Flavonoids from Lycium barbarum Leaves Exhibit Anti-Aging Effects through the Redox-Modulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of Crude Extracts from Lycium barbarum Leaves
2.3. Preliminary Purification of LBLF by D101 Rein
2.4. Repurification and Enrichment of LBLF by PR
2.5. Identification of Compounds by Ultra Performance Liquid Chromatography-Mass Spectrometry (UPLC-MS) and High Performance Liquid Chromatography (HPLC)
2.6. Cell Culture and Treatment
2.7. Cell Viability Assay
2.8. Measurement of ROS, SOD, GSH-Px, CAT and MDA
2.9. RNA-Seq Analysis
2.10. C. elegans Culture and Lifespan Assay
2.11. Movement Assay
2.12. Real-Time PCR (RT-PCR) Analysis of mRNA Expression
2.13. Statistical Analysis
3. Results
3.1. Static Adsorption and Desorption of D101 Resin
3.2. Dynamic Adsorption and Desorption of Polyamide Resin
3.3. Characterization of LBLF by UPLC-MS and HPLC
3.4. LBLF Alleviates H2O2-Induced Cell Death in HUVECs
3.5. LBLF Suppressed H2O2-Induced Oxidative Stress Generation
3.6. Differential Gene Expression in H2O2 and LBLF Treated Cells
3.7. Increase of EPO and HO-1 Expression Is MAPK Dependent
3.8. Effect of LBLF on the Lifespan of C. elegans
3.9. Effect of LBLF on the Movement of C. elegans
3.10. LBLF Extended Lifespan by Increasing Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zheng, S.Q.; Huang, X.B.; Xing, T.K.; Ding, A.J.; Wu, G.S.; Luo, H.R. Chlorogenic acid extends the lifespan of Caenorhabditis elegans via insulin/IGF-1 signaling pathway. J. Gerontol. A Biol. 2017, 72, 464–472. [Google Scholar]
- Niccoli, T.; Partridge, L. Ageing as a risk factor for disease. Curr. Biol. 2012, 22, 741–752. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serbetci Tohma, H.; Gulcin, I. Antioxidant and radical scavenging activity of aerial parts and roots of Turkish liquorice (Glycyrrhiza glabra L.). Int. J. Food Prop. 2010, 13, 657–671. [Google Scholar] [CrossRef]
- Deepika; Pawan, K.M. Health benefits of quercetin in age-related diseases. Molecules 2022, 27, 2498. [Google Scholar] [CrossRef] [PubMed]
- Mocan, A.; Zengin, G.; Simirgiotis, M.; Mollica, A.; Vodnar, D.C.; Crişan, G.; Rohn, S. Functional constituents of wild and cultivated Goji (L. barbarum L.) leaves: Phytochemical characterization, biological profile, and computational studies. J. Enzym. Inhib. Med. Ch. 2017, 32, 153–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Pandey, A.K. Chemistry and biological activities of flavonoids: An overview. Sci. World J. 2013, 2013, 162750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruan, X.; Zhan, L.M.; Gao, X.X.; Yan, L.Y.; Zhang, H.; Zhu, Z.Y.; Wang, Q.; Jiang, D.A. Separation and purification of flavonoid from taxus remainder extracts free of taxoids using polystyrene and polyamide resin. J. Sep. Sci. 2013, 36, 1925–1934. [Google Scholar] [PubMed]
- Vongsak, B.; Sithisarn, P.; Mangmool, S.; Thongpraditchote, S.; Wongkrajang, Y.; Gritsanapan, W. Maximizing total phenolics, total flavonoids contents and antioxidant activity of moringa oleifera leaf extract by the appropriate extraction method. Ind. Crop. Prod. 2013, 44, 566–571. [Google Scholar] [CrossRef]
- Abdennacer, B.; Karim, M.; Yassine, M.; Nesrine, R.; Mouna, D.; Mohamed, B. Determination of phytochemicals and antioxidant activity of methanol extracts obtained from the fruit and leaves of tunisian Lycium intricatum boiss. Food Chem. 2015, 174, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Ma, N.; Xia, F.B.; Li, P.; He, C.W.; Wu, Z.Q.; Wan, J.B. Preparative separation of minor saponins from Panax notoginseng leaves using biotransformation, macroporous resins and preparative high-performance liquid chromatography. J. Ginseng Res. 2019, 43, 105–115. [Google Scholar] [CrossRef]
- Sun, L.J.; Liu, D.J.; Sun, J.J.; Yang, X.B.; Fu, M.H. Simultaneous separation and purification of chlorogenic acid, epicatechin, hyperoside and phlorizin from thinned young, Qinguan, apples by successive use of polyethylene and polyamideresins. Food Chem. 2017, 230, 362–371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niu, Y.H.; Chen, J.H.; Fan, Y.L.; Kou, T.T. Effect of flavonoids from Lycium barbarum leaves on the oxidation of myofibrillar proteins in minced mutton during chilled storage. J. Food Sci. 2021, 86, 1766–1777. [Google Scholar] [CrossRef] [PubMed]
- Pallauf, K.; Duckstein, N.; Rimbach, G. A literature review of flavonoids and lifespan in model organisms. Proc. Nutr. Soc. 2016, 76, 145–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bajalan, I.; Mohammadi, M.; Alaei, M.; Pirbalouti, A.G. Total phenolic and flavonoid contents and antioxidant activity of extracts from different populations of lavandin. Ind. Crop. Prod. 2016, 87, 255–260. [Google Scholar] [CrossRef]
- Romero-Márquez, J.M.; Navarro-Hortal, M.D.; Jiménez-Trigo, V.; Vera-Ramírez, L.; Forbes-Hernández, T.J.; Esteban-Muñoz, A.; Giampieri, F.; Bullón, P.; Battino, M.; Sánchez-González, C.; et al. An oleuropein rich-olive (Olea europaea L.) leaf extract reduces β-amyloid and tau proteotoxicity through regulation of oxidative- and heat shock-stress responses in Caenorhabditis elegans. Food Chem. Toxicol. 2022, 162, 112914. [Google Scholar] [CrossRef] [PubMed]
- Helms, S.J.; Rozemuller, W.M.; Costa, A.C.; Avery, L.; Stephens, G.J.; Shimizu, T.S. Modelling the ballistic-to-diffusive transition in nematode motility reveals variation in exploratory behaviour across species. J. R. Soc. Interface 2019, 157, 20190174. [Google Scholar] [CrossRef] [Green Version]
- Xie, Y.; Guo, Q.S.; Wang, G.S. Preparative separation and purification of the total flavonoids in Scorzonera austriaca with macroporous resins. Molecules 2016, 21, 768. [Google Scholar] [CrossRef]
- Kenny, O.; Smyth, T.; Hewage, C.; Brunton, N.P. Antioxidant properties and quantitative uplc-ms analysis of phenolic compounds from extracts of fenugreek Cargnello (Trigonella foenum-graecum) seeds and bitter melon (Momordica charantia) fruit. Food Chem. 2013, 141, 4295–4302. [Google Scholar] [CrossRef] [PubMed]
- Cargnello, M.; Roux, P.P. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 2011, 75, 50–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.B.; Yuan, B.; Huang, H.F.; Qu, S.M.; Yang, S.K.; Zeng, Z. Gastrodin induced HO-1 and Nrf2 up-regulation to alleviate H2O2-induced oxidative stress in mouse liver sinusoidal endothelial cells through p38 MAPK phosphorylation. Braz. J. Med. Biol. Res. 2018, 51, 7439. [Google Scholar] [CrossRef]
- Genc, K.; Egrilmez, M.Y.; Genc, S. Erythropoietin induces nuclear translocation of Nrf2 and heme oxygenase-1 expression in SH-SY5Y cells. Cell Biochem. Funct. 2010, 28, 197–201. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.C.; Hsiao, L.D.; Lin, H.H.; Tseng, H.C.; Situmorang, J.H.; Leu, Y.L.; Yang, C.M. Induction of HO-1 by 5,8-Dihydroxy-4,7-Dimethoxyflavone via activation of ROS/p38 MAPK/Nrf2 attenuates thrombin-induced connective tissue growth factor expression in human cardiac fibroblasts. Oxidative Med. Cell. Longev. 2020, 2020, 1080168. [Google Scholar] [CrossRef]
- Marzo, F.; Lavorgna, A.; Coluzzi, G.; Santucci, E.; Tarantino, F.; Rio, T.; Conti, E.; Autore, C.; Agati, L.; Andreotti, F. Erythropoietin in heart and vessels: Focus on transcription and signalling pathways. J. Thromb. Thrombolysis 2008, 26, 183–187. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.C.; Li, W.H.; Shi, Y.C.; Yen, P.L.; Chang, S.T. Antioxidant activity and delayed aging effects of hot water extract from Chamaecyparis obtusa var. formosana leaves. J. Agric. Food Chem. 2014, 62, 4159–4165. [Google Scholar] [CrossRef] [PubMed]
- Kampkötter, A.; Timpel, C.; Zurawski, R.F.; Ruhl, S.; Chovolou, Y.; Proksch, P.; Wätjen, W. Increase of stress resistance and lifespan of Caenorhabditis elegans by quercetin. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2008, 149, 314–323. [Google Scholar] [CrossRef] [PubMed]
- Grünz, G.; Haas, K.; Soukup, S.; Klingenspor, M.; Kulling, S.E.; Daniel, H.; Spanier, B. Structural features and bioavailability of four flavonoids and their implications for lifespan-extending and antioxidant actions in C. elegans. Mech. Ageing Dev. 2012, 133, 1–10. [Google Scholar] [CrossRef]
- Birch-Machin, M.A.; Bowman, A. Oxidative stress and ageing. Brit. J. Dermatol. 2016, 175, 26–29. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.K.; Zhou, Y.N.; Fan, H.T.; Billy, K.J.; Zhao, Y.J.; Zhan, X.; Yang, L.J.; Jia, Y. Effects of Lycium barbarum polysaccharides on health and aging of C.elegans depend on daf-12/daf-16. Oxidative Med. Cell. longev 2019, 2019, 6379493. [Google Scholar]
- Zhi, D.; Feng, N.; Ling, D.; Rong, L.; Hou, L.; Wang, M.; Ding, X.; Li, H. Realgar bioleaching solution suppress ras excessive activation by increasing ROS in Caenorhabditis elegans. Arch. Pharmacal. Res. 2014, 37, 390–398. [Google Scholar] [CrossRef]
- Song, B.; Zheng, B.S.; Li, T.; Liu, R.H. SKN-1 is involved in combination of apple peels and blueberry extracts synergistically protecting against oxidative stress in Caenorhabditis elegans. Food Funct. 2020, 11, 5409–5419. [Google Scholar] [CrossRef]
- Jia, W.; Peng, Q.; Su, L.; Yu, X.; Ma, C.; Liang, M.; Yin, X.; Zou, Y.; Huang, Z. Novel bioactive peptides from Meretrix meretrix protect Caenorhabditis elegans against free radical-induced oxidative stress through the stress response factor DAF-16/FOXO. Mar. Drugs 2018, 16, 444–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, Z.Y.; Chen, Y.T.; Wang, G.; Feng, T.; Shen, M.; Xiao, B.; Gu, J.Y.; Wang, W.M.; Li, J.; Zhang, Y.J. Evaluation of the antioxidant effects of acid hydrolysates from Auricularia auricular polysaccharides using a Caenorhabditis elegans model. Food Funct. 2019, 10, 5531–5543. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.H.; Kou, T.T.; Fan, Y.L.; Niu, Y.H. Antioxidant activity and stability of the flavonoids from Lycium barbarum leaves during gastrointestinal digestion in vitro. Int. J. Food Eng. 2020, 16, 417–422. [Google Scholar] [CrossRef]
- Jiang, W.Y.; Si, L.H.; Li, P.D.; Bing, B.; Qu, J.L.; Bao, H.; Zou, H.; Fan, X.; Liu, Z.Q.; Liu, Z.Y.; et al. Serum metabonomics study on antidiabetic effects of fenugreek flavonoids in streptozotocin-induced rats. J. Chromatogr. B 2018, 1092, 466–472. [Google Scholar] [CrossRef] [PubMed]
- Mocan, A.; Vlase, L.; Raita, O.; Hanganu, D.; Paltinean, R.; Dezsi, S.; Gheldiu, A.M.; Oprean, R.; Crisan, G. Comparative studies on antioxidant activity and polyphenolic content of Lycium barbarum L. and Lycium Chinese Mill. Leaves. Pak. J. Pharm. Sci. 2015, 28, 1511–1515. [Google Scholar] [PubMed]
- Zaplatic, E.; Bule, M.; Shah, S.Z.A.; Sahab Uddin, M.; Niaz, K. Molecular mechanisms underlying protective role of quercetin in attenuating Alzheimer’s disease. Life Sci. 2019, 224, 109–119. [Google Scholar] [CrossRef]
- Yahfoufi, N.; Alsadi, N.; Jambi, M.; Matar, C. The immunomodulatory and anti-inflammatory role of polyphenols. Nutrients 2018, 10, 1618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, T.Y.; Chen, S.F.; Feng, T.; Dong, J.; Li, Y.Y.; Li, H. Rutin protects against aging-related metabolic dysfunction. Food Funct. 2016, 7, 1147–1154. [Google Scholar] [CrossRef]
- Li, Y.H.; Qin, R.R.; Yan, H.D.; Wang, F.; Huang, S.Y.; Zhang, Y.; Zhong, M.; Zhang, W.; Wang, Z.H. Inhibition of vascular smooth muscle cells premature senescence with rutin attenuates and stabilizes diabetic atherosclerosis. J. Nutr. Biochem. 2018, 51, 91. [Google Scholar] [CrossRef]
- Georgieva, A.; Ilieva, Y.; Nedialkova, Z.K.; Zaharieva, M.M.; Nedialkov, P.; Dobreva, A.; Kroumov, A.; Najdenski, H.; Mileva, M. Redox-modulating capacity and antineoplastic activity of wastewater obtained from the distillation of the essential oils of four bulgarian oil-bearing roses. Antioxidants 2021, 10, 1615. [Google Scholar] [CrossRef] [PubMed]
- Zaharieva, M.M.; Dimitrova, D.Z.; Videva, S.R.; Ilieva, Y.; Brachkova, A.; Balabanova, V.; Gevrenova, R.; Kim, T.C.; Kaleva, M.; Georgieva, A.; et al. Antimicrobial and antioxidant potential of Scenedesmus obliquus microalgae in the context of integral biorefinery concept. Molecules 2022, 27, 519. [Google Scholar] [CrossRef] [PubMed]
System Name | Volume | |||
---|---|---|---|---|
Ⅰ | Reverse transcription system | |||
5 × HiScript II Q RT SuperMix | 4 μL | |||
RNA | 1 μg | |||
RNase-free H2O | Up to 20 μL | |||
50 °C 15 min 85 °C 5 s 4 °C 5 min | ||||
Ⅱ | Real-time PCR | |||
2 × RealStar Green Fast Mixture (GenStar) | 10 μL | |||
Upstream primer | 0.5 μL (10 μM) | |||
Downstream primer | 0.5 μL (10 μM) | |||
Revers e transcript | 2 μL | |||
DEPC H2O | 7 μL | |||
50 °C | 2 min | |||
95 °C | 10 min | | ||
95 °C | 15 s | 40 cycles | ||
60 °C | 1 min | |||
95 °C | 15 s | |||
60 °C | 1 min | |||
95 °C | 30 s | |||
60 °C | 15 s |
Gene Name | Primer Sequence | ||
---|---|---|---|
Forward (5′–3′) | Reverse (5′–3′) | ||
Human | EPO | GGAGGCCGAGAATATCACGAC | CCCTGCCAGACTTCTACGG |
C17ORF49 | GAAACAGAAGGCTGATGTGACACT | CCTTCAATATCCACCACGTCACT | |
HO-1 | AAGACTGCGTTCCTGCTCAAC | AAAGCCCTACAGCAACTGTCG | |
NRF2 | TCAGCGACGGAAAGAGTATGA | CCACTGGTTTCTGACTGGATGT | |
GAPDH | TCCAAAATCAAGTGGGGCGA | AAATGAGCCCCAGCCTTCTC | |
C. elegans | sod-2 | AGCTTTCGGCATCAACTGTC | AAGTCCAGTTGTTGCCTCAAGT |
gcs-1 | GTGCAAGTGTCGACGATCGTAC | GCGAATATGTTTTGCCAGTGGCTC | |
daf-16 | TCCTCATTCACTCCCGATTC | CCGGTGTATTCATGAACGTG | |
sir2.1 | TGGCTGACGATTCGATGGAT | ATGAGCAGAAATCGCGACAC | |
aak-2 | TGCTTCACCATATGCTCTGC | GTGGATCATCTCCCAGCAAT | |
skn-1 | ACAGGGTGGAAAAAGCAAGG | CAGGCCAAACGCCAATGAC | |
act-2 | CCCACTCAATCCAAAGGCTA | GGGACTGTGTGGGTAACACC | |
gapdh | TCAAGGAGGAGCCAAGAAGG | CAGTGGTGCCAGACAGTTG |
No. | Retention Time (min) | [M+H]+ | Compounds | Intensity |
---|---|---|---|---|
1 | 2.29 | 251.14 | Chrysin | 6,796,006 |
2 | 3.21 | 293.16 | Angelicain | 335,873.3 |
3 | 3.63 | 355.1 | Neochlorogenic acid | 32,480,266 |
4 | 4.17 | 472.24 | Quercetin-3-O-glucuronide | 40,736,980 |
5 | 4.43 | 512.24 | Isochlorogenic acid A | 3,446,140 |
6 | 6.15 | 610.19 | Rutin | 45,838,012 |
7 | 7.57 | 453.34 | Taxifolin 7-rhamnoside | 20,721,940 |
8 | 7.8 | 509.89 | Isochlorogenic acid B | 5,564,009 |
9 | 8.99 | 420.22 | Daidzin | 2,764,151.5 |
10 | 9.65 | 279.09 | Kaempferol | 15,970,930 |
11 | 17.11 | 149.02 | Piperonone | 11,459,642 |
Treatment | I | II | III | IV | V |
---|---|---|---|---|---|
H2O | Met | DMSO | Rutin | LBLF | |
Mean lifespan | 14.8± 0.1 | 15.9 ± 0.9 | 14.9 ± 1.0 | 16.0 ± 0.3 | 17.1 ± 0.4 |
Fold increase | 7.5% | 7.6% | 15.0% | ||
p value | / | I vs. II 0.13 | / | III vs. IV 0.12 | III vs. V <0.0001 |
Uncensored/n | 78/100 | 72/100 | 85/100 | 76/100 | 78/100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niu, Y.; Liao, J.; Zhou, H.; Wang, C.-c.; Wang, L.; Fan, Y. Flavonoids from Lycium barbarum Leaves Exhibit Anti-Aging Effects through the Redox-Modulation. Molecules 2022, 27, 4952. https://doi.org/10.3390/molecules27154952
Niu Y, Liao J, Zhou H, Wang C-c, Wang L, Fan Y. Flavonoids from Lycium barbarum Leaves Exhibit Anti-Aging Effects through the Redox-Modulation. Molecules. 2022; 27(15):4952. https://doi.org/10.3390/molecules27154952
Chicago/Turabian StyleNiu, Yinhong, Jiale Liao, Haitao Zhou, Chih-chen Wang, Lei Wang, and Yanli Fan. 2022. "Flavonoids from Lycium barbarum Leaves Exhibit Anti-Aging Effects through the Redox-Modulation" Molecules 27, no. 15: 4952. https://doi.org/10.3390/molecules27154952
APA StyleNiu, Y., Liao, J., Zhou, H., Wang, C.-c., Wang, L., & Fan, Y. (2022). Flavonoids from Lycium barbarum Leaves Exhibit Anti-Aging Effects through the Redox-Modulation. Molecules, 27(15), 4952. https://doi.org/10.3390/molecules27154952