in the cinnamon oils analyzed, followed by oxygenated sesquiterpenes (0.22–14.07%), sesquiterpene hydrocarbons (1.89–8.98%), and monoterpene hydrocarbons (0.63–8.08%), with minor amounts. The main constituents were eugenol (0.7–91.0%), benzyl benzoate (0.28–76.51%), (E)-cinnamyl acetate (0.36–32.1%), and (E)-cinnamaldehyde (1.0–19.73%). Caryophyllene oxide (0–7.54%), spathulenol (0.05–3.95%), eugenyl acetate (0–3.78%), linalool (0–3.69%), and bicyclogermacrene (0–3.25%) also were identified in minor concentrations (Table 1).
The multivariate analyses of PCA (Principal Component Analysis) were applied to the constituents present in oils above 3% to evaluate the chemical variety among cultivated (Cve1-Cve5) and commercial (Cve6-c-Cv9-c) samples of C. verum (see Figure 1). The PCA of the constituents of oil samples explained 89.83% of the data variance and showed four main groups PC1, PC2 and PC3. PC1 accounted 42.21 % and showed a positive correlation observed for samples rich in benzyl benzoate (0.33313), (E)-cinnamaldehyde (0.29201), (E)-cinnamyl acetate (0.40693), spathulenol (0.38234), caryophyllene oxide (0.30473), linalool (0.03381), and a negative correlation with eugenol (−0.50031) and eugenol acetate (−0.38427). On the other hand, the PC2 component explained 26.43 % of the chemical variability, presenting a positive correlation with eugenol (0.1918), eugenol acetate (0.21607), (E)-cinnamyl acetate (0.06106), spathulenol (0.43412), and caryophyllene oxide (0.47984), and a negative correlation with linalool (−0.61597), (E)-cinnamaldehyde (−0.10138), and benzyl benzoate (−0.3231). Finally, the third component PC3 explained 21.19% and displayed positive correlations with the variables (E)-cinnamaldehyde (0.62778), eugenol (0.7923), (E)-cinnamyl acetate (0.48448), and eugenol acetate (0.03431) and negative with linalool (−0.20501), spathulenol (−0.22885), caryophyllene oxide (−0.31166), and benzyl benzoate (0.41495). Group I, composed of CVe2 and CVe7-c, comprised samples rich in benzyl benzoate (76.51% and 68.16%). The Cve4, Cve5, Cve6-c, and Cve9-c samples, Group II, showed a high concentration of eugenol (54.51–91.0%) followed by benzyl benzoate (0.28–22.96%). Group III, which included the Cve3 sample, was characterized by benzyl benzoate (44.14%), (E)-cinnamyl acetate (14.94%), caryophyllene oxide (7.54%), and spathulenol (3.95%). Cve1 and Cve8-c oils, Group IV, showed similar concentrations for (E)-cinnamyl acetate (32.11%, 26.15%, respectively), benzyl benzoate (15.83%, 47.68%), and (E)-cinnamaldehyde (19.74%, 10.82%).
Existing oil content variations can be attributed to genetic and environmental factors, including ecotype, chemotype, phenophases, and the environment [18,28]. The chemical diversity of C. verum has been reported in several studies, revealing the existence of four chemotypes, eugenol, eugenol and safrole, benzyl benzoate, and linalool-rich oils [18,29,30,31].
The highest oil content (1.9–2.5%) was observed for the samples (Cve4, Cve5, and Cve9-c) that presented the chemotype eugenol (>85%). The leaves of two varieties of C. verum chemotype-eugenol, collected in Sri Lanka, showed yields ranging from 2% to 3.90% [32,33]. The leaves of a 2-year-old C. verum, collected in China, with a high percentage of eugenol (>90%), presented a yield of 5.81% [34]. However, two specimens collected in the Amazon biome of chemotype eugenol (2.2%) and chemotype benzyl benzoate (2.4%) did not show significant differences between yields [18].
Therefore, one should consider that these chemotypes may result from the plant genotype, considering the season, the weather, and the collection site [35]. Eugenol is the most common chemotype identified in C. verum leaves [18,33,36]. In Sri Lanka, Malaysia, Cameroon, and India, the eugenol concentrations of the leaves of C. verum are around 80–90% [32,33,37,38,39]. On the other hand, more significant variations in eugenol content (64.20–95.0%) are observed in the specimens of C. verum collected in Brazil [18,30,40,41]. The samples collected in Brazil in the cities of Belém (PA), Manaus (AM), and São Luis (MA) showed predominance in eugenol (60.0–93.6%) and (E)-caryophyllene (1.4–8.3%). In the International Organization for Standardization (ISO) list [42], the profile of the oil of C. verum leaf growing mainly in Sri Lank is composed of eugenol (70–83%), benzyl benzoate (2–4.0%) and eugenyl acetate (1.3–3.0%).
(E)-Cinnamaldehyde and cinnamyl acetate were also significant constituents in the leaves and flowers of C. verum from Benin and India, respectively [43,44], and in other Cinnamomum species, such as C. osmophloeum from Taiwan [45]. In addition, these compounds are common to major constituents of C. verum bark oil [46,47].
Chemotypes rich in benzyl benzoate have also been reported [18,35,48]. The compositions of the leaf oil of two C. verum specimens from Santa Inês (MA, Brazil) revealed the existence of two chemotypes. Type I leaf oil was rich in benzyl benzoate (95.3%), linalool (1.4%), and eugenol (0.8%), whereas type II showed benzyl benzoate (65.4%), followed by linalool (5.4%), (E)-cinnamaldehyde (4.0%), α-pinene (3.9%), β-phellandrene (3.4%), and eugenol (3.4%) [18,35]. Benzyl benzoate (65.42%), linalool (10.81%), and (E)-caryophyllene (6.92%) were the major compounds of C. verum specimens from India [48].
The concentration of linalool in our study varied from 2.66% to 3.69%. However, the higher the concentration of this compound, the greater the flavor and fragrance, making the oil more commercially valuable [49]. The leaves of a specimen collected in Manaus (AM, Brazil) presented a linalool content of 7.0% [41]. The presence of caryophyllene oxide in the CVe3 sample collected in Belém (PA) may indicate the process of plant maturation, since (E)-caryophyllene may oxidize into caryophyllene oxide [29].
Cinnamon is a natural component showing a wide range of pharmacological functions; among the biological properties assigned to the majority of compounds, we can cite the chemotypes rich in eugenol and benzyl benzoate, which have antifungal and antioxidant potential [18]. C. verum oil, especially rich in cinnamaldehyde, can act in synergism with antibiotics commercial to increase antimicrobial potential [15]. The cinnamaldehyde compound and its derivatives act as a high anti-carcinogenic agent [9]. Finally, antidiabetic, antioxidant, and antimicrobial activities were reported for (E)-cinnamyl acetate [44].
Table 1. Volatile compositions of Cinnamomum verum leaf essential oils.
Table 1. Volatile compositions of Cinnamomum verum leaf essential oils.
Oil Yield (%) 0.541.671.301.902.500.700.500.802.50
Constituent (%)IR(L)IR(C)CVe1CVe2CVe3CVe4CVe5CVe6-cCVe7-cCVe8-cCVe9-c
Ethylbenzene857 1859 0.01
Styrene891 18910.070.010.020.04 0.010.010.01
Tricyclene921 29220.02 0.01 0.010.01
α-Thujene924 29250.060.020.01 0.060.060.03
α-Pinene932 29332.891.181.520.230.121.691.510.330.23
Camphene946 29471.450.61.030.110.070.840.820.120.13
6-Methylheptan-2-ol958 2950 0.14
Benzaldehyde952 29572.360.512.130.110.150.450.80.440.26
Sabinene969 29720.040.020.01 0.030.080.050.010.02
β-Pinene974 29761.360.590.870.10.10.760.850.150.15
Myrcene988 29890.280.170.070.010.020.220.30.060.02
Mesitylene994 2993 0.01
n-Decane1000 2998 0.01 0.020.02 0.01
α-Phellandrene1004 210040.480.250.030.070.030.170.740.57
δ-3-Carene1008 210100.04 0.03 0.010.030.03
α-Terpinene1014 210160.020.04 0.030.30.150.010.03
p-Cymene1020 210230.340.10.530.040.060.110.280.260.02
β-Phellandrene1025 21027 0.291.45 0.32
Limonene1024 210270.960.660.590.07 1.340.18
1,8-Cineole1026 21030 0.01
Benzyl alcohol1026 210311.060.820.71 0.060.630.670.260.03
(Z)-β-Ocimene1032 210350.010.1 0.040.05
Butyl 2-methylbutyrate1042 11038 0.02
Salicylaldehyde1039 210400.03 0.03
(E)-β-Ocimene1044 210450.02 0.07 0.130.890.01
γ-Terpinene1054 210560.02 0.050.040.01
Acetophenone1059 21063 0.04
cis-Linalool oxide (furanoid)1067 210700.01 0.02 0.01
trans-Linalool oxide (furanoid)1084 21087 0.04
Terpinolene1086 210870.090.08 0.090.120.06
Methyl benzoate1088 210940.01 0.02
Linalool1095 210991.973.660.05 0.543.133.690.862.26
2-Methylbutyl 2-methylbutyrate1100 211030.04 0.03 0.02 0.090.020.02
α-Campholenal1122 21124 0.09
(trans)-p-Menth-2-en-1ol1136 21137 0.010.01
(trans)-Pinocarveol1135 21137 0.16
Camphor1141 211430.030.030.04 0.010.04
Pinocarvone1160 21161 0.36
Hydrocinnamaldehyde1599 211601.40.16 0.010.180.080.20.45
Benzyl acetate1157 211620.720.12 0.030.750.040.10.04
Borneol1165 211640.260.140.22 0.030.110.160.010.05
Pyruvophenone1169 11165 0.14
Ethyl benzoate1169 211690.110.060.04 0.050.040.03
Terpinen-4-ol1174 211760.10.090.09 0.050.10.140.040.04
Naphthalene1178 21181 0.04
p-Cymen-8-ol1179 21183 0.02
α-Terpineol1186 211890.340.320.30.030.050.180.430.150.11
(4Z)-Decenal1193 211920.08 0.01
Myrtenol1194 211950.03 0.12
Methyl chavicol1195 21197 0.01
(Z)-Cinnamaldehyde1217 212170.17 0.030.06
Hydrocinnamyl alcohol1124 212280.13 0.22 0.02 0.05
Chavicol1247 21253 0.030.110.05 0.06
2-Phenylethyl acetate1254 21255 0.05 0.03
(E)-Cinnamaldehyde1267 2127419.742.43.5113.033.043.7610.824.86
(E)-Cinnamyl alcohol1303 213030.25 1.27 0.04
Isobutyl benzoate1327 213270.01 0.04 0.01
δ-Elemene1335 213370.07 0.040.190.06
α-Cubebene1345 213490.09 0.04 0.04
Eugenol1356 213561.072.130.79190.1554.511.321.6985.68
Hydrocinnamyl acetate1366 213702.910.291.30.030.130.140.261.260.1
Butyl benzoate1376 113710.05 0.06 0.040.02
α-Copaene1374 213762.240.232.90.390.240.091.320.580.36
Geranyl acetate1379 213820.05
β-Bourbonene1387 21384 0.07
(Z)-Cinnamyl acetate1388 21387 0.53
β-Cubebene1387 213900.06 0.050.02
β-Elemene1389 213920.14 0.020.140.05
Methyl eugenol1403 21403 0.18 0.060.13
cis-α-Bergamotene1411 21414 0.05
(E)-Caryophyllene1417 214202.751.530.571.551.022.682.721.451.96
2-Methylbutyl benzoate1438 214360.01 0.03 0.050.03
Aromadendrene1439 214380.05 0.02 0.040.110.010.03
(E)-Cinnamyl acetate1443 2145232.14.4314.940.330.140.821.226.150.36
α-Humulene1452 214540.70.320.090.280.210.520.680.330.38
9-epi-(E)-Caryophyllene1464 214600.05 0.03 0.04
Cadina-1(6),4-diene1475 214740.05 0.02 0.02
γ-Muurolene1478 214770.03 0.05 0.040.020.090.020.05
Germacrene D1484 214810.08 0.120.07 0.830.07
2-Phenylethyl 2-methylbutanoate1486 21485 0.11 0.02
(E)-Muurola-4(14),5-diene1493 214920.05 0.03
β-Selinene1489 21494 0.09
Viridiflorene1496 21494 0.09 0.14
Bicyclogermacrene1500 214971.40.73 0.14 0.763.251.35
α-Muurolene1500 215000.030.020.06 0.020.030.020.02
β-Bisabolene1505 21508 0.04
γ-Cadinene1513 21514 0.080.15 0.040.020.020.060.07
Cubebol1514 215150.04
δ-Cadinene1522 215230.330.290.530.040.130.10.250.190.23
Eugenol acetate1521 21526 3.780.261.48 0.19
(E)-o-Methoxycinnamaldehyde1527 215270.03 0.03
(E)-Cadina-1,4-diene1533 215320.03
α-Cadinene1537 21537 0.02
α-Calacorene1544 21542 0.03
Caryolan-8-ol1571 21569 0.02
Spathulenol1577 215770.810.153.950.050.060.190.640.80.07
Caryophyllene oxide1582 215820.610.317.540.170.560.410.670.520.53
β-Copaen-4α-ol1590 21586 0.34
Viridiflorol1592 215910.03 0.020.130.03
Cubeban-11-ol1595 21593 0.03
Rosifoliol1600 21601 0.08
Humulene epoxide II1608 216080.1 0.83 0.060.030.060.060.05
1-epi-Cubenol1627 216270.06 0.17 0.040.02
Caryophylla-4(12),8(13)-dien-5-α-ol1639 21631 0.05
Caryophylla-4(12),8(13)-dien-5-β-ol1639 216350.02 0.43 0.020.08
α-Muurolol (=Torreyol)1644 21640 0.14
epi-α-Murrolol (=τ-muurolol)1640 21640 0.08
epi-α-Cadinol (=τ-cadinol)1638 21640 0.2 0.04 0.06
Cubenol1645 216420.06 0.07
α-Cadinol1652 216540.030.12 0.030.040.030.070.07
14-Hydroxy-9-epi-(E)-caryophyllene1668 21670 0.45
Mustakone1676 21676 0.07
Khusinol1675 21684 0.12
Amorpha-4,9-dien-2-ol1704 21698 0.04
Benzyl benzoate1759 2176915.8376.5144.110.291.2222.9668.1647.680.28
Phytone1841 11843 0.020.02
2-Phenylethyl benzoate1856 11852 0.372.43 0.030.230.11
Benzyl salicylate1864 21866 0.150.03 0.02
Phytol2110 12110 0.06
Monoterpene Hydrocarbons8.083.814.770.630.756.017.241.830.92
Oxygenated Monoterpenes2.794.241.450.040.673.564.471.062.51
Sesquiterpene Hydrocarbons8.153,24.742.421.894.388.984.973.31
Oxygenated Sesquiterpenes1.760.7214.070.220.710.731.791.640.8
Phenylpropanoids56.49.2521.9496.1493.8960.016.5740.1191.37
Benzenoids21.6678.7150.460.531.7525.0570.3249.130.67
Others0.12 0.2 0.180.030.130.10.03
Total Identifield98.9699.9397.6399.9899.8499.7799.598.8499.61
1 [50]; 2 [51]; RI(C): Calculated retention index; RI(L): Literature retention index; C. verum cultivated (Cve1–Cve5); C. verum commercials (Cve6-c–Cve9-c).

2.2. DNA Authentication and Genetic Variability of Cinnamomum verum Samples

A DNA barcode was incorporated to address the challenge of chemical plasticity, as the genetic makeup of a particular species should be more stable under various environmental conditions [52]. In plants, the establishment and refinement of DNA barcodes have been more challenging due to the distinct genetic diversity among different species [53].
PCR amplification and sequencing success are important factors for selecting ideal barcode loci [54,55]. The sequences of the matK, rbcL, and psbA-trnH regions were constructed for all studied samples, including five specimens of C. verum (Cve1, Cve2, Cve3, Cve4, Cve5) which had confirmed morphological identity, and four commercial samples (Cve6-c, Cve7-c, Cve8-c, Cve9-c). The PCR success rate was 100% for all the analyzed loci except matK, which did not show any amplification in two commercial samples (CVe7-c and CVe9-c). All PCR products were successfully sequenced, and high-quality bidirectional sequences were obtained.
The success of species identification depends on the quality of the barcode sequence and the taxonomic coverage of reference sequences in the GenBank database [56]. The sequence with the highest homology, maximum query coverage, and maximum score was used as a reference to assign the identity of the species. The herbal analysis of the market samples revealed that all of C. verum samples were authentic. Using authenticated raw materials is the basic starting point in developing safe and high-quality natural health products. The possibility of adulteration is high due to misidentification because the collectors do not have the taxonomic expertise to differentiate morphologically similar species [57].
In relation to the regions, homology searches using the NCBI Blast program found matched sequences with C. verum, resulting in species-level identification for the matK region. On the other hand, the psbA-trnH and rbcL sequences provided identification only at the genus level. Another important criterion of an ideal barcode is its discriminatory power [55,58].
The psbA-trnH sequences had the highest nucleotide diversity (π: 0.01449), polymorphic sites (20 bp), and parsimonious-informative characters (6 bp). The intergenic spacer is described as a DNA barcode rich in simple sequence repeats and small insertions and deletions (INDELs) [59,60]. In contrast, the sequences of matK and rbcL coding regions showed a phylogenetically conserved nature, with low nucleotide diversity (0.00000–0.000123), polymorphic sites (0 and 3 bp), and parsimonious-informative (0 bp) (Table 2). The alignment of the concatenated matrix (rbcL+matK+psbA-trnH) presented a total of 1699 bp of characters, of which 6 bp are considered informative, and 23 bp are polymorphic sites (Table 2).
A multi-locus approach of barcode regions was used to establish the DNA barcode signatures from commercialized and cultivated of C. verum samples in the Amazon. Interestingly, cultivated samples in different locations (Benevides, Belém, Curuçá and Maranhãozinho) showed great genetic similarities with commercial samples. The alignment of the concatenated matrix showed great genetic variability in the psbA-trnH intergenic region compared to matK and rbcL in samples obtained (Figure 2).
Due to the greater nucleotide diversity, we use the pbsA-trnH region to check the distances between sequences. The genetic distances were low, with a mean of 0.015 (Supplementary Materials: Table S1), indicating little genetic variability between specimens of C. verum. DNA barcodes have also been suggested to discriminate species and identify adulterants in Cinnamomum. For example, commercial samples of cinnamon were identified as adulterants in C. aromaticum and C. malabathrum using sequences of rbcL, matK, and psbA-trnH [27]. Nevertheless, these same regions used individually or in combination did not show sufficient genetic variation to discriminate C. capparu-coronde, C. citriodorum, C. litseifolium, C. sinharajaense, C. ovalifolium, and C. verum species in Sri Lanka [61].

2.3. Molecular and Chemical Methods

Most Cinnamomum plants are highly economically valuable tree species. However, Cinnamomum species share similar morphological features in their taxonomy. Thus, developing a rapid and feasible method for the identification of Cinnamomum plants is needed to prevent their adulteration of trees [62]. DNA barcodes can be incorporated to address the challenge of chemical plasticity, as the genetic makeup of a particular species should be more stable under various environmental conditions [52].
The DNA barcode can only authenticate the medicinal plant while the chemical profile provides information on the presence and concentration of compounds with pharmacological activity [63]. This diversity of compounds is generally determined by the genetic constitution of the plant, although environmental factors may also influence the type, amount, and concentrations of the compounds present in the essential oil [64].
Chemical compounds commonly occur similarly in members of the same phylogenetic clade, and their presence or absence may indicate the common origin and, therefore, lineage [65]. The differences/fluctuations in the composition of secondary metabolites could be due to genetic modifications linked to the adaptation of these plant species to their environment [66]. Our phylogenetic analysis study allowed specific taxonomic identifications up to the level of C. verum varieties.
The complementary use of chemical and molecular markers for quality control achievement of the C. verum species and other plant materials should be tested in commercialized leaves and in herbal preparations. The identification of adulterants, fillers and/or substitutes could be accomplished only if the molecular databases of medicinal plants are enriched with more studies [67,68].

3. Materials and Methods

3.1. Plant Material

Leaf samples of five cultivated Cinnamomum verum species were collected in Belém (PA, Brazil), Benevides (PA, Brazil), Curuçá (PA, Brazil), and Maranhãozinho (AM, Brazil). The plant vouchers were identified and cataloged in the Herbarium João Murça Pires, Emilio Goeldi Museum, Pará state, Brazil, as listed in Table 1. Four commercial samples of cinnamon leaves were purchased in local markets of companies in Belém (PA, Brazil) and labeled as Cve-6c to Cve9-c to check the authenticity of the commercialized product (Table 3).

3.2. Essential Oil Extraction

The leaves were dried for two days at room temperature and then subjected to essential oil distillation. The dry leaves were pulverized and submitted to hydrodistillation using a Clevenger-type apparatus (3 h). The oils were dried over anhydrous sodium sulfate, and the yields were calculated based on the dry weight of the plant material. The moisture content of each sample was measured using an infrared moisture balance ID50 with a heat source (Marte®, Santa Rita do Sapucaí, MG, Brazil). The moisture content of each sample was measured using an infrared moisture balance. The procedure was performed in triplicate.

3.3. GC-MS and GC(FID) Analysis

The oil samples were analyzed on a GCMS-QP2010 Ultra system (Shimadzu Corporation, Tokyo, Japan), equipped with an auto-injector (AOC-20i). The parameters of analysis were: A silica capillary column Rxi-5ms (30 m × 0.25 mm; 0.25 μm film thickness) (Restek Corporation, Bellefonte, PA, USA); injector temperature: 250 °C; oven temperature programming: 60–240 °C (3 °C/min); helium as carrier gas, adjusted to a linear velocity of 36.5 cm/s (1.0 mL/min); splitless mode injection of 1 μL of the sample (oil 5 μL:hexane 500 μL); ionization by electronic impact at 70 eV; ionization source and transfer line temperatures at 200 °C and 250 °C, respectively. The mass spectra were obtained by automatically scanning every 0.3 s, with mass fragments in the range of 35–400 m/z. The quantitative data regarding the volatile constituents were obtained by peak-area normalization using a GC 6890 Plus Series (Agilent, Wilmington, DE, USA), coupled to a flame ionization detector (FID), operated under similar GC-MS system conditions. The retention index was calculated for all volatile components using a homologous series of C8-C20 n-alkanes (Sigma-Aldrich, St. Louis, MO, USA), according to the linear equation of Van den Dool and Kratz [69]. The components of oils were identified by comparing their retention indices and mass spectra (molecular mass and fragmentation pattern) with data stored in the [28,29,70] libraries.

3.4. Multivariate Statistical Analysis of Chemical Composition

The chemical compositions of the leaf samples with a percentage above 3% were used as variables in multivariate analysis. First, the matrix’s data standardization was performed by subtracting the mean and dividing it by the standard deviation. The Principal Component Analysis was applied to verify the interrelation in the oil’s components (OriginPro trial version, OriginLab Corporation, Northampton, MA, USA).

3.5. DNA Isolation, PCR Amplification, and Sequencing

Genomic DNA material was extracted from 100 mg of dried leaf tissue of each plant using a plant DNA isolation Kit (PureLink™ Genomic DNA, Invitrogen, Carlsbad, CA, USA) according to the protocol given by the company and stored at −20 °C. Three chloroplast DNA regions were used for amplification: rbcL, matK, and the intergenic spacer psbA-trnH. The Consortium for the Barcode of Life’s (CBOL) plant working group recommended using a core of a two-locus combination of rbcL + matK as the plant barcode, with psbA-trnH as complementary sequences [55]. Polymerase chain reactions (PCR) were performed in a volume of 50 µL containing 35.0 μL of ultrapure water (Invitrogen, Carlsbad, CA, USA), 5 μL of 10x Advantage Buffer (200 mM Tris-HCl pH 8.4; 500 mM KCl, Invitrogen, Carlsbad, CA, USA), 1 μL of deoxynucleotide (dNTP) (10mM, Biotium, Fremont, CA, USA), 0.5 μL of Taq DNA polymerase (5 U/μL, Invitrogen, Carlsbad, CA, USA), 4.0 μL template DNA (at a concentration of approximately 20 ng/μL) and 1 µL of each primer, forward and reverse (10 mM), synthesized by the companies Síntese Biotecnologia (Belo Horizonte, Brazil). DNA amplifications were conducted in a thermocycler (GeneAmp PCR System 9700, Foster, CA, USA), and the negative control was carried out for all PCR reactions in the absence of DNA. Amplification products were visualized in agarose gel 1.5% and, subsequently, the amplicons were sent for purification, quantification and sequencing at the company ACTgene Análises Moleculares Ltd. (Alvorada, Brazil). Table 4 presents the sequences of the primers of each fragment and its PCR amplification conditions.

3.6. Sequence Identity and Distance Genetics Analysis

The forward and reverse sequences of each amplified region (matK, rbcL, and psbA-trnH) were edited and aligned using the software MUSCLE algorithm [75] implemented within MEGA 7 software [76]. Sequences were compared with available sequences in the National Center for Biotechnology Information (NCBI) GenBank database (http://www.ncbi.nlm.nih.gov/, accessed in 1 June 2022), using the tool Blast N. DNA sequences generated in this study were deposited in the NCBI GenBank, and accession numbers are listed in the Supporting Information (Table 5).
The sequences of rbcL, matK, and psbA-trnH were analyzed in DnaSP v6 [77] to obtain the median length described the genetic variability of each marker (bp) and total alignment length (bp), both discounting gaps, the number of sites with gaps, and nucleotide diversity (π). The sequencer was concatenated using the program Phylosuite [78] and aligned with the CLUSTAL W [79] in Mega software. The alignment was edited in BIOEDIT program [80]. The pbsA-trnH region was used to estimate the pairwise distance using the Kimura two-parameter (K2P) model [81].

4. Conclusions

We developed a pioneering study by integrating the volatile profile and molecular sequences for rapid authentication and discrimination of C. verum samples in this study. The essential oils of the samples with occurrence in the Amazon were rich in benzenoids and phenylpropanoids. The wide array of volatile chemical structures identified in the samples and their distribution pattern was utilized to differentiate chemotypes, such as (E)-cinnamyl acetate, benzyl benzoate, (E)-cinnamaldehyde, caryophyllene oxide, spathulenol, linalool, and eugenol. The species identity has been confirmed using barcode sequences, which is crucial for commercial samples with morphological data limitations.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules27217337/s1, Table S1. Pairwise analysis of the psbA-trnH region using Kimura two-parameter method.

Author Contributions

J.K.A.M.X. and T.G.C.B. conducted the experiments; O.V.C.A., E.C.d.O.M. and A.R.C. contributed to the phylogenetic analyses; J.K.A.M.X., P.L.B.F., E.C.d.O.M. and J.K.R.d.S. performed organization of the database, statistical analysis, and manuscript writing; J.G.S.M., W.N.S., J.K.R.d.S. and J.K.A.M.X. provided extensive manuscript editing and review. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Aromatic Plant Research Center (APRC, https://aromaticplant.org/, accessed on 16 April 2022).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Publicly available gene sequence datasets were analyzed in this study. These data can be found here: https://www.ncbi.nlm.nih.gov/genbank/; accession numbers: C. verum (OM981169, OM981164, OM981159, OM981170, OM981165, OM981160, OM981171, OM981166, OM981161, OM981172, OM981167, OM981162, OM981173, OM981168, OM981163).

Acknowledgments

In this section, you can acknowledge any support given which is not covered by the author contribution or funding sections. This may include administrative and technical support, or donations in kind (e.g., materials used for experiments).

Conflicts of Interest

The authors declare no conflict of interest.

Sample Availability

Samples of this work are available from the authors.

References

  1. Bandusekara, B.S.; Pushpakumara, D.K.N.G.; Bandaranayake, P.C.G.; Wijesinghe, K.G.G.; Jayasinghe, G.G. Field Level Identification of Cinnamomum Species in Sri Lanka Using a Morphological Index. Trop. Agric. Res. 2020, 31, 43–53. [Google Scholar] [CrossRef] [Scilit]
  2. WFO. World Flora Online. 2022. Available online: http://www.worldfloraonline.org (accessed on 15 April 2022).
  3. Rani, A.; Pande, C.; Tewari, G.; Patni, K. A review on aroma profile of cinnamomum species in north and north east India. World J. Pharm. Res. 2017, 6, 200–221. [Google Scholar] [CrossRef] [Scilit]
  4. Lopes, J.D.S.; de Lima, A.B.S.; da Cruz Cangussu, R.R.; da Silva, M.V.; Ferrão, S.P.B.; Santos, L.S. Application of spectroscopic techniques and chemometric methods to differentiate between true cinnamon and false cinnamon. Food Chem. 2022, 368, 130746. [Google Scholar] [CrossRef] [Scilit]
  5. Suriyagoda, L.; Mohotti, A.J.; Vidanarachchi, J.K.; Kodithuwakku, S.P.; Chathurika, M.; Bandaranayake, P.C.; Hetherington, A.M.; Beneragama, C.K. “Ceylon cinnamon”: Much more than just a spice. Plants People Planet 2021, 3, 319–336. [Google Scholar] [CrossRef] [Scilit]
  6. Abeysekera, W.P.K.M.; Premakumara, G.A.S.; Ratnasooriya, W.D. In vitro antioxidant properties of leaf and bark extracts of ceylon cinnamon (Cinnamomum zeylanicum Blume). Trop. Agric. Res. 2013, 24, 128–138. [Google Scholar]
  7. Ministry of Development Strategies and International Trade (MDSIT) and Sri Lanka Export Development Board (SLEDB). Government of Sri Lanka National Export Strategy of Sri Lanka—Spices and Concentrates Strategy. 13–14; Government of Sri Lanka: Sri Lanka, 2018. Available online: www.sputnix.es (accessed on 14 February 2022).
  8. Singh, N.; Rao, A.S.; Nandal, A.; Kumar, S.; Yadav, S.S.; Ganaie, S.A.; Narasimhan, B. Phytochemical and pharmacological review of Cinnamomum verum J. Presl-a versatile spice used in food and nutrition. Food Chem. 2021, 338, 127773. [Google Scholar] [CrossRef] [Scilit]
  9. Sadeghi, S.; Davoodvandi, A.; Pourhanifeh, M.H.; Sharifi, N.; ArefNezhad, R.; Sahebnasagh, R.; Moghadam, S.A.; Sahebkar, A.; Mirzaei, H. Anti-cancer effects of cinnamon: Insights into its apoptosis effects. Eur. J. Med. Chem. 2019, 178, 131–140. [Google Scholar] [CrossRef] [Scilit]
  10. Zare, R.; Nadjarzadeh, A.; Zarshenas, M.M.; Shams, M.; Heydari, M. Efficacy of cinnamon in patients with type II diabetes mellitus: A randomized controlled clinical trial. Clin. Nutr. 2019, 38, 549–556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Ranasinghe, P.; Galappaththy, P.; Constantine, G.R.; Jayawardena, R.; Weeratunga, H.D.; Premakumara, S.; Katulanda, P. Cinnamomum zeylanicum (Ceylon cinnamon) as a potential pharmaceutical agent for type-2 diabetes mellitus: Study protocol for a randomized controlled trial. Trials 2017, 18, 446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Gulcin, I.; Kaya, R.; Goren, A.C.; Akincioglu, H.; Topal, M.; Bingol, Z.; Alwasel, S. Anticholinergic, antidiabetic and antioxidant activities of cinnamon (Cinnamomum verum) bark extracts: Polyphenol contents analysis by LC-MS/MS. Int. J. Food Prop. 2019, 22, 1511–1526. [Google Scholar] [CrossRef] [Scilit]
  13. Schink, A.; Naumoska, K.; Kitanovski, Z.; Kampf, C.J.; Fröhlich-Nowoisky, J.; Thines, E.; Lucas, K. Anti-inflammatory effects of cinnamon extract and identification of active compounds influencing the TLR2 and TLR4 signaling pathways. Food Funct. 2018, 9, 5950–5964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Semenya, S.S.; Potgieter, M.J.; Erasmus, L.J.C. Ethnobotanical survey of medicinal plants used by Bapedi traditional healers to manage HIV/AIDS in the Limpopo Province, South Africa. J. Med. Plant Res. 2013, 7, 434–441. [Google Scholar] [CrossRef]
  15. Padalia, H.; Rathod, T.; Moteriya, P.; Chanda, S. Antimicrobial efficacy of Cinnamonum verum essential oil alone and in combination with antibiotics and other essential oils. Int. J. Curr. Microbiol. Appl. 2017, 6, 3377–3395. [Google Scholar] [CrossRef] [Scilit]
  16. Al-Zereini, W.A.; Al-Trawneh, I.N.; Al-Qudah, M.A.; TumAllah, H.M.; Al-Rawashdeh, H.A.; Abudayeh, Z.H. Essential oils from Elettaria cardamomum (L.) Maton grains and Cinnamomum verum J. Presl barks: Chemical examination and bioactivity studies. J. Pharm. Pharmacogn. Res. 2022, 10, 173–185. [Google Scholar] [CrossRef] [Scilit]
  17. Jirovetz, L.; Buchbauer, G.; Ruzicka, J.; Shafi, M.P.; Rosamma, M.K. Analysis of Cinnamomum zeylanicum Blume leaf oil from South India. J. Essent. Oil Res. 2001, 13, 442–443. [Google Scholar] [CrossRef] [Scilit]
  18. Farias, A.P.P.; Monteiro, O.D.S.; da Silva, J.K.R.; Figueiredo, P.L.B.; Rodrigues, A.A.C.; Monteiro, I.N.; Maia, J.G.S. Chemical composition and biological activities of two chemotype-oils from Cinnamomum verum J. Presl growing in North Brazil. J. Food Sci. Technol. 2020, 57, 3176–3183. [Google Scholar] [CrossRef] [Scilit]
  19. Binitha Raj, R.V.; Rajesh, K.S.; Mahadevan, S.; Rosamma, M.P.; Meena, C.V. Detection of adulteration in commercial samples of Cinnamomum verum JS Presl from Kerala. Eur. J. Biomed. 2018, 5, 297–304. [Google Scholar]
  20. Geethakumary, M.P.; Pandurangan, A.G.; Santhoshkumar, E.S. Cinnamomum litseaefolium (Lauraceae)–A new distributional record for India. Rheedea 2012, 22, 127–130. [Google Scholar]
  21. Ananthakrishnan, R.; Santhoshkumar, E.S.; Rameshkumar, K.B. Comparative chemical profiles of essential oil constituents of eight wild Cinnamomum species from the Western Ghats of India. Nat. Prod. Commun. 2018, 13, 1934578X1801300525. [Google Scholar] [CrossRef] [Scilit]
  22. Xavier, J.K.A.; Maia, L.; Figueiredo, P.L.B.; Folador, A.; Ramos, A.R.; Andrade, E.H.; Maia, J.G.S.; Setzer, W.N.; da Silva, J.K.R. Essential Oil Composition and DNA Barcode and Identification of Aniba species (Lauraceae) Growing in the Amazon Region. Molecules 2021, 26, 1914. [Google Scholar] [CrossRef] [Scilit]
  23. da Trindade, R.C.S.; Xavier, J.K.A.M.; Setzer, W.N.; Maia, J.G.S.; da Silva, J.K.R. Chemical Diversity and Therapeutic Effects of Essential Oils of Aniba Species from the Amazon: A Review. Plants 2021, 10, 1854. [Google Scholar] [CrossRef] [Scilit]
  24. Santhosh Kumar, J.U.; Krishna, V.; Seethapathy, G.S.; Ganesan, R.; Ravikanth, G.; Shaanker, R.U. Assessment of adulteration in raw herbal trade of important medicinal plants of India using DNA barcoding. 3 Biotech 2018, 8, 135. [Google Scholar] [CrossRef] [Scilit]
  25. Li, Y.; Geng, L.; Liu, Y.; Chen, M.; Mu, Q.; Zhang, X.; Ren, G.; Liu, C. Identification of three Daphne species by DNA barcoding and HPLC fingerprint analysis. PLoS ONE 2018, 13, e0201711. [Google Scholar] [CrossRef] [Scilit]
  26. Yu, J.; Wu, X.; Liu, C.; Newmaster, S.; Ragupathy, S.; Kress, W.J. Progress in the use of DNA barcodes in the identification and classification of medicinal plants. Ecotoxicol. Environ. Saf. 2021, 208, 111691. [Google Scholar] [CrossRef] [Scilit]
  27. Swetha, V.P.; Parvathy, V.A.; Sheeja, T.E.; Sasikumar, B. DNA barcoding for discriminating the economically important Cinnamomum verum from its adulterants. Food Biotechnol. 2014, 28, 183–194. [Google Scholar] [CrossRef] [Scilit]
  28. Fahlén, A.; Welander, M.; Wennersten, R. Effects of light–temperature regimes on plant growth and essential oil yield of selected aromatic plants. J. Sci. Food. Agric. 1997, 73, 111–119. [Google Scholar] [CrossRef]
  29. Malsawmtluangi, L.; Nautiyal, B.P.; Hazarika, T.; Chauhan, R.S.; Tava, A. Essential oil composition of bark and leaves of Cinammoum verum Bertch. & Presl from Mizoram, North East India. J. Essent. Oil Res. 2016, 28, 551–556. [Google Scholar] [CrossRef] [Scilit]
  30. Koketsu, M.; Gonçalves, S.L.; Godoy, R.L.D.O.; Lopes, D.; Morsbach, N. Óleos essenciais de cascas e folhas de canela (Cinnamomum verum Presl) cultivada no Paraná. Food Sci. Technol. 1997, 17, 281–285. [Google Scholar] [CrossRef] [Scilit]
  31. Chinh, H.V.; Luong, N.X.; Thin, D.B.; Dai, D.N.; Hoi, T.M.; Ogunwande, I.A. Essential oils leaf of Cinnamomum glaucescens and Cinnamomum verum from Vietnam. J. Essent. Oil Res. 2017, 8, 2712. [Google Scholar] [CrossRef]
  32. Ariyarathne, H.B.M.A.; Weerasooriya, S.N.; Senarath, W.T.P.S.K. Comparison of morphological and chemical characteristics of two selected accessions and six wild species of genus Cinnamomum Schaeff. Sri Lankan J. Biol. 2018, 3, 11–23. [Google Scholar] [CrossRef] [Scilit]
  33. Wijeweera, A.A.; Hewage, J.W.; Jayasinghe, G.G.; Waduthanthrige, S.H.; Hettiarachchi, S.R.; Wijesinghe, K.G. Maturity dependence of quality, quantity and chemical constituents of bark and leaf oil of Ceylon Cinnamon (Cinnamomum zeylanicum Blume). Ruhuna J. Sci. 2020, 11, 1–12. [Google Scholar] [CrossRef] [Scilit]
  34. Li, Y.; Kong, D.; Lin, X.; Xie, Z.; Bai, M.; Huang, S.; Nian, H.; Wu, H. Quality evaluation for essential oil of Cinnamomum verum leaves at different growth stages based on GC–MS, FTIR and microscopy. Food Anal. Methods 2016, 9, 202–212. [Google Scholar] [CrossRef] [Scilit]
  35. Monteiro, I.N.; dos Santos Monteiro, O.; Costa-Junior, L.M.; da Silva Lima, A.; de Aguiar Andrade, E.H.; Maia, J.G.S.; Mouchrek Filho, V.E. Chemical composition and acaricide activity of an essential oil from a rare chemotype of Cinnamomum verum Presl on Rhipicephalus microplus (Acari: Ixodidae). Vet. Parasitol. 2017, 238, 54–57. [Google Scholar] [CrossRef] [Scilit]
  36. Liyanage, N.N.; Ranawake, A.L.; Bandaranayake, P.C.G. Cross-pollination effects on morphological, molecular, and biochemical diversity of a selected cinnamon (Cinnamomum zeylanicum Blume) seedling population. J. Crop Improv. 2021, 35, 21–37. [Google Scholar] [CrossRef] [Scilit]
  37. Chakraborty, A.; Sankaran, V.; Ramar, M.; Chellappan, D.R. Chemical analysis of leaf essential oil of Cinnamomum verum from Palni hills, Tamil Nadu. J. Chem. Pharm. 2015, 8, 476–479. [Google Scholar]
  38. Jantan, I.B.; Karim Moharam, B.A.; Santhanam, J.; Jamal, J.A. Correlation between chemical composition and antifungal activity of the essential oils of eight cinnamomum. Species. Pharm. Biol. 2008, 46, 406–412. [Google Scholar] [CrossRef] [Scilit]
  39. Dongmo, P.M.J.; Tatsadjieu, L.N.; Tchoumbougnang, F.; Sameza, M.L.; Dongmo, B.N.; Zollo, P.H.A.; Menut, C. Chemical composition, antiradical and antifungal activities of essential oil of the leaves of Cinnamomum zeylanicum Blume from Cameroon. Nat. Prod. Commun. 2007, 2, 1934578X0700201219. [Google Scholar] [CrossRef] [Scilit]
  40. de Castro, C.C.; da Silva, A.R.C.; Franco, C.D.J.P.; Siqueira, G.M.; Cascaes, M.M.; do Nascimento, L.D.; de Aguiar Andrade, E.H. Caracterização química do óleo essencial das folhas, galhos e frutos de Cinnamomum verum J. Presl (Lauraceae). Braz. J. Dev. 2020, 6, 41320–41333. [Google Scholar] [CrossRef] [Scilit]
  41. Lima, M.D.P.; Zoghbi, M.D.G.B.; Andrade, E.H.A.; Silva, T.M.D.; Fernandes, C.S. Constituintes voláteis das folhas e dos galhos de Cinnamomum zeylanicum Blume (Lauraceae). Acta Amaz 2005, 35, 363–366. [Google Scholar] [CrossRef] [Scilit]
  42. ISO 3524:2003(E); Oil of Cinnamon Leaf, Sri Lanka Type (Cinnamomum zeylanicum Blume). ISO (International Organization for Standardization): Geneva, Switzerland, 2003.
  43. Boniface, Y.; Philippe, S.; de Lima, H.R.; Pierre, N.J.; Alain, A.G.; Fatiou, T.; Dominique, S. Chemical composition and antimicrobial activities of Cinnamomum zeylanicum Blume dry leaves essential oil against food-borne pathogens and adulterated microorganisms. Int. Res. J. Biol. Sci. 2012, 1, 18–25. [Google Scholar]
  44. Jayaprakasha, G.K.; Jagan Mohan Rao, L.; Sakariah, K.K. Chemical composition of the flower oil of Cinnamomum zeylanicum Blume. J. Agric. Food Chem. 2000, 48, 4294–4295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Cheng, S.S.; Liu, J.Y.; Hsui, Y.R.; Chang, S.T. Chemical polymorphism and antifungal activity of essential oils from leaves of different provenances of indigenous cinnamon (Cinnamomum osmophloeum). Bioresour. Technol. 2006, 97, 306–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Csikós, E.; Csekő, K.; Ashraf, A.R.; Kemény, Á.; Kereskai, L.; Kocsis, B.; Böszörményi, A.; Helyes, Z.; Horváth, G. Effects of Thymus vulgaris L., Cinnamomum verum J. Presl and Cymbopogon nardus (L.) rendle essential oils in the endotoxin-induced acute airway inflammation mouse model. Molecules 2020, 25, 3553. [Google Scholar] [CrossRef] [Scilit]
  47. Andrade, M.A.; Cardoso, M.D.G.; Batista, L.R.; Mallet, A.C.T.; Machado, S.M.F. Óleos essenciais de Cymbopogon nardus, Cinnamomum zeylanicum e Zingiber officinale: Composição, atividades antioxidante e antibacteriana. Rev. Cienc. Agron. 2012, 43, 399–408. [Google Scholar] [CrossRef] [Scilit]
  48. Nath, S.C.; Pathak, M.G.; Baruah, A. Benzyl benzoate, the major component of the leaf and stem bark oil of Cinnamomum zeylanicum Blume. J. Essent. Oil Res. 1996, 8, 327–328. [Google Scholar] [CrossRef] [Scilit]
  49. Raina, V.K.; Srivastava, S.K.; Aggarwal, K.K.; Ramesh, S.; Kumar, S. Essential oil composition of Cinnamomum zeylanicum Blume leaves from Little Andaman, India. Flavour Fragr. J. 2001, 16, 374–376. [Google Scholar] [CrossRef] [Scilit]
  50. Adams, R.P. Identification of Essential Oil Components by Gas Chromatography/Mass Spectrometry; Allured Publishing Corporation: Carol Stream, IL, USA, 2007. [Google Scholar]
  51. Mondello, L. FFNSC 2: Flavors and Fragrances of Natural and Synthetic Compounds, Mass Spectral Database; John Wiley & Sons Inc.: Hoboken, NJ, USA, 2011. [Google Scholar]
  52. Alberts, P.S.F.; Meyer, J.J.M. Integrating chemotaxonomic-based metabolomics data with DNA barcoding for plant identification: A case study on south-east African Erythroxylaceae species. S. Afr. J. Bot. 2022, 146, 174–186. [Google Scholar] [CrossRef] [Scilit]
  53. El-Atroush, H. DNA Barcoding of Two Medicinal Plants Using Molecular Markers. Egypt. Acad. J. Biolog. Sci. (C. Physiol. Mol. Biol.) 2020, 12, 83–92. [Google Scholar]
  54. Kress, W.J.; Erickson, D.L. A two-locus global DNA barcode for land plants: The coding RBCL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2007, 2, e508. [Google Scholar] [CrossRef] [Scilit]
  55. CBOL Plant Working Group 1; Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Little, D.P.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef] [Scilit]
  56. Kiran, K.R.; Swathy, P.S.; Paul, B.; Prasada, K.S.; Rao, M.R.; Joshi, M.B.; Rai, P.S.R.; Satyamoorthy, K.; Muthusamy, A. Untargeted metabolomics and DNA barcoding for discrimination of Phyllanthus species. J. Ethnopharmacol. 2021, 273, 113928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Seethapathy, G.S.; Ganesh, D.; Santhosh Kumar, J.U.; Senthilkumar, U.; Newmaster, S.G.; Ragupathy, S.; Shaanker, R.U.; Ravikanth, G. Assessing product adulteration in natural health products for laxative yielding plants, Cassia, Senna, and Chamaecrista, in Southern India using DNA barcoding. Int. J. Leg. Med. 2015, 129, 693–700. [Google Scholar] [CrossRef] [Scilit]
  58. Hollingsworth, P.M.; Graham, S.W.; Little, D.P. Choosing and using a plant DNA barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Kress, W.J.; Erickson, D.L.; Jones, F.A.; Swenson, N.G.; Perez, R.; Sanjur, O.; Bermingham, E. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Natl. Acad. Sci. USA 2009, 106, 18621–18626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Trofimov, D.; Rudolph, B.; Rohwer, J.G. Phylogenetic study of the genus Nectandra (Lauraceae), and reinstatement of Damburneya. Taxon 2016, 65, 980–996. [Google Scholar] [CrossRef] [Scilit]
  61. Chandrasekara, C.B.; Naranpanawa, D.N.U.; Bandusekara, B.S.; Pushpakumara, D.K.N.G.; Wijesundera, D.S.A.; Bandaranayake, P.C. Universal barcoding regions, rbcL, matK and trnH-psbA do not discriminate Cinnamomum species in Sri Lanka. PLoS ONE 2021, 16, e0245592. [Google Scholar] [CrossRef] [Scilit]
  62. Yang, B.C.; Lee, M.S.; Sun, F.C.; Chao, H.H.; Chang, W.T.; Lin, M.K.; Chen, H.J.; Lee, M.S. Rapid identification of the indigenous medicinal crop Cinnamomum osmophloeum from various adulterant Cinnamomum species by DNA polymorphism analysis. Pharmacogn. Mag. 2020, 16, 64. [Google Scholar]
  63. Sánchez, M.; González-Burgos, E.; Divakar, P.K.; Gómez-Serranillos, M.P. DNA-based authentication and metabolomics analysis of medicinal plants samples by DNA barcoding and ultra-high-performance liquid chromatography/triple quadrupole mass spectrometry (UHPLC-MS). Plants 2020, 9, 1601. [Google Scholar] [CrossRef] [Scilit]
  64. Feitosa-Alcantara, R.B.; Arrigoni-Blank, M.D.F.; Blank, A.F.; Nogueira, P.C.D.L.; Sampaio, T.S.; Nizio, D.A.D.C.; Almeida-Pereira, C.S. Chemical diversity of essential oils from Hyptis pectinata (L.) Poit. Biosci. J. 2018, 34, 875–887. [Google Scholar] [CrossRef] [Scilit]
  65. Wink, M. Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemistry 2003, 64, 3–19. [Google Scholar] [CrossRef] [Scilit]
  66. Philippe, F.; Dubrulle, N.; Marteaux, B.; Bonnet, B.; Choisy, P.; Berthon, J.Y.; Garnier, L.; Leconte, N.; Milesi, S.; Morvan, P.Y.; et al. Combining DNA Barcoding and Chemical fingerprints to authenticate Lavender raw material. Int. J. Cosmet. Sci. 2022, 44, 91–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Mishra, P.; Kumar, A.; Nagireddy, A.; Mani, D.N.; Shukla, A.K.; Tiwari, R.; Sundaresan, V. DNA barcoding: An efficient tool to overcome authentication challenges in the herbal market. Plant Biotechnol. J. 2016, 14, 8–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Cristians, S.; Bye, R.; Nieto-Sotelo, J. Molecular markers associated with chemical analysis: A powerful tool for quality control assessment of copalchi medicinal plant complex. Front. Pharmacol. 2018, 9, 666. [Google Scholar] [CrossRef] [Scilit]
  69. van den Dool, H.; Kratz, P.D. A generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 1963, A11, 463–471. [Google Scholar] [CrossRef] [Scilit]
  70. Lias, S.G.; Mikaia, A.I.; Sparkman, O.D.; Stein, S.E.; Zaikin, G. The NIST/EPA/NIH Mass Spectral Database: Simultaneous Control of Quality and Quantity. In Proceedings of the 45th ASMS Conference on Mass Spectrometry and Allied Topics, Palm Springs, CA, USA, 1–5 June 1997; Available online: https://www.nist.gov/publications/nistepanih-mass-spectral-database-simultaneous-control-quality-and-quantity (accessed on 26 February 2022).
  71. Liu, Z.F.; Ci, X.Q.; Li, L.; Li, H.W.; Conran, J.G.; Li, J. DNA barcoding evaluation and implications for phylogenetic relationships in Lauraceae from China. PLoS ONE 2017, 12, e0175788. [Google Scholar] [CrossRef] [Scilit]
  72. Sang, T.; Crawford, D.J.; Stuessy, T.F. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 1997, 84, 1120–1136. [Google Scholar] [CrossRef] [Scilit]
  73. Tate, J.A.; Simpson, B.B. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 2003, 28, 723–737. [Google Scholar] [CrossRef]
  74. Ford, C.S.; Ayres, K.L.; Toomey, N.; Haider, N.; Van Alphen Stahl, J.; Kelly, L.J.; Wikstrom, N.; Hollingsworth, P.M.; Duff, R.J.; Hoot, S.B.; et al. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. 2009, 159, 1–11. [Google Scholar] [CrossRef] [Scilit]
  75. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit]
  76. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
  77. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit]
  80. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  81. Kimura, M.A. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. The tridimensional plot of the first three components (PC1, PC2 and PC3) from principal component analysis (PCA) of Cinnamomum verum samples, based on the main constituents present in the analyzed essential oils: cultivated (Cve1-Cve5) and commercial samples (Cv6-c-Cve9-c).
Figure 1. The tridimensional plot of the first three components (PC1, PC2 and PC3) from principal component analysis (PCA) of Cinnamomum verum samples, based on the main constituents present in the analyzed essential oils: cultivated (Cve1-Cve5) and commercial samples (Cv6-c-Cve9-c).
Molecules 27 07337 g001
Figure 2. Multiple alignments of the nucleotide sequences of the markers matK, rbcL and psbA-trnH of cultivated (Cve1–Cve5) and commercial samples (Cve6-c–Cve9-c) of Cinnamomum verum. The dots indicate the consensus nucleotides, and the Boxes shown the variable region observed in pbsA-trnH.psbA-trnH (1–431 bp), rbcL (432–974 bp) and matK (975–1712 bp).
Figure 2. Multiple alignments of the nucleotide sequences of the markers matK, rbcL and psbA-trnH of cultivated (Cve1–Cve5) and commercial samples (Cve6-c–Cve9-c) of Cinnamomum verum. The dots indicate the consensus nucleotides, and the Boxes shown the variable region observed in pbsA-trnH.psbA-trnH (1–431 bp), rbcL (432–974 bp) and matK (975–1712 bp).
Molecules 27 07337 g002
Table 2. Molecular characteristics of markers evaluated for Cinnamomum verum.
Table 2. Molecular characteristics of markers evaluated for Cinnamomum verum.
DNA MarkersAligned Length (bp)Nucleotide Diversity (π)Polymorphic SitesParsimony-Informative Sites
rbcL5430.00012330
matK7380.0000000
psbA-trnH4180.01449206
rbcL+matK+psbA-trnH16990.00700236
Table 3. Data from cultivated and commercial Cinnamomum verum samples.
Table 3. Data from cultivated and commercial Cinnamomum verum samples.
Sample CodeTypeCollection Site/CompanyVoucher
Cve1CultivatedMaranhãozinho (MA)243613
Cve2CultivatedCuruçá (PA)243614
Cve3CultivatedBelém (PA)243615
Cve4CultivatedBenevides (PA)243616
Cve5CultivatedBelém (PA)243617
Cve6-ccommercializedVer-o-peso market Not cataloged
Cve7-ccommercializedTempero e CiaNot cataloged
CVe8-ccommercializedVer-o-peso marketNot cataloged
Cve9-ccommercializedPau de verônicaNot cataloged
Table 4. Primer sequences applied in DNA amplification of Cinnamomum verum species and its experimental conditions.
Table 4. Primer sequences applied in DNA amplification of Cinnamomum verum species and its experimental conditions.
RegionPrimersSequence (5′–3′)Amplification Protocol
matK 1matk 2.1CCTATCCATCTGGAAATCTTAG 95 °C 7min; 95 °C 1min, 53 °C
1 min, 72 °C 1 min, 35 cycles;
72 °C 7 min
matk 5GTTCTAGCACAAGAAAGTCG
psbA 2psbA3_f FGTTATGCATGAACGTAATGCT95 °C 7 min; 95 °C 1min, 56 °C
1 min, 72 °C 1 min, 35 cycles;
72 °C 7 min
trnH 3trnHf_05 RCGCGCATGGTGGATTCACAATCC
rbcL 4rbcL1ATGTCACCACAAACAGAGACTAAAGC95 °C 7min; 95 °C 1min, 53 °C
1 min, 72 °C 1 min, 35 cycles;
72 °C 7 min
rbcLa GTAAAATCAAGTCCACCRCG
1 [71]; 2 [72]; 3 [73]; 4 [74].
Table 5. GenBank accession numbers of Cinnamomum verum species collected in the Amazon.
Table 5. GenBank accession numbers of Cinnamomum verum species collected in the Amazon.
Sample CodematKpsbA-trnHrbcL
Cve1OM981169OM981164OM981159
Cve2OM981170OM981165OM981160
Cve3OM981171OM981166OM981161
Cve4OM981172OM981167OM981162
Cve5OM981173OM981168OM981163
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Xavier, J.K.A.M.; Baia, T.G.C.; Alegria, O.V.C.; Figueiredo, P.L.B.; Carneiro, A.R.; Moreira, E.C.d.O.; Maia, J.G.S.; Setzer, W.N.; da Silva, J.K.R. Essential Oil Chemotypes and Genetic Variability of Cinnamomum verum Leaf Samples Commercialized and Cultivated in the Amazon. Molecules 2022, 27, 7337. https://doi.org/10.3390/molecules27217337

AMA Style

Xavier JKAM, Baia TGC, Alegria OVC, Figueiredo PLB, Carneiro AR, Moreira ECdO, Maia JGS, Setzer WN, da Silva JKR. Essential Oil Chemotypes and Genetic Variability of Cinnamomum verum Leaf Samples Commercialized and Cultivated in the Amazon. Molecules. 2022; 27(21):7337. https://doi.org/10.3390/molecules27217337

Chicago/Turabian Style

Xavier, Júlia Karla A. M., Talissa Gabriele C. Baia, Oscar Victor C. Alegria, Pablo Luis B. Figueiredo, Adriana R. Carneiro, Edith Cibelle de O. Moreira, José Guilherme S. Maia, William N. Setzer, and Joyce Kelly R. da Silva. 2022. "Essential Oil Chemotypes and Genetic Variability of Cinnamomum verum Leaf Samples Commercialized and Cultivated in the Amazon" Molecules 27, no. 21: 7337. https://doi.org/10.3390/molecules27217337

APA Style

Xavier, J. K. A. M., Baia, T. G. C., Alegria, O. V. C., Figueiredo, P. L. B., Carneiro, A. R., Moreira, E. C. d. O., Maia, J. G. S., Setzer, W. N., & da Silva, J. K. R. (2022). Essential Oil Chemotypes and Genetic Variability of Cinnamomum verum Leaf Samples Commercialized and Cultivated in the Amazon. Molecules, 27(21), 7337. https://doi.org/10.3390/molecules27217337

Article Metrics

Back to TopTop